Dataset for CDS BCL2L1 of organism Mastacembelus armatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3MX20_BCL2L1-      atgtctcaa---aacagggaactggtggttttctacataaaatataaact
A0A3Q3NFM4_BCL2L1-      atgtcgtacagtaacagagagctggtggagttctttattagctacaagct
A0A3Q3NFM4_BCL2L1-      atgtcgtacagtaacagagagctggtggagttctttattagctacaagct
                        *****  *    ***** ** *******  ****  ** *  ** ** **

A0A3Q3MX20_BCL2L1-      ctcccagagaaactatcct-ctcatctacatagaactcaatgagcaacag
A0A3Q3NFM4_BCL2L1-      gtctcagaagaactacccgacctctctgc-----------tgag-gccag
A0A3Q3NFM4_BCL2L1-      gtctcagaagaactacccgacctctctgc-----------tgag-gccag
                         ** ****  ***** **  *   *** *           ****   ***

A0A3Q3MX20_BCL2L1-      aacaggactgatgg-gggagaggctgagtcaggtgaggaacagcggatag
A0A3Q3NFM4_BCL2L1-      aagatg-ctggtggaaggacagagggagacatgaccggtgcagctgccac
A0A3Q3NFM4_BCL2L1-      aagatg-ctggtggaaggacagagggagacatgaccggtgcagctgccac
                        ** * * *** ***  *** **   *** ** *   **  **** *  * 

A0A3Q3MX20_BCL2L1-      caac-----gcatgccaacgggacttttaatggcacaagtcctgggaccc
A0A3Q3NFM4_BCL2L1-      caacggcttgctggtcaacagcaggtatgtcagcggccggccgggga---
A0A3Q3NFM4_BCL2L1-      caacggcttgctggtcaacagcaggtatgtcagcggccggccgggga---
                        ****     **  * **** * *  * *    **    * ** ****   

A0A3Q3MX20_BCL2L1-      ccccagcgtccccgctgcgacaagaacatttgcagtccacggcaagcctg
A0A3Q3NFM4_BCL2L1-      tgtcatcatcccc------------acat------------ggaggcgta
A0A3Q3NFM4_BCL2L1-      tgtcatcatcccc------------acat------------ggaggcgta
                           ** * *****            ****            * * ** * 

A0A3Q3MX20_BCL2L1-      gatgcagtgaaagaggccctccgggactcagccaacgagtttgagctacg
A0A3Q3NFM4_BCL2L1-      gaggctgtaaaggcagctcttagggactccgctgaagagtttgaactgct
A0A3Q3NFM4_BCL2L1-      gaggctgtaaaggcagctcttagggactccgctgaagagtttgaactgct
                        ** ** ** ** *  ** **  ******* **  * ******** ** * 

A0A3Q3MX20_BCL2L1-      atacgcccgtgctttcagcgatctgcacaaccagctgcatatcacgccag
A0A3Q3NFM4_BCL2L1-      cttcactcaggcgtttagtgacctttcctcacagcttgacatcactcctg
A0A3Q3NFM4_BCL2L1-      cttcactcaggcgtttagtgacctttcctcacagcttgacatcactcctg
                         * * * *  ** ** ** ** **   *   *****  * ***** ** *

A0A3Q3MX20_BCL2L1-      ccacggcctaccaaagcttcgagagtgtgatggatgaagtgttccgggac
A0A3Q3NFM4_BCL2L1-      acacagcttaccacagctttaaaagcgtgatggatgaggtgttcaaggat
A0A3Q3NFM4_BCL2L1-      acacagcttaccacagctttaaaagcgtgatggatgaggtgttcaaggat
                         *** ** ***** *****  * ** *********** ******  *** 

A0A3Q3MX20_BCL2L1-      ggtgtcaactggggtcgcatcatagggctttttgcattcggcggggctct
A0A3Q3NFM4_BCL2L1-      ggagtcaactggggacgcatagtgggcctgtttgctttcggtggtgtact
A0A3Q3NFM4_BCL2L1-      ggagtcaactggggacgcatagtgggcctgtttgctttcggtggtgtact
                        ** *********** *****  * ** ** ***** ***** ** *  **

A0A3Q3MX20_BCL2L1-      gtgtgtcgagtgtgtggagaaggagatgagtccactggtgggcaggattg
A0A3Q3NFM4_BCL2L1-      gtgtgtggaatgcattgagaagaacatgagtgcgctggtgtcccgcatcg
A0A3Q3NFM4_BCL2L1-      gtgtgtggaatgcattgagaagaacatgagtgcgctggtgtcccgcatcg
                        ****** ** **  * ****** * ****** * ******  * * ** *

A0A3Q3MX20_BCL2L1-      tggagtggatgaccctctacctggacaaccacattgagccctggatccaa
A0A3Q3NFM4_BCL2L1-      cagattggatgaccatgtatctggatgagcacatcagtccgtggatcgag
A0A3Q3NFM4_BCL2L1-      cagattggatgaccatgtatctggatgagcacatcagtccgtggatcgag
                          ** ********* * ** *****  * *****    ** ****** * 

A0A3Q3MX20_BCL2L1-      agccagggaggatgggagcactttgctgaaatctttgggcaggatgcagc
A0A3Q3NFM4_BCL2L1-      agccaaggaggctgggactgctttgctgagatttttgggcgagatgcagc
A0A3Q3NFM4_BCL2L1-      agccaaggaggctgggactgctttgctgagatttttgggcgagatgcagc
                        ***** ***** *****   ********* ** *******  ********

A0A3Q3MX20_BCL2L1-      agcagagagcaggaggtcccaagagaatttcaagaagtggctgctggcag
A0A3Q3NFM4_BCL2L1-      tgcagaagcaaggagatcacaggaaaccctgaggaggtggctgctagttg
A0A3Q3NFM4_BCL2L1-      tgcagaagcaaggagatcacaggaaaccctgaggaggtggctgctagttg
                         *****    ***** ** ** ** *   * * ** ********* *  *

A0A3Q3MX20_BCL2L1-      ggatgacgctggtgactggggtcgtggtgggttcacttattgcccagaaa
A0A3Q3NFM4_BCL2L1-      gagtggcgctgctaacgggagtgctgataggtgtgctcatcgctaagaaa
A0A3Q3NFM4_BCL2L1-      gagtggcgctgctaacgggagtgctgataggtgtgctcatcgctaagaaa
                        *  ** ***** * ** ** **  ** * ***   ** ** **  *****

A0A3Q3MX20_BCL2L1-      cgcctgtga
A0A3Q3NFM4_BCL2L1-      ca---gtga
A0A3Q3NFM4_BCL2L1-      ca---gtga
                        *    ****

© 1998-2020Legal notice