Dataset for CDS MCL-1 of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A5F8GAQ2_MCL1-03      atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactg
A0A5F8GAQ2_MCL1-01      atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactg
A0A5F8GAQ2_MCL1-02      atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactg

A0A5F8GAQ2_MCL1-03      tggcggggcagggatgggcgccggcggcggcgccagcggtcccccgtccg
A0A5F8GAQ2_MCL1-01      tggcggggcagggatgggcgccggcggcggcgccagcggtcccccgtccg
A0A5F8GAQ2_MCL1-02      tggcggggcagggatgggcgccggcggcggcgccagcggtcccccgtccg

A0A5F8GAQ2_MCL1-03      gcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccg
A0A5F8GAQ2_MCL1-01      gcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccg
A0A5F8GAQ2_MCL1-02      gcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccg

A0A5F8GAQ2_MCL1-03      ccgcagcgcgatggaggggaagtggaaacagggacggcgggggcagggtt
A0A5F8GAQ2_MCL1-01      ccgcagcgcgatggaggggaagtggaaacagggacggcgggggcagggtt
A0A5F8GAQ2_MCL1-02      ccgcagcgcgatggaggggaagtggaaacagggacggcgggggcagggtt

A0A5F8GAQ2_MCL1-03      gattggcggaggaatccgtgcgagtcctccgaatcctgtctcgccgggcg
A0A5F8GAQ2_MCL1-01      gattggcggaggaatccgtgcgagtcctccgaatcctgtctcgccgggcg
A0A5F8GAQ2_MCL1-02      gattggcggaggaatccgtgcgagtcctccgaatcctgtctcgccgggcg

A0A5F8GAQ2_MCL1-03      cccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtc
A0A5F8GAQ2_MCL1-01      cccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtc
A0A5F8GAQ2_MCL1-02      cccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtc

A0A5F8GAQ2_MCL1-03      accaccgatccgatgccgagcctgttcgcgccgggccgctgctcgtcggc
A0A5F8GAQ2_MCL1-01      accaccgatccgatgccgagcctgttcgcgccgggccgctgctcgtcggc
A0A5F8GAQ2_MCL1-02      accaccgatccgatgccgagcctgttcgcgccgggccgctgctcgtcggc

A0A5F8GAQ2_MCL1-03      gcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg
A0A5F8GAQ2_MCL1-01      gcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg
A0A5F8GAQ2_MCL1-02      gcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg

A0A5F8GAQ2_MCL1-03      aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgc
A0A5F8GAQ2_MCL1-01      aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgc
A0A5F8GAQ2_MCL1-02      aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgc

A0A5F8GAQ2_MCL1-03      ctggctgtgctggaaatagcccgggaaggtggggacagcccgaacggctc
A0A5F8GAQ2_MCL1-01      ctggctgtgctggaaatagcccgggaaggtggggacagcccgaacggctc
A0A5F8GAQ2_MCL1-02      ctggctgtgctggaaatagcccgggaaggtggggacagcccgaacggctc

A0A5F8GAQ2_MCL1-03      tttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaac
A0A5F8GAQ2_MCL1-01      tttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaac
A0A5F8GAQ2_MCL1-02      tttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaac

A0A5F8GAQ2_MCL1-03      tatacgggcagtccttggagctcatcagccggtaccttcgcgagcaggcg
A0A5F8GAQ2_MCL1-01      tatacgggcagtccttggagctcatcagccggtaccttcgcgagcaggcg
A0A5F8GAQ2_MCL1-02      tatacgggcagtccttggagctcatcagccggtaccttcgcgagcaggcg

A0A5F8GAQ2_MCL1-03      gttggcacgaaggaggccaagcccctacgcagcggcaaggccttagagac
A0A5F8GAQ2_MCL1-01      gttggcacgaaggaggccaagcccctacgcagcggcaaggccttagagac
A0A5F8GAQ2_MCL1-02      gttggcacgaaggaggccaagcccctacgcagcggcaaggccttagagac

A0A5F8GAQ2_MCL1-03      cctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttcc
A0A5F8GAQ2_MCL1-01      cctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttcc
A0A5F8GAQ2_MCL1-02      cctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttcc

A0A5F8GAQ2_MCL1-03      aaggcatgcttcggaaattggatatcaaaaacgaagaggatattaaagct
A0A5F8GAQ2_MCL1-01      aaggcatgcttcggaaattggatatcaaaaacgaagaggatattaaagct
A0A5F8GAQ2_MCL1-02      aaggcatgcttcggaaattggatatcaaaaacgaagaggatattaaagct

A0A5F8GAQ2_MCL1-03      gtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg
A0A5F8GAQ2_MCL1-01      gtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg
A0A5F8GAQ2_MCL1-02      gtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg

A0A5F8GAQ2_MCL1-03      caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttga
A0A5F8GAQ2_MCL1-01      caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttga
A0A5F8GAQ2_MCL1-02      caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttga

A0A5F8GAQ2_MCL1-03      agagcataaaccaggaaagttgcatagacccgctagcagaaagcataaca
A0A5F8GAQ2_MCL1-01      agagcataaaccaggaaagttgcatagacccgctagcagaaagcataaca
A0A5F8GAQ2_MCL1-02      agagcataaaccaggaaagttgcatagacccgctagcagaaagcataaca

A0A5F8GAQ2_MCL1-03      gatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctg
A0A5F8GAQ2_MCL1-01      gatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctg
A0A5F8GAQ2_MCL1-02      gatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctg

A0A5F8GAQ2_MCL1-03      ggagggatttgtggaattctttcatgtacaggacctagaaggtggcatca
A0A5F8GAQ2_MCL1-01      gaaagg------------cctccttgctcaagacacggaagaagccaccc
A0A5F8GAQ2_MCL1-02      gtcag-------------------------------ggaaggagagagtg
                        *   *                                ****  *  *   

A0A5F8GAQ2_MCL1-03      gaaatg----------------------------------------tgct
A0A5F8GAQ2_MCL1-01      gaaccggcgatccctgcgccccctcctcggcatacctcctcctctgcgca
A0A5F8GAQ2_MCL1-02      gatcca-------------------------------------------a

A0A5F8GAQ2_MCL1-03      gctcgcctttgccggtgttgctggagta-ggagctggtttggcatat---
A0A5F8GAQ2_MCL1-01      gaacccttgttctggtggtgccagctcacagcatcgggctgtcatgttcc
A0A5F8GAQ2_MCL1-02      gaggccttgt----------------------------------------
                        *    * * *                                        

A0A5F8GAQ2_MCL1-03      -----------------------ctaataagatag---------------
A0A5F8GAQ2_MCL1-01      ggataagcccaggaatgtgcttactgaggagagaaaatgggctgcctcgc
A0A5F8GAQ2_MCL1-02      -----------------------ctcaggaggaaa---------------
                                               ** *  **  *                

A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      tgcaacgttctcacaacaaattctccacttcaatgataactcatggactc
A0A5F8GAQ2_MCL1-02      -------------------------------------------------c

A0A5F8GAQ2_MCL1-03      ---
A0A5F8GAQ2_MCL1-01      tag
A0A5F8GAQ2_MCL1-02      tga

© 1998-2022Legal notice