Dataset for CDS MCL-1 of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6ZMX1_MCL1-03      atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggca
F6ZMX1_MCL1-01      atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggca
F6ZMX1_MCL1-02      atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggca
                    ************************************************************

F6ZMX1_MCL1-03      gggatgggcgccggcggcggcgccagcggtcccccgtccggcgggcgcctgctagcttct
F6ZMX1_MCL1-01      gggatgggcgccggcggcggcgccagcggtcccccgtccggcgggcgcctgctagcttct
F6ZMX1_MCL1-02      gggatgggcgccggcggcggcgccagcggtcccccgtccggcgggcgcctgctagcttct
                    ************************************************************

F6ZMX1_MCL1-03      ggcaaaggccctacggttgagagtactccgccgcagcgcgatggaggggaagtggaaaca
F6ZMX1_MCL1-01      ggcaaaggccctacggttgagagtactccgccgcagcgcgatggaggggaagtggaaaca
F6ZMX1_MCL1-02      ggcaaaggccctacggttgagagtactccgccgcagcgcgatggaggggaagtggaaaca
                    ************************************************************

F6ZMX1_MCL1-03      gggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
F6ZMX1_MCL1-01      gggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
F6ZMX1_MCL1-02      gggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
                    ************************************************************

F6ZMX1_MCL1-03      tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtc
F6ZMX1_MCL1-01      tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtc
F6ZMX1_MCL1-02      tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtc
                    ************************************************************

F6ZMX1_MCL1-03      accaccgatccgatgccgagcctgttcgcgccgggccgctgctcgtcggcgcccgccgag
F6ZMX1_MCL1-01      accaccgatccgatgccgagcctgttcgcgccgggccgctgctcgtcggcgcccgccgag
F6ZMX1_MCL1-02      accaccgatccgatgccgagcctgttcgcgccgggccgctgctcgtcggcgcccgccgag
                    ************************************************************

F6ZMX1_MCL1-03      gtggccgatggggctgcggacgtcccaatgtgccctgaggaggaactggacggttacgag
F6ZMX1_MCL1-01      gtggccgatggggctgcggacgtcccaatgtgccctgaggaggaactggacggttacgag
F6ZMX1_MCL1-02      gtggccgatggggctgcggacgtcccaatgtgccctgaggaggaactggacggttacgag
                    ************************************************************

F6ZMX1_MCL1-03      cccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
F6ZMX1_MCL1-01      cccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
F6ZMX1_MCL1-02      cccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
                    ************************************************************

F6ZMX1_MCL1-03      ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaa
F6ZMX1_MCL1-01      ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaa
F6ZMX1_MCL1-02      ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaa
                    ************************************************************

F6ZMX1_MCL1-03      gaggatgaactatacgggcagtccttggagctcatcagccggtaccttcgcgagcaggcg
F6ZMX1_MCL1-01      gaggatgaactatacgggcagtccttggagctcatcagccggtaccttcgcgagcaggcg
F6ZMX1_MCL1-02      gaggatgaactatacgggcagtccttggagctcatcagccggtaccttcgcgagcaggcg
                    ************************************************************

F6ZMX1_MCL1-03      gttggcacgaaggaggccaagcccctacgcagcggcaaggccttagagaccctgcgacgc
F6ZMX1_MCL1-01      gttggcacgaaggaggccaagcccctacgcagcggcaaggccttagagaccctgcgacgc
F6ZMX1_MCL1-02      gttggcacgaaggaggccaagcccctacgcagcggcaaggccttagagaccctgcgacgc
                    ************************************************************

F6ZMX1_MCL1-03      gtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
F6ZMX1_MCL1-01      gtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
F6ZMX1_MCL1-02      gtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
                    ************************************************************

F6ZMX1_MCL1-03      gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagt
F6ZMX1_MCL1-01      gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagt
F6ZMX1_MCL1-02      gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagt
                    ************************************************************

F6ZMX1_MCL1-03      gacggtataacaaactggggcaggattgtgactctcatttctttcggtgcctttgtggca
F6ZMX1_MCL1-01      gacggtataacaaactggggcaggattgtgactctcatttctttcggtgcctttgtggca
F6ZMX1_MCL1-02      gacggtataacaaactggggcaggattgtgactctcatttctttcggtgcctttgtggca
                    ************************************************************

F6ZMX1_MCL1-03      aagcacttgaagagcataaaccaggaaagttgcatagacccgctagcagaaagcataaca
F6ZMX1_MCL1-01      aagcacttgaagagcataaaccaggaaagttgcatagacccgctagcagaaagcataaca
F6ZMX1_MCL1-02      aagcacttgaagagcataaaccaggaaagttgcatagacccgctagcagaaagcataaca
                    ************************************************************

F6ZMX1_MCL1-03      gatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctgggagggattt
F6ZMX1_MCL1-01      gatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctggaaagg----
F6ZMX1_MCL1-02      gatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctggtcag-----
                    ***************************************************   *     

F6ZMX1_MCL1-03      gtggaattctttcatgtacaggacctagaaggtggcatcagaaatg--------------
F6ZMX1_MCL1-01      --------cctccttgctcaagacacggaagaagccacccgaaccggcgatccctgcgcc
F6ZMX1_MCL1-02      --------------------------ggaaggagagagtggatcca--------------
                                               ****  *  *   **                  

F6ZMX1_MCL1-03      --------------------------tgctgctcgcctttgccggtgttgctggagta-g
F6ZMX1_MCL1-01      ccctcctcggcatacctcctcctctgcgcagaacccttgttctggtggtgccagctcaca
F6ZMX1_MCL1-02      -----------------------------agaggccttgt--------------------
                                                  *    * * *                    

F6ZMX1_MCL1-03      gagctggtttggcatat--------------------------ctaataagatag-----
F6ZMX1_MCL1-01      gcatcgggctgtcatgttccggataagcccaggaatgtgcttactgaggagagaaaatgg
F6ZMX1_MCL1-02      -------------------------------------------ctcaggaggaaa-----
                                                               ** *  **  *      

F6ZMX1_MCL1-03      ------------------------------------------------------------
F6ZMX1_MCL1-01      gctgcctcgctgcaacgttctcacaacaaattctccacttcaatgataactcatggactc
F6ZMX1_MCL1-02      -----------------------------------------------------------c
                                                                                

F6ZMX1_MCL1-03      ---
F6ZMX1_MCL1-01      tag
F6ZMX1_MCL1-02      tga
                       

© 1998-2020Legal notice