Dataset for CDS Unclassified of organism Denticeps clupeoides

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C3ZRU8_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Denticeps clupeoides (length=372 residues).
cgcaccgccgccatggccagcgacgttccccacgacagccgcgccatcgagctgttccgggacggcgtcaactggggacg
cgtcgtggcgttcttcgagttcggcggcgccgtgtgcgtggagagcgtgggccgccaggcgagcccgcaggtggagaacg
tcacgcagtggatgacggagtacctggacggacccctgcgcgtctggatcgaggacaacggaggatgggtaagatgcgcg
acgtcctcctcgcacctggacaggtgtccccctggagacacggaagtgctgctccccgggcgcctgtcatggtgcccact
gacacatttcactgtgtgcaccgtgtgctgtgctgctgagtatcacatgtga
>gnl|bcl2dbcds|A0A8C4B0G6_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Denticeps clupeoides (length=555 residues).
atggctcacgacaaccgcagcatcgtggagaagtacctccggcacaagctggtgaagaggggcttggcgtgggaggggcc
gcggagcccgggtccgccggacgcgccgctggaccgggtgctgcgggaggccggggacgagctggagcggctctaccagc
ccgacttcgtcgagatgtcccggcagctgcagctgacggcggtcgccgcggagcgccgcttcaccgccgtgatggacgag
ctgttccgggacggggtgaactggggtcggatcatcgcctttttcgagttcggggggacggtgtgtgtcgagtgcgtcaa
ccgggaaatgacggcgcaggtggacaacatcgcgggatggatgaccgagtatctggacggaccgctgcaggcgtggatcc
aggagaacgggggctgggaggcctttgtggagctctacgggcagcagcagagcagcgcgttccgcagctcctggtcgtcc
atcgcatccgtcttcgggctggcagcgctgggcgccgtgggtctgaccatcggggcgtacctggctcagaagtga
>gnl|bcl2dbcds|A0A8C4B5U0_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Denticeps clupeoides (length=735 residues).
atgtcacagagccccgccgccagcttcttcatatccaacggagttgtggacaaaggaattttgcgctgcgaaccgaccat
ggatctgtcgaactatccagctcctctaacccaagatttttgtccgggagctgggaaaaccgggaagtgttgtttgctta
ggcccaacaacctagtgagacacgggttccagaacagcttcaccggaagtgatgttacggacgggtccctgccgtcttct
cccgaagaggccgaaccctcaactttcccaagccccgacgcgctggaaaacgacacgcgggacctgatcgagcgggccgc
gctgaaaaccattgatctgttttataacgttacctttgcttccgcaggcatgattaataagcttaaagtggaagagcagc
ctggtgatctgaccgtggtctcgagcattgccaaggagctgttcagtgatggcaaaacaaactgggggcgcatcgccagc
ctggtggccttcggggccctcctgagcaaacatctgagggagaagggacacggggacagtgtgagcctggtggcccacga
gatctcgtcctacctcctctcagaccagctcaactggctgatcaaaaacaacaaatgggagggatttgtacagttctttc
acattgaagacccagagacgacagtgagaacggcgctcatgaaaatcgtgggagttgtggggattggagcggggctcgct
ttcctcctgaaatga
>gnl|bcl2dbcds|A0A8C4FRZ1_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Denticeps clupeoides (length=555 residues).
atggccagcgacgttccccacgacagccgcgccatcgtggagagctacgtgtaccaccgactcctgcagaagggccacgc
gtgggaccgaggcgcgcccccgcggcgggacgaggcgcgcggccgcctgcagcgcgcgctccgccgcgccggggacgagc
tggagaggatgttccgccgggacctggcgtccgtgggccggcggctgcggctgagccgcgggaccttctccgccgtggtg
gaggagctgttccgggacggcgtcaactggggacgcgtcgtggcgttcttcgagttcggcggcgccgtgtgcgtggagag
cgtgggccgccaggcgagcccgcaggtggagaacgtcacgcagtggatgacggagtacctggacggacccctgcgcgtct
ggatcgaggacaacggaggatgggacgcgtttgtggagctgtatggacagcaggaggactctgtcctgtcctggacgtat
ctgaagacaatgttcggtctggcagccctgggcgtggccggcgtcacccttggggccttcttcatacagaagtga
© 1998-2022Legal notice