Dataset for CDS BCL-2-like of organism Strix occidentalis caurina

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8D0ELW8_BCL2A1-      atg-----------------------------------gaaactgctgag
A0A8D0FVP8_MCL1-01      atg------------------------------------tgtgtgcttgc
A0A8D0FHG7_BCL2L1-      atg-----tccag-------------cagtaaccgggagttagtgattga
A0A8D0G0L7_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
                        ***                                        ** *   

A0A8D0ELW8_BCL2A1-      ttctattacgtttattacttagctcaag-------------attatctgc
A0A8D0FVP8_MCL1-01      ctcta--aaccagcatctcttgcaggaatgcttcgg-------aagctgg
A0A8D0FHG7_BCL2L1-      ctttgtttcctacaagctctcgcagaagggatacagctggagtcagctgg
A0A8D0G0L7_BCL2-01      gtacatccactataaactctcgcagaggggatacgactgg-----gctgc
                         *                 * **                       *** 

A0A8D0ELW8_BCL2A1-      aatatgtgcttcaggag------------------------tcacatctt
A0A8D0FVP8_MCL1-01      aaatccagaaagaggaa---------------------------------
A0A8D0FHG7_BCL2L1-      aggaggaggatgagaacagga---------------------------ct
A0A8D0G0L7_BCL2-01      cgg-------cgaggacagggcacccctgcctccgggtctctctcctcct
                                    ** *                                  

A0A8D0ELW8_BCL2A1-      g--------------------------------------------gacca
A0A8D0FVP8_MCL1-01      ---------------------------------------------gat--
A0A8D0FHG7_BCL2L1-      gactttgcagtggaggacgccga----------------------gat--
A0A8D0G0L7_BCL2-01      gctgctgctgctgcggtcgctgctgctgctgctgggacttcctctgatca
                                                                     **   

A0A8D0ELW8_BCL2A1-      ---------------gcccaaaccagggttgctcatgtc------ttgcg
A0A8D0FVP8_MCL1-01      ---------------------------------------------ctgca
A0A8D0FHG7_BCL2L1-      -----ggacggcg--tcctcaacgggagcccctcctggcacccgcccgcc
A0A8D0G0L7_BCL2-01      cactgggctggtgtctccgcaccccgagccccccggctcggctg-ctgct
                                                                       ** 

A0A8D0ELW8_BCL2A1-      aaacatt-------------------gcatcttcgctgcaagatcaaacc
A0A8D0FVP8_MCL1-01      atcagtgt------------------gtgaagtggctg----------cc
A0A8D0FHG7_BCL2L1-      agccacgtagtgaacggagccgccgtgcaccggagc--agcctcgaagtc
A0A8D0G0L7_BCL2-01      agccacgc----------gcccccg-gccgaggggctgcgccccgcaccc
                        *                         *       **             *

A0A8D0ELW8_BCL2A1-      gagg----------------------------------------------
A0A8D0FVP8_MCL1-01      cacg----------------------------------------------
A0A8D0FHG7_BCL2L1-      catggaatcgttcaagcggccgatgtgaggcaggcgctgagagaggcggg
A0A8D0G0L7_BCL2-01      cagg---tcgtccacctcgcc---------------ctgcgccaggcggg
                         * *                                              

A0A8D0ELW8_BCL2A1-      --------------------------aggctctcagaccattcttggaca
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      ggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttccc
A0A8D0G0L7_BCL2-01      cgatgagttctcccgccgctaccagagggactttgcccaaatgtccggcc
                                                                          

A0A8D0ELW8_BCL2A1-      ggattgatattacctctgtagctgt-tgccaagagaattttcaatggtgt
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      agctccacatcacccctggcacggcgtatcaga----gctttgagcaggt
A0A8D0G0L7_BCL2-01      agctgcacctgacgcccttcacggc----caggggccgcttcgtggcagt
                                                                          

A0A8D0ELW8_BCL2A1-      catgcaagaaaaatttgctgatggaaatactaactggggacgaattatga
A0A8D0FVP8_MCL1-01      -----------tgttcagtgatggagtaacaaactggggtagagtggtga
A0A8D0FHG7_BCL2L1-      agtgaacgaactcttccgcgatggagt---gaactggggtcgcatcgtgg
A0A8D0G0L7_BCL2-01      ggtggaggagctcttccgagacggggt---taactggggcaggattgtgg
                                     **    ** **       ********  *  *  ** 

A0A8D0ELW8_BCL2A1-      ccatatttacgtttggaggtcttctcactaagaagcttcaagagcat---
A0A8D0FVP8_MCL1-01      cgctcatctcgtttggtgcctttgttgcgaaa-cacctgaagagcataaa
A0A8D0FHG7_BCL2L1-      ctttcttctccttcggagga------gccttg-tgcgtggagagcgttga
A0A8D0G0L7_BCL2-01      ccttcttcgagtttggcggc------gtgatg-tgcgtggagagcgtcaa
                        *  *  *    ** ** *                 * *  ***** *   

A0A8D0ELW8_BCL2A1-      ---ggag------ttcagctcactggagaggagaaggagcagatttctta
A0A8D0FVP8_MCL1-01      ccaggagaagtgcatcagctcgctggcagggatc--------atcac---
A0A8D0FHG7_BCL2L1-      caaggagatgcgggta------ttggtgggacgc--------attgtatc
A0A8D0G0L7_BCL2-01      ccgggagatgtctccc------cttgtagacagc--------atcgccgc
                           ****                * *                **      

A0A8D0ELW8_BCL2A1-      tttcatcacagagtacataataaacaacaaagccgaatggatagatgcaa
A0A8D0FVP8_MCL1-01      --ggacgcactcgt--ctcatcgaa-----gcgcgagtggctaatgagcc
A0A8D0FHG7_BCL2L1-      ttggatgaccatgtacttgaccgaccacctagatccctggatccaggaga
A0A8D0G0L7_BCL2-01      ctggatgaccgagtacctgaaccggcacctgcacaactggatccaggaca
                            *       **   * *                 *** *        

A0A8D0ELW8_BCL2A1-      acggtggctgggaaaatggcttcctaacgaagtttgaa------------
A0A8D0FVP8_MCL1-01      aaggaggctggg---agggctttgtcgacttctttcgagtcga-------
A0A8D0FHG7_BCL2L1-      atggcggatggg---agcggtttgtggacctctacgggaacgatgctgct
A0A8D0G0L7_BCL2-01      acggaggctggg---atgccttcgtcgagttgtatggcaacagt------
                        * ** ** ****   *    **  *       *                 

A0A8D0ELW8_BCL2A1-      -------------------agaagatcactactatctttctccaaaatta
A0A8D0FVP8_MCL1-01      --------------ggacctggaaggcagcatcagaaatgtactga----
A0A8D0FHG7_BCL2L1-      gccgaggtgaggaagggccaggagaccttcaacaaatggctcctga----
A0A8D0G0L7_BCL2-01      -------------------atgaggcctttgtttgatttctcctggatct
                                              *   *             * *       

A0A8D0ELW8_BCL2A1-      cagccatattcatagctgttttctccttattcagagagta----------
A0A8D0FVP8_MCL1-01      ------tggcgtttgcaggtgtggctggactgggagcgag-------ctt
A0A8D0FHG7_BCL2L1-      ccggggcgacggtggcaggagtgcttctgctgggatc----------cct
A0A8D0G0L7_BCL2-01      ctctgaagactatcctgagtctggttctggtgggagcttgcatcactctt
                                    *        *        *  **               

A0A8D0ELW8_BCL2A1-      -----------------ctactga
A0A8D0FVP8_MCL1-01      g--gcctacatgatccg---gtga
A0A8D0FHG7_BCL2L1-      g--------ctgagccgcaagtga
A0A8D0G0L7_BCL2-01      ggcgcttatctcggacataagtag
                                             *  

© 1998-2023Legal notice