Dataset for CDS BOK of organism Equus caballus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|F7CDD0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Equus caballus GN=BOK (length=642 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggcagggagttcgtgcacgcgcggctgctgcgcgctggcctcgcctggagcgcgcccg
agcgtgccgcccctgcccccggcggccgcctggcagaggtgtgcgcggtgctgctgcgcctgggagatgagctggagctg
atccggcccagtgtctaccgcaacgtggctcgccagctgaacatctcactgcagtctgagaccgtggtgactgacgcctt
cctggctgtgtctgcccagatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtacttggtggctgcggggc
tggccgtggactgcgtgcggcaggcccagcccgccatggtccatgctctcgttgactgcctcggggagtttgtgcgcaag
accctggcgacctggctgcggaggcgtggcggatggactgacgtcctcaagtgtgtggtcagcacggaccccggctaccg
ctcccattggctcgtggctgcgttctgcagtgtcggccgcttcctgaaggctgccttcttcatgctgttgccagagagat
ga
>gnl|bcl2dbcds|F7CDD0_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Equus caballus GN=BOK (length=705 residues).
atgggggatgtggctggtccagctgaccctggaggtgcggcgccccccgcccgcgtccccgccatggaggtgctgcggcg
ctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagctggtggcccaggccaagg
cgctcggcagggagttcgtgcacgcgcggctgctgcgcgctggcctcgcctggagcgcgcccgagcgtgccgcccctgcc
cccggcggccgcctggcagaggtgtgcgcggtgctgctgcgcctgggagatgagctggagctgatccggcccagtgtcta
ccgcaacgtggctcgccagctgaacatctcactgcagtctgagaccgtggtgactgacgccttcctggctgtgtctgccc
agatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtacttggtggctgcggggctggccgtggactgcgtg
cggcaggcccagcccgccatggtccatgctctcgttgactgcctcggggagtttgtgcgcaagaccctggcgacctggct
gcggaggcgtggcggatggactgacgtcctcaagtgtgtggtcagcacggaccccggctaccgctcccattggctcgtgg
ctgcgttctgcagtgtcggccgcttcctgaaggctgccttcttcatgctgttgccagagagatga
© 1998-2024Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice