Dataset for CDS MCL-1 of organism Paramormyrops kingsleyae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B3R4U0_MCL1-01      atgaatc---------tgatcaatcgtaccacggccaccg---gcttgtt
A0A3B3SG34_MCL1-01      atgaatccacaaagcttgaagagttacgcgccgattatggtgagcatgaa
                        *******         ***  * *    *  **   *  *   ** **  

A0A3B3R4U0_MCL1-01      ctgccccgg---cattaaaaatggcgtgaagcagaacggc-ttctacagc
A0A3B3SG34_MCL1-01      ctaccacagacccctgcaccatggcgtcctggggaaaagcattttgcag-
                        ** ** * *   * *  *  *******   *  ***  ** ** * *** 

A0A3B3R4U0_MCL1-01      tttgtatcggcgtctctgc-----ccgtagccccgctcaaagcgaa----
A0A3B3SG34_MCL1-01      --tgtctcgattcgtctgcaagagccgcaaacacaccctgtctggagtcc
                          *** ***     *****     *** *  * * * *     * *    

A0A3B3R4U0_MCL1-01      --------aagcgaagaggagctggaca---gtctggatgaaggcgaacg
A0A3B3SG34_MCL1-01      tccgggttatgggacgacgagctggacaactgtacggacg-aggtggacg
                                * * ** ** **********   **  *** * *** * ***

A0A3B3R4U0_MCL1-01      tttt-----------catggagcgccgaaa---------acagagaggcg
A0A3B3SG34_MCL1-01      tgtgtccctgctcgacaagactcgccaaaagggattctgaaaaagagccg
                        * *            ** *   **** ***         * * **** **

A0A3B3R4U0_MCL1-01      tgattgcgaacaccacttacgggcgtcgggcaacgaagacgggtctttgc
A0A3B3SG34_MCL1-01      tg-tcggggaagccggttgcccgggagcacaaacgcggtcggctcactgc
                        ** * * * *  **  ** *  * *      ****  * *** **  ***

A0A3B3R4U0_MCL1-01      cgtccacgccggg-gacgcc--gccggactgcgggaaaatgctgacgttt
A0A3B3SG34_MCL1-01      cgacttccccggacggcgacttgccagcttacggacccat-ttgtggttt
                        ** *  * ****  * ** *  *** *  * ***    **  **  ****

A0A3B3R4U0_MCL1-01      c----------ccaacagggggctcagccaggagactcatgagcttatcg
A0A3B3SG34_MCL1-01      ctctcgcagcgccgtcgaaatgctggaccaagagactagcgaattaatca
                        *          **  *     ***   *** ******   **  * *** 

A0A3B3R4U0_MCL1-01      ggaccttcttacggacttacagcggcct---cccggcctcggccagccga
A0A3B3SG34_MCL1-01      cgactttcttcgccgaatacacggggctgtgtgcgacattacagagacga
                         *** *****       ****  ** **     ** * *     ** ***

A0A3B3R4U0_MCL1-01      cacaaagcgtaccctgtcctcagacgagtggcggagactgtcataggaaa
A0A3B3SG34_MCL1-01      aacgaggcgctctccacactgaagcgggtggtggcgactgttgtcgaaaa
                         ** * ***  * *    ** *  ** **** ** ******  * * ***

A0A3B3R4U0_MCL1-01      gcacttgatcgcgtacaatggcatgattaaaaaactagaactggataagc
A0A3B3SG34_MCL1-01      acacaagtttgcttacaatggtatgattggaaaactaagtttgaatcagc
                         ***  * * ** ******** ******  *******    ** ** ***

A0A3B3R4U0_MCL1-01      gtggggacgacacaagtttcgtcacgaaggtggccgaggaaatcttcagt
A0A3B3SG34_MCL1-01      agagtgatgacatgaccgtaatcaaaactgtagctgagagaatattcagt
                           * ** ****  *   *  ***  *  ** ** ***  *** ******

A0A3B3R4U0_MCL1-01      gacaaggtcaccaactggggtcgcatcgccagcctgatagcgtttggggg
A0A3B3SG34_MCL1-01      gatggaaccacaaactgggggcgtattgccagccttgtggcctttggggc
                        **      *** ******** ** ** ********  * ** ******* 

A0A3B3R4U0_MCL1-01      tgtcgtgtgcaagtacctgaaagatcacggacagaccaactgcgtggatg
A0A3B3SG34_MCL1-01      agaggtgtgtaaatacctgaaggagactgggcgggagcactgcgtggagg
                         *  ***** ** ******** **    ** * *    ********** *

A0A3B3R4U0_MCL1-01      atgtggcaagccggatcagctgctacctgctggaacaccagagggactgg
A0A3B3SG34_MCL1-01      ctgtggggaagcagatctcctcctacctgctctcagagcagcgacaatgg
                         *****  *  * ****  ** *********   * * *** *  * ***

A0A3B3R4U0_MCL1-01      ctaaaccgtaacaatggctgggagggatttacagacttcttctatatgga
A0A3B3SG34_MCL1-01      ctactcaagaacaaggcctgggatggatttgtggagttctttcatgtaga
                        ***  *   ***** * ****** ******   ** *****  ** * **

A0A3B3R4U0_MCL1-01      agacccagagtccactg---tgcgtaatgctcttgtggcatttgcaggag
A0A3B3SG34_MCL1-01      agacactgaatcgttggtcctccagaaggttcttgt-acatgtttctgag
                        **** * ** **    *   * *  ** * ******  *** *    ***

A0A3B3R4U0_MCL1-01      ttgcaagcctgggggctg---gactt----gctctgttgatgaggtga
A0A3B3SG34_MCL1-01      tgcggatcctttgaattacatgaccttaaagccttgtgcat---gtaa
                        *    * ***  *   *    *** *    **  ***  **   ** *

© 1998-2021Legal notice