Dataset for CDS MCL-1 of organism Varanus komodoensis

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=972 residues).
acgggcctgagcggaactcgccgcgcgcgccgccgccgccgccggggggagcgggacgggacgggccaccctgcgcgctc
gcgcgtccgcggccaatccgcgcgccggcgctgccaggctggcggccccgcgggggccctggccctgctcgggcccctgg
agggggcgccgcgcctgccggagcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgagggcgagctggac
ggctgcgagccggacgccgagggcagcggcggcggcctcgtcccctcgcccaccccctcggtcgcgtcctcgcaggaggg
cgagcccgagccggcggcggcggacgacggcggcggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgc
tggaggtggtgggccggtacctgcgcgaggcggccagccagggccccgcggagggcggcggcggcgccggcaagttcctg
caggggctggtgggccgcttcggggccccccagggcggcgccggcgcggcgtgcgcggatcaggcgctggagacgctccg
ccgggtgggcggcggcatcctcgacaagcaccagctggctttccaaggaatgcttaaaaagatggaaatcaagaaagagg
atgacctgaagtctgtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgactctc
atcgcctttggtgcctttgttgccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaatcat
tacggacgtgctggtgacagataagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttccatg
tagaggacatagaaggcagcatcagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggcatac
atgatccggtga
>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=1110 residues).
atggccgccatgttgaacacgaaggcgatggtgctgtactgcggaagcgccccggcgtcgccgccggtgggggcggcggg
cggcggcggggagggagccggccccgcgctgagccggctccccgagggcctcggcgcgcgcgcgggccggctccccnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnncgcggatcggcggaggggccctggccctgctcgggcccctggagggggcgccgcgcctgccgga
gcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgagggcgagctggacggctgcgagccggacgccgagg
gcagcggcggcggcctcgtcccctcgcccaccccctcggtcgcgtcctcgcaggagggcgagcccgagccggcggcggcg
gacgacggcggcggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgctggaggtggtgggccggtacct
gcgcgaggcggccagccagggccccgcggagggcggcggcggcgccggcaagttcctgcaggggctggtgggccgcttcg
gggccccccagggcggcgccggcgcggcgtgcgcggatcaggcgctggagacgctccgccgggtgggcggcggcatcctc
gacaagcaccagctggctttccaaggaatgcttaaaaagatggaaatcaagaaagaggatgacctgaagtctgtgtcaga
aattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgactctcatcgcctttggtgcctttgttg
ccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaatcattacggacgtgctggtgacagat
aagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttccatgtagaggacatagaaggcagcat
cagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggcatacatgatccggtga
>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=1056 residues).
atggccgccatgttgaacacgaaggcgatggtgctgtactgcggaagcgccccggcgtcgccgccggtgggggcggcggg
cggcggcggggagggagccggccccgcgctgagccggctccccgagggcctcggcgcgcgcgcgggccggctccccnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnncgcggatcggcggaggggccctggccctgctcgggcccctggagggggcgccgcgcctgccgga
gcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgagggcgagctggacggctgcgagccggacgccgagg
gcagcggcggcggcctcgtcccctcgcccaccccctcggtcgcgtcctcgcaggagggcgagcccgagccggcggcggcg
gacgacggcggcggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgctggaggtggtgggccggtacct
gcgcgaggcggccagccagggccccgcggagggcggcggcggcgccggcaagttcctgcaggggctggcgctggagacgc
tccgccgggtgggcggcggcatcctcgacaagcaccagctggctttccaaggaatgcttaaaaagatggaaatcaagaaa
gaggatgacctgaagtctgtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgac
tctcatcgcctttggtgcctttgttgccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaa
tcattacggacgtgctggtgacagataagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttc
catgtagaggacatagaaggcagcatcagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggc
atacatgatccggtga
>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=486 residues).
aacttcctgttagggacaaatgcaatttataagttgagtttaagtggtggcgtggcattgttcttttccatggtatttct
gaaatgcaagtttaatgccaactccatcctttcccacccaggaatgcttaaaaagatggaaatcaagaaagaggatgacc
tgaagtctgtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgactctcatcgcc
tttggtgcctttgttgccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaatcattacgga
cgtgctggtgacagataagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttccatgtagagg
acatagaaggcagcatcagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggcatacatgatc
cggtga
© 1998-2023Legal notice