Dataset for CDS MCL-1 of organism Varanus komodoensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8D2IVC0_MCL1-04      ---------------aact-------------------------------
A0A8D2IVC0_MCL1-01      acgggc-ctgagcggaactcg-----------------ccgc----gcgc
A0A8D2IVC0_MCL1-02      atggccgccatgttgaacacgaaggcgatggtgctgtactgcggaagcgc
A0A8D2IVC0_MCL1-03      atggccgccatgttgaacacgaaggcgatggtgctgtactgcggaagcgc
                                       ***                                

A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      gccgccgccgccgccggggggagcgg--------gacgggacggg---cc
A0A8D2IVC0_MCL1-02      cccggcgtcgccgccggtgggggcggcgggcggcggcggggagggagccg
A0A8D2IVC0_MCL1-03      cccggcgtcgccgccggtgggggcggcgggcggcggcggggagggagccg
                                                                          

A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      accctgcgc---gctcgcgcgtccgcggccaatccgcgcgccggcgctgc
A0A8D2IVC0_MCL1-02      gccccgcgctgagccggctccccgagggcc--tcggcgcgc--gcgcggg
A0A8D2IVC0_MCL1-03      gccccgcgctgagccggctccccgagggcc--tcggcgcgc--gcgcggg
                                                                          

A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      caggct--------------------------------------------
A0A8D2IVC0_MCL1-02      ccggctccccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8D2IVC0_MCL1-03      ccggctccccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8D2IVC0_MCL1-03      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8D2IVC0_MCL1-04      ----------------------------------tcctgttag-------
A0A8D2IVC0_MCL1-01      ----------ggcggccccgcg--ggggccctggccctgctcgggcccct
A0A8D2IVC0_MCL1-02      nnnnnnnnnncgcggatcggcggaggggccctggccctgctcgggcccct
A0A8D2IVC0_MCL1-03      nnnnnnnnnncgcggatcggcggaggggccctggccctgctcgggcccct
                                                           **** * *       

A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      ggagggggcgccgcgcctgccggagcccgcgcgcgcctgcccgcggcccg
A0A8D2IVC0_MCL1-02      ggagggggcgccgcgcctgccggagcccgcgcgcgcctgcccgcggcccg
A0A8D2IVC0_MCL1-03      ggagggggcgccgcgcctgccggagcccgcgcgcgcctgcccgcggcccg
                                                                          

A0A8D2IVC0_MCL1-04      ----------------------------ggacaaatgcaatttataagtt
A0A8D2IVC0_MCL1-01      ccgcgctcccgctgcccgagggcgagctggacggctgcgagccggacgcc
A0A8D2IVC0_MCL1-02      ccgcgctcccgctgcccgagggcgagctggacggctgcgagccggacgcc
A0A8D2IVC0_MCL1-03      ccgcgctcccgctgcccgagggcgagctggacggctgcgagccggacgcc
                                                    ****   *** *     * *  

A0A8D2IVC0_MCL1-04      gagtttaagtggtggc-gtggcattgttctttt--------------cca
A0A8D2IVC0_MCL1-01      gag----ggcagcggcggcggcctcgtcccctcgcccaccccctcggtcg
A0A8D2IVC0_MCL1-02      gag----ggcagcggcggcggcctcgtcccctcgcccaccccctcggtcg
A0A8D2IVC0_MCL1-03      gag----ggcagcggcggcggcctcgtcccctcgcccaccccctcggtcg
                        ***     *  * *** * *** * ** *  *                * 

A0A8D2IVC0_MCL1-04      tggtatttctgaaatgcaagtttaa-------------------------
A0A8D2IVC0_MCL1-01      cgtcctcgcaggagggcgagcccgagccggcggcggcggacgacggcggc
A0A8D2IVC0_MCL1-02      cgtcctcgcaggagggcgagcccgagccggcggcggcggacgacggcggc
A0A8D2IVC0_MCL1-03      cgtcctcgcaggagggcgagcccgagccggcggcggcggacgacggcggc
                         *   *  * * *  ** **    *                         

A0A8D2IVC0_MCL1-04      ------------------tgcca---------------------------
A0A8D2IVC0_MCL1-01      ggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgctgga
A0A8D2IVC0_MCL1-02      ggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgctgga
A0A8D2IVC0_MCL1-03      ggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgctgga
                                          *****                           

A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      ggtggtgggccggtacctgcgcgaggcggccagccagggccccgcggagg
A0A8D2IVC0_MCL1-02      ggtggtgggccggtacctgcgcgaggcggccagccagggccccgcggagg
A0A8D2IVC0_MCL1-03      ggtggtgggccggtacctgcgcgaggcggccagccagggccccgcggagg
                                                                          

A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      gcggcggcggcgccggcaagttcctgcaggggctggtgggccgcttcggg
A0A8D2IVC0_MCL1-02      gcggcggcggcgccggcaagttcctgcaggggctggtgggccgcttcggg
A0A8D2IVC0_MCL1-03      gcggcggcggcgccggcaagttcctgcaggggct----------------
                                                                          

A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      gccccccagggcggcgccggcgcggcgtgcgcggatcaggcgctggagac
A0A8D2IVC0_MCL1-02      gccccccagggcggcgccggcgcggcgtgcgcggatcaggcgctggagac
A0A8D2IVC0_MCL1-03      --------------------------------------ggcgctggagac
                                                                          

A0A8D2IVC0_MCL1-04      actccatc--------------------------------ctttcccacc
A0A8D2IVC0_MCL1-01      gctccgccgggtgggcggcggcatcctcgacaagcaccagctggctttcc
A0A8D2IVC0_MCL1-02      gctccgccgggtgggcggcggcatcctcgacaagcaccagctggctttcc
A0A8D2IVC0_MCL1-03      gctccgccgggtgggcggcggcatcctcgacaagcaccagctggctttcc
                         ****  *                                **  *   **

A0A8D2IVC0_MCL1-04      caggaatgcttaaaaagatggaaatcaagaaagaggatgacctgaagtct
A0A8D2IVC0_MCL1-01      aaggaatgcttaaaaagatggaaatcaagaaagaggatgacctgaagtct
A0A8D2IVC0_MCL1-02      aaggaatgcttaaaaagatggaaatcaagaaagaggatgacctgaagtct
A0A8D2IVC0_MCL1-03      aaggaatgcttaaaaagatggaaatcaagaaagaggatgacctgaagtct
                         *************************************************

A0A8D2IVC0_MCL1-04      gtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggg
A0A8D2IVC0_MCL1-01      gtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggg
A0A8D2IVC0_MCL1-02      gtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggg
A0A8D2IVC0_MCL1-03      gtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggg
                        **************************************************

A0A8D2IVC0_MCL1-04      gcgaattgtgactctcatcgcctttggtgcctttgttgccaagcatctga
A0A8D2IVC0_MCL1-01      gcgaattgtgactctcatcgcctttggtgcctttgttgccaagcatctga
A0A8D2IVC0_MCL1-02      gcgaattgtgactctcatcgcctttggtgcctttgttgccaagcatctga
A0A8D2IVC0_MCL1-03      gcgaattgtgactctcatcgcctttggtgcctttgttgccaagcatctga
                        **************************************************

A0A8D2IVC0_MCL1-04      agaatataaaccaggagagtggcatcagtactttgacagaaatcattacg
A0A8D2IVC0_MCL1-01      agaatataaaccaggagagtggcatcagtactttgacagaaatcattacg
A0A8D2IVC0_MCL1-02      agaatataaaccaggagagtggcatcagtactttgacagaaatcattacg
A0A8D2IVC0_MCL1-03      agaatataaaccaggagagtggcatcagtactttgacagaaatcattacg
                        **************************************************

A0A8D2IVC0_MCL1-04      gacgtgctggtgacagataagcgggaatggctggtcaaccataatgcttg
A0A8D2IVC0_MCL1-01      gacgtgctggtgacagataagcgggaatggctggtcaaccataatgcttg
A0A8D2IVC0_MCL1-02      gacgtgctggtgacagataagcgggaatggctggtcaaccataatgcttg
A0A8D2IVC0_MCL1-03      gacgtgctggtgacagataagcgggaatggctggtcaaccataatgcttg
                        **************************************************

A0A8D2IVC0_MCL1-04      ggaggggtttgttaaattcttccatgtagaggacatagaaggcagcatca
A0A8D2IVC0_MCL1-01      ggaggggtttgttaaattcttccatgtagaggacatagaaggcagcatca
A0A8D2IVC0_MCL1-02      ggaggggtttgttaaattcttccatgtagaggacatagaaggcagcatca
A0A8D2IVC0_MCL1-03      ggaggggtttgttaaattcttccatgtagaggacatagaaggcagcatca
                        **************************************************

A0A8D2IVC0_MCL1-04      gaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttg
A0A8D2IVC0_MCL1-01      gaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttg
A0A8D2IVC0_MCL1-02      gaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttg
A0A8D2IVC0_MCL1-03      gaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttg
                        **************************************************

A0A8D2IVC0_MCL1-04      gcatacatgatccggtga
A0A8D2IVC0_MCL1-01      gcatacatgatccggtga
A0A8D2IVC0_MCL1-02      gcatacatgatccggtga
A0A8D2IVC0_MCL1-03      gcatacatgatccggtga
                        ******************

© 1998-2023Legal notice