Dataset for CDS BAX-like of Organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7ICC2_BAK1-02      atgg-gtctgtgccact--cctgggagct---ggggaggcctg-gggggtcttgcccttc
F7ICC2_BAK1-04      atggcatcggggcaagg--cccaggtcctcccaggcaggagtgcggagagcctgacccac
F7ICC2_BAK1-01      atggcatcggggcaagg--cccaggtcctcccaggcaggagtgcggagagcctgacccac
F7ICC2_BAK1-03      atggcatcggggcaagg--cccaggtcctcccaggcaggagtgcggagagcctgacccac
F6SBR3_BOK-01       atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgcctttgaccgc
F6SBR3_BOK-02       atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgcctttgaccgc
                    ****       **      **   *   *    *    *     **    * *   *  *

F7ICC2_BAK1-02      tctcatggctgctcctctttcatgttgggctcctacccccatccaggaccttgtatcctt
F7ICC2_BAK1-04      cct-----ctgcttct---------------------------gaggagcaggtag----
F7ICC2_BAK1-01      cct-----ctgcttct---------------------------gaggagcaggtag----
F7ICC2_BAK1-03      cct-----ctgcttct---------------------------gaggagcaggtag----
F6SBR3_BOK-01       tcgcccaccgac-------------------------------aaggagctggtgg----
F6SBR3_BOK-02       tcgcccaccgac-------------------------------aaggagctggtgg----
                     *      *  *                                **** *  **      

F7ICC2_BAK1-02      tttatttagcccatgcctgccccttgtcccagag------cccagcattcatgttttaga
F7ICC2_BAK1-04      --------------------cccgggacacagaggaggttttccacagctacgtttttta
F7ICC2_BAK1-01      --------------------cccgggacacagaggaggttttccacagctacgtttttta
F7ICC2_BAK1-03      --------------------cccgggacacagaggaggttttccacagctacgtttttta
F6SBR3_BOK-01       --------------------cccaggccaaggcg------ctcggcag------------
F6SBR3_BOK-02       --------------------cccaggccaaggcg------ctcggcag------------
                                        ***  * *   * *        *  **             

F7ICC2_BAK1-02      acattgtcggggatctccaaggaggggtgcacagggccatggacagcttgggcagaaacc
F7ICC2_BAK1-04      ccgccatcgg---------------------caggaacagg--------aggctgaag--
F7ICC2_BAK1-01      ccgccatcgg---------------------caggaacagg--------aggctgaag--
F7ICC2_BAK1-03      ccgccatcgg---------------------caggaacagg--------aggctgaag--
F6SBR3_BOK-01       ---------------------------------ggagtacgtgcacgcgcggctact---
F6SBR3_BOK-02       ---------------------------------ggagtacgtgcacgcgcggctact---
                                                     **   * *         ***       

F7ICC2_BAK1-02      ctctgccatgatgcaggccctggcccccactgcctggccacctgctcacctgcctgcctc
F7ICC2_BAK1-04      --------------gggcggctgcccctgctgacccagagatggttagcttgtct--ctc
F7ICC2_BAK1-01      --------------gggcggctgcccctgctgacccagagatggttagcttgtct--ctc
F7ICC2_BAK1-03      --------------gggcggctgcccctgctgacccagagatggttagcttgtct--ctc
F6SBR3_BOK-01       --------------gcgcgccggcctctcctggagcg--------------------cgc
F6SBR3_BOK-02       --------------gcgcgccggcctctcctggagcg--------------------cgc
                                    **    *** *  ***                         * *

F7ICC2_BAK1-02      ccgctcacacagcaccat----ggggcaggtgggacggcagctcgctat---------ca
F7ICC2_BAK1-04      caaccta-gcagcaccat----ggggcaggtgggacggcagctcgctat---------ca
F7ICC2_BAK1-01      caaccta-gcagcaccat----ggggcaggtgggacggcagctcgctat---------ca
F7ICC2_BAK1-03      caaccta-gcagcaccat----ggggcaggtgggacggcagctcgctat---------ca
F6SBR3_BOK-01       ccgagcgcgccgcgccgttcccggggcgcctggccgaggtgtgcgcggtgctgctgcgcc
F6SBR3_BOK-02       ccgagcgcgccgcgccgttcccggggcgcctggccgaggtgtgcgcggtgctgctgcgcc
                    *        * ** ** *    *****   ***    *  *  ***  *         * 

F7ICC2_BAK1-02      ttggggatgacatcaaccggcgctatgactcggagtt--ccagaccatgctgcagca---
F7ICC2_BAK1-04      ttggggatgacatcaaccggcgctatgactcggagtt--ccagaccatgctgcagca---
F7ICC2_BAK1-01      ttggggatgacatcaaccggcgctatgactcggagtt--ccagaccatgctgcagca---
F7ICC2_BAK1-03      ttggggatgacatcaaccggcgctatgactcggagtt--ccagaccatgctgcagca---
F6SBR3_BOK-01       tgggggatgagctgga--gatgatccgccccagcgtttaccgcaacgtggcgcgccagct
F6SBR3_BOK-02       tgggggatgagctgga--gatgatccgccccagcgtttaccgcaacgtggcgcgccagct
                    * ********  *  *  *  * *  * * * * ***  **  * * **  **  **   

F7ICC2_BAK1-02      ---------cctgcagcccacggcagagaacgcctacgagtacttcaccaagatcgcctc
F7ICC2_BAK1-04      ---------cctgcagcccacggcagagaacgcctacgagtacttcaccaagatcgcctc
F7ICC2_BAK1-01      ---------cctgcagcccacggcagagaacgcctacgagtacttcaccaagatcgcctc
F7ICC2_BAK1-03      ---------cctgcagcccacggcagagaacgcctacgagtacttcaccaagatcgcctc
F6SBR3_BOK-01       gcacatctccctacagtccgagcctgtggtgaccgatgcattcttggccgtggccggcca
F6SBR3_BOK-02       gcacatctccctacagtccgagcctgtggtgaccgatgcattcttggccgtggccggcca
                             *** *** **  * * * *    ** * *  * ***  **  *  ** *  

F7ICC2_BAK1-02      -----------------cagcctgtttgagagtgg------------catcaactggggc
F7ICC2_BAK1-04      caggt-----accccgaccacctccccg-------------------------ccggact
F7ICC2_BAK1-01      -----------------cagcctgtttgagagtgg------------catcaactggggc
F7ICC2_BAK1-03      caggccagcaacacccacagcctgtttgagagtgg------------catcaactggggc
F6SBR3_BOK-01       -----------------catcttctctgcagg---------------catcacgtgggg-
F6SBR3_BOK-02       -----------------catcttctctgcaggtatgcccagcctgcccatcccctgggac
                                     *  * *    *                           **   

F7ICC2_BAK1-02      cgtgtggtggctctcctgggctttggctacc--------gtct------ggccctacacg
F7ICC2_BAK1-04      c---tggtcactctcctgtcccgtgacaacctcaccatggcct------g--cctatatg
F7ICC2_BAK1-01      cgtgtggtggctctcctgggctttggctacc--------gtct------ggccctacacg
F7ICC2_BAK1-03      cgtgtggtggctctcctgggctttggctacc--------gtct------ggccctacacg
F6SBR3_BOK-01       --caaggtgg-tgtccttgtatgcggtggccgcagggctggc---cgtggactgcgtgag
F6SBR3_BOK-02       ctcagggagg-gatc--------tggggtctgcggctcagtcttacagggaccccacgag
                         **      **         *    *         * *       *         *

F7ICC2_BAK1-02      tcta--ccagcgcggcctgac------------tggcttcctgggccag---gtgacccg
F7ICC2_BAK1-04      -atg--cactcctggcctggg------------agacaccttctgtc-g---gtgtccag
F7ICC2_BAK1-01      tcta--ccagcgcggcctgac------------tggcttcctgggccag---gtgacccg
F7ICC2_BAK1-03      tcta--ccagcgcggcctga----------------------------------------
F6SBR3_BOK-01       gcaggcccagcctgccatggtccacgcccttgttgactgcctgggagagtttgtgcgcaa
F6SBR3_BOK-02       ccagcccctgcccatcctggc--------------gctgccca---------gtgctca-
                          *   *    * **                                         

F7ICC2_BAK1-02      cttcgtgg--tggacttcatgctgcatcactgcatcgcccggtggatcgcacagaggggt
F7ICC2_BAK1-04      tgtctgct--gtgaactcacatgtggtctcggcctcctatttt-----------------
F7ICC2_BAK1-01      cttcgtgg--tggacttcatgctgcatcactgcatcgcccggtggatcgcacagaggggt
F7ICC2_BAK1-03      ------------------------------------------------------------
F6SBR3_BOK-01       gaccctgg--ccacctggctgcggaggcgcggtggatggactgatgtcctcaagtgtgtg
F6SBR3_BOK-02       ----ctggtactatctcgct--------gctgtagatgtctggaactgccca-----gtg
                                                                                

F7ICC2_BAK1-02      ggctgggtggcagccctggacctgggcaatg----------gacccatcctgaatgtgct
F7ICC2_BAK1-04      --------------tctctcttagggtccca----------gactcattcgtattttgtg
F7ICC2_BAK1-01      ggctgggtggcagccctggacctgggcaatg----------gacccatcctgaatgtgct
F7ICC2_BAK1-03      ------------------------------------------------------------
F6SBR3_BOK-01       gtcaacacagaccct--ggcctccgctcccactggctgctcgccgcactctgcagct-tt
F6SBR3_BOK-02       accagtgcggatcctcaggactcaaactaca-------------gcattcagggtct-ct
                                                                                

F7ICC2_BAK1-02      ggtcg--ttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatca
F7ICC2_BAK1-04      cat----------------------------------tagctcacagctcttttcagcac
F7ICC2_BAK1-01      ggtcg--ttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatca
F7ICC2_BAK1-03      ------------------------------------------------------------
F6SBR3_BOK-01       ggccgcttcctgaaggctgcc---ttcttcgtgctcctgccagaga------------ga
F6SBR3_BOK-02       cgtgg--ttctgtgggttggcgggcacgctgggcagctggcacaggctt---------ct
                                                                                

F7ICC2_BAK1-02      tga
F7ICC2_BAK1-04      tga
F7ICC2_BAK1-01      tga
F7ICC2_BAK1-03      ---
F6SBR3_BOK-01       tga
F6SBR3_BOK-02       tga
                       

© 1998-2020Legal notice