Dataset for CDS BCL-2-like of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3HBP6_BCL2A1-      atgac---------------------agactgcg---------------a
A0A2I3HBP6_BCL2A1-      atgac---------------------agactgcg---------------a
A0A2I3HBP6_BCL2A1-      atgac---------------------agactgcg---------------a
G1R3W6_BCL2L10-01       atggttgaccagttgcgggagcgcaccgagcggc----------------
A0A2I3GZF9_BCL2-01      atggc----------gcacgctgggagaacaggg---------tacgata
A0A2I3GJZ3_MCL1-01      atgtt----------tggcctcagaagaaacgcggtaatcggactcaacc
A0A2I3GJZ3_MCL1-03      atgtt----------tggcctcagaagaaacgcggtaatcggactcaacc
A0A2I3GJZ3_MCL1-02      atgtt----------tggcctcagaagaaacgcggtaatcggactcaacc
G1RER8_BCL2L1-01        atgtc---------------tcagagcaaccggg---------------a
A0A2I3GEA7_BCL2L2-      -------------------------------ggg---------------c
A0A2I3GEA7_BCL2L2-      atggcgaccccagcctcggccccagacacacggg---------------c
A0A2I3GEA7_BCL2L2-      atggcgaccccagcctcggccccagacacacggg---------------c
                                                       *                  

A0A2I3HBP6_BCL2A1-      atttggatatatttacaggctagctcaggactatctgcagtacgtcctac
A0A2I3HBP6_BCL2A1-      atttggatatatttacaggctagctcaggactatctgcagtacgtcctac
A0A2I3HBP6_BCL2A1-      atttggatatatttacaggctagctcaggactatctgcagtacgtcctac
G1R3W6_BCL2L10-01       ---------tgctggccgactac------------------------ctg
A0A2I3GZF9_BCL2-01      accgggagatagtgatgaagtacatcca------ttataagctgtcgcag
A0A2I3GJZ3_MCL1-01      tctactgtgggggggccggcttgggggc------cggca-------gcgg
A0A2I3GJZ3_MCL1-03      tctactgtgggggggccggcttgggggc------cggca-------gcgg
A0A2I3GJZ3_MCL1-02      tctactgtgggggggccggcttgggggc------cggca-------gcgg
G1RER8_BCL2L1-01        gct-------ggtggttgactttctctc------ctacaagctttcccag
A0A2I3GEA7_BCL2L2-      tgc-------g--ggcgg---ttcgggg------ctccgggccggggcgg
A0A2I3GEA7_BCL2L2-      tct-------ggtggcagactttgtagg------ttataagctgaggcag
A0A2I3GEA7_BCL2L2-      tct-------ggtggcagactttgtagg------ttataagctgaggcag
                                                                          

A0A2I3HBP6_BCL2A1-      agataccacagcc-------------------------------------
A0A2I3HBP6_BCL2A1-      agataccacagcc-------------------------------------
A0A2I3HBP6_BCL2A1-      agataccacagcc-------------------------------------
G1R3W6_BCL2L10-01       gggtgctgcgccc-------------------------------------
A0A2I3GZF9_BCL2-01      aggggctacgagt-------------------------------------
A0A2I3GJZ3_MCL1-01      cggcgccacccctccgggagggcggcttttggctacggagaaggaggcct
A0A2I3GJZ3_MCL1-03      c-------------------------------------------------
A0A2I3GJZ3_MCL1-02      cggcgccacccctccgggagggcggcttttggctacggagaaggaggcct
G1RER8_BCL2L1-01        aaaggatacagct--------------------------------ggagt
A0A2I3GEA7_BCL2L2-      cggcgccatct-t--------------------------------g----
A0A2I3GEA7_BCL2L2-      aagggttatgtct--------------------------------g----
A0A2I3GEA7_BCL2L2-      aagggttatgtct--------------------------------g----
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       ------------------------gggaacccggc---------------
A0A2I3GZF9_BCL2-01      ---------gggatgcgggagatgtgggcgccgcgcccccgggggccgcc
A0A2I3GJZ3_MCL1-01      cggcccggcgagagatagggggaggggaggccggcgcggtgattggcgga
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      cggcccggcgagagatagggggaggggaggccggcgcggtgattggcgga
G1RER8_BCL2L1-01        cagtttagtgatgtggaagagaacaggactgaggccccagaagggactga
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --tggatcag----------------------------------------
A0A2I3HBP6_BCL2A1-      --tggatcag----------------------------------------
A0A2I3HBP6_BCL2A1-      --tggatcag----------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GZF9_BCL2-01      cccgcaccgggcatcttctcctcccagccggggcacacgccccatccagc
A0A2I3GJZ3_MCL1-01      agcgccggcgcaagccccccgtcagtcctcacacca--------------
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      agcgccggcgcaagccccccgtcagtcctcacacca--------------
G1RER8_BCL2L1-01        atcggagatggagacccccagtgccatcaatggcaacccatcctggcacc
A0A2I3GEA7_BCL2L2-      --t-----------------------------------------------
A0A2I3GEA7_BCL2L2-      --tggagctg----------------------------------------
A0A2I3GEA7_BCL2L2-      --tggagctg----------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      ---------gtccaagca--------------------------------
A0A2I3HBP6_BCL2A1-      ---------gtccaagca--------------------------------
A0A2I3HBP6_BCL2A1-      ---------gtccaagca--------------------------------
G1R3W6_BCL2L10-01       ---------acccccgag--------------------------------
A0A2I3GZF9_BCL2-01      tgc------atcccgggacccggtcgccaggacctcgccgctgccgaccc
A0A2I3GJZ3_MCL1-01      ---------gactcccgg----------agggtcgcgcggccgccgccca
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      ---------gactcccgg----------agggtcgcgcggccgccgccca
G1RER8_BCL2L1-01        tggcggacagccccgcgg----------tgaatggagccactggccacag
A0A2I3GEA7_BCL2L2-      ---------gccccgggg--------------------------------
A0A2I3GEA7_BCL2L2-      ---------gccccgggg----------agg-------------------
A0A2I3GEA7_BCL2L2-      ---------gccccgggg----------agg-------------------
                                                                          

A0A2I3HBP6_BCL2A1-      -aaacgtccagagtgctacaaaacgttgcgttctcagtc-----------
A0A2I3HBP6_BCL2A1-      -aaacgtccagagtgctacaaaacgttgcgttctcagtc-----------
A0A2I3HBP6_BCL2A1-      -aaacgtccagagtgctacaaaacgttgcgttctcagtc-----------
G1R3W6_BCL2L10-01       ---------------ccgacgccgtccacgcccgaggcc-----------
A0A2I3GZF9_BCL2-01      cggctgcccccggcgccgccgcggggcctgcgctcagcccggtgccacct
A0A2I3GJZ3_MCL1-01      ttggcgccgaggtctccga-------------------c-----------
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      ttggcgccgaggtctccga-------------------c-----------
G1RER8_BCL2L1-01        cagcagtttggatgcccgggaggtgatccccatggcagc-----------
A0A2I3GEA7_BCL2L2-      ---------------ccggtggggaggc----------c-----------
A0A2I3GEA7_BCL2L2-      -------------gcccagcagctgacc----------c-----------
A0A2I3GEA7_BCL2L2-      -------------gcccagcagctgacc----------c-----------
                                                                          

A0A2I3HBP6_BCL2A1-      ----caaaaagaagtggaaaagaatctgaagccg--tgcttggacaatgt
A0A2I3HBP6_BCL2A1-      ----caaaaagaagtggaaaagaatctgaagccg--tgcttggacaatgt
A0A2I3HBP6_BCL2A1-      ----caaaaagaagtggaaaagaatctgaagccg--tgcttggacaatgt
G1R3W6_BCL2L10-01       --gccatgctgcgctccgcggccgccaggttacggcagctccacccgtcc
A0A2I3GZF9_BCL2-01      gtggtccacctgaccctccgccaggccggcgatg--acttctcccgccgc
A0A2I3GJZ3_MCL1-01      --gtcactgcgacccccgcgaggctgcttttctt--cgctcccacccgcc
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --gtcactgcgacccccgcgaggctgcttttctt--cgctcccacccgcc
G1RER8_BCL2L1-01        --agtaaagcaagcgctgagggaggcaggcgacg--agtttgaactgcgg
A0A2I3GEA7_BCL2L2-      --ggggaggggggccccgggggc---------------ctgaggagctgc
A0A2I3GEA7_BCL2L2-      --gctgcaccaagccatgcgggcagctggagatg--agttcgagacccgc
A0A2I3GEA7_BCL2L2-      --gctgcaccaagccatgcgggcagctggagatg--agttcgagacccgc
                                                                          

A0A2I3HBP6_BCL2A1-      taatgttgtgtccat--------------------------------aga
A0A2I3HBP6_BCL2A1-      taatgttgtgtccat--------------------------------aga
A0A2I3HBP6_BCL2A1-      taatgttgtgtccat--------------------------------aga
G1R3W6_BCL2L10-01       ttcttctccgcctac-------------ctcggctaccctgggaaccgcg
A0A2I3GZF9_BCL2-01      taccgccgcgacttcgccgagatgtccagccagctgcacctgacgccctt
A0A2I3GJZ3_MCL1-01      gcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcatg
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      gcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcatg
G1RER8_BCL2L1-01        taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
A0A2I3GEA7_BCL2L2-      tgctggagc-------ccgagccgg----------------------agc
A0A2I3GEA7_BCL2L2-      ttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccagg
A0A2I3GEA7_BCL2L2-      ttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccagg
                                                                          

A0A2I3HBP6_BCL2A1-      cactgccagaacactattcaaccaagtgatggaa---aaggagtttgaag
A0A2I3HBP6_BCL2A1-      cactgccagaacactattcaaccaagtgatggaa---aaggagtttgaag
A0A2I3HBP6_BCL2A1-      cactgccagaacactattcaaccaagtgatggaa---aaggagtttgaag
G1R3W6_BCL2L10-01       tcgagctgg--------tggtgctgatggcggattccgtgctctccgaca
A0A2I3GZF9_BCL2-01      caccgcgcggggacgctttgccacggtggtggag---gagctcttcaggg
A0A2I3GJZ3_MCL1-01      tc--gcccgaagaggagctggacgggtacgagcc---ggagcctctcggg
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      tc--gcccgaagaggagctggacgggtacgagcc---ggagcctctcggg
G1RER8_BCL2L1-01        gacagcatatcagagctttgaacaggtagtgaat---gaactcttccggg
A0A2I3GEA7_BCL2L2-      ccgagcccgaagaggagccgccccggcccc--------------------
A0A2I3GEA7_BCL2L2-      ctcagcccaacaacgcttcacccaggtctccgat---gaactttttcaag
A0A2I3GEA7_BCL2L2-      ctcagcccaacaacgcttcacccaggtctccgat---gaactttttcaag
                                                                          

A0A2I3HBP6_BCL2A1-      atggcatcattaactggggaa----gaattgtaaccatatttgcatttga
A0A2I3HBP6_BCL2A1-      atggcatcattaactggggaa----gaattgtaaccatatttgcatttga
A0A2I3HBP6_BCL2A1-      atggcatcattaactggggaa----gaattgtaaccatatttgcatttga
G1R3W6_BCL2L10-01       gccccggccccacctggggca----gagtggtgacgctcgtggccttcgc
A0A2I3GZF9_BCL2-01      a---cggggtgaactggggga----ggattgtggccttctttgagttcgg
A0A2I3GJZ3_MCL1-01      a---agcggccggctg------------tcctgcccctgctggagttggt
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      a---agcggccggctg------------tcctgcccctgctggagttggt
G1RER8_BCL2L1-01        a---tggggtaaactggggtc----gcattgtggcctttttctccttcgg
A0A2I3GEA7_BCL2L2-      ----gcgcccccccgggagctccgggccctg-ggcctggttcg-----gg
A0A2I3GEA7_BCL2L2-      g---gggccccaactggggcc----gccttgtagccttctttgtctttgg
A0A2I3GEA7_BCL2L2-      g---gggccccaactggggcc----gccttgtagccttctttgtctttgg
                                                                          

A0A2I3HBP6_BCL2A1-      aggtattctcgtca--agaaacttctacgacagcgaactgccccggatgt
A0A2I3HBP6_BCL2A1-      aggtattctcgtca--agaaacttctacgacagcgaactgccccggatgt
A0A2I3HBP6_BCL2A1-      aggtattctcgtca--agaaacttctacgacagcgaactgccccggatgt
G1R3W6_BCL2L10-01       agggacgctgct------------------ggagagagggccgctggtg-
A0A2I3GZF9_BCL2-01      tggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtgg
A0A2I3GJZ3_MCL1-01      cggggaatctggtaataacaccagtacggacgggtcactaccctcgacgc
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      cggggaatctggtaataacaccagtacggacgggtcactaccctcgacgc
G1RER8_BCL2L1-01        cggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtga
A0A2I3GEA7_BCL2L2-      agc--ccccggcagccaagag-------gaggaggaggagcc------gg
A0A2I3GEA7_BCL2L2-      ggctgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtgg
A0A2I3GEA7_BCL2L2-      ggctgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtgg
                                                                          

A0A2I3HBP6_BCL2A1-      ggatacttaca----aggagatttcgtattttgttgcagagttcat----
A0A2I3HBP6_BCL2A1-      ggatacttaca----aggagatttcgtattttgttgcagagttcat----
A0A2I3HBP6_BCL2A1-      ggatacttaca----aggagatttcgtattttgttgcagagttcat----
G1R3W6_BCL2L10-01       -----accgcccggtggaagaagtggggcttccagccgcggctaaaggag
A0A2I3GZF9_BCL2-01      acaacatcgccctgtggatgactgagtacctg------------------
A0A2I3GJZ3_MCL1-01      cgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      cgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
G1RER8_BCL2L1-01        gtcggattgcagcttggatggccacttacctg------------------
A0A2I3GEA7_BCL2L2-      gac--------tggtcgagggtgacccg---ggggacggcgc--------
A0A2I3GEA7_BCL2L2-      gacaagtgcaggagtggatggtggcctacttggagacgcggctggctga-
A0A2I3GEA7_BCL2L2-      gacaagtgcaggagtggatggtggcctacttggagacgcggctggctga-
                                                                          

A0A2I3HBP6_BCL2A1-      ----------------------aatgaataacacaggag-----------
A0A2I3HBP6_BCL2A1-      ----------------------aatgaataacacaggag-----------
A0A2I3HBP6_BCL2A1-      ----------------------aatgaataacacaggag-----------
G1R3W6_BCL2L10-01       caggagggcgacgtcgcccgggactgccagcgcctggtggccttgctgag
A0A2I3GZF9_BCL2-01      ----------------------aacc--ggcacctg--------------
A0A2I3GJZ3_MCL1-01      atcatctctcggtaccttcgggagca--ggccaccggcg-----------
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      atcatctctcggtaccttcgggagca--ggccaccggcg-----------
G1RER8_BCL2L1-01        ----------------------aatg--accacctagag-----------
A0A2I3GEA7_BCL2L2-      ---------------------cattg--aggacccggag-----------
A0A2I3GEA7_BCL2L2-      ---------ctggatccacagcagtg--ggggctgggag-----------
A0A2I3GEA7_BCL2L2-      ---------ctggatccacagcagtg--ggggctgggcg-----------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------aatggataaggcaaaacgga----
A0A2I3HBP6_BCL2A1-      --------------------------aatggataaggcaaaacgga----
A0A2I3HBP6_BCL2A1-      --------------------------aatggataaggcaaaacgga----
G1R3W6_BCL2L10-01       ctcgcgcctcgtggggcagcaccgcgcctggctgcaggctcagggc----
A0A2I3GZF9_BCL2-01      ----------------------cacacctggatccaggataacgga----
A0A2I3GJZ3_MCL1-01      -------ccaaggacacaaagccaatgggcaggtctggggccaccagcag
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      -------ccaaggacacaaagccaatgggcaggtctggggccaccagcag
G1RER8_BCL2L1-01        -------cc------------------ttggatccaggagaacggc----
A0A2I3GEA7_BCL2L2-      -------ctggaagc----tatcaaagctcgagtcagggagatgga---g
A0A2I3GEA7_BCL2L2-      -------ctggaagc----tatcaaagctcgagtcagggagatgga---g
A0A2I3GEA7_BCL2L2-      -------------ga----gttcacagctctatacggggacggggccctg
                                                                          

A0A2I3HBP6_BCL2A1-      -----ggctgg----------------------gggaaatggc-------
A0A2I3HBP6_BCL2A1-      -----ggct-g----------------------ggaaaatggctttgtaa
A0A2I3HBP6_BCL2A1-      -----ggct-g----------------------ggaaaatggctttgtaa
G1R3W6_BCL2L10-01       -----ggctgggtgagcacgcggcggacaccgggacacggggcgggacgg
A0A2I3GZF9_BCL2-01      -----ggctgg--gatgcctttg------------------------tgg
A0A2I3GJZ3_MCL1-01      gaaggcgctgg--agaccttacgacg----ggttggggatggcgtgcagc
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      gaaggcgctgg--agaccttacgacg----ggttggggatggcgtgcagc
G1RER8_BCL2L1-01        -----ggctgg--gatacttttg------------------------tgg
A0A2I3GEA7_BCL2L2-      gaagaagctga--gaagctaaaggagctacagaacgaggtagagaagcag
A0A2I3GEA7_BCL2L2-      gaagaagctga--gaagctaaaggagctacagaacgaggtagagaagcag
A0A2I3GEA7_BCL2L2-      gaggaggcgcg--gcgtctgcgggag---------------gggaactgg
                                                                          

A0A2I3HBP6_BCL2A1-      ataatcacatgcc----------tatg-ctggtagagtcagtggcccaca
A0A2I3HBP6_BCL2A1-      agaagtttgaacc----------taaatctggctggatgacttttctaga
A0A2I3HBP6_BCL2A1-      agaagtttgaacc----------taaatctggctggatgacttttctaga
G1R3W6_BCL2L10-01       gcagccgggaagcgccc-----acgaggccggcacg--------------
A0A2I3GZF9_BCL2-01      aactgtacggccccagc--------atgc---------------------
A0A2I3GJZ3_MCL1-01      gcaaccatgagacggccttc---caa------------------------
A0A2I3GJZ3_MCL1-03      --------------------------ggcatgcttcggaaactggacatc
A0A2I3GJZ3_MCL1-02      gcaaccatgagacggccttc---caaggcatgcttcggaaactggacatc
G1RER8_BCL2L1-01        aactctatggg----------aacaatgc---------------------
A0A2I3GEA7_BCL2L2-      atgaatatgagtccacctccaggcaatgctggcccagtgatcatgtccat
A0A2I3GEA7_BCL2L2-      atgaatatgagtccacctccaggcaatgctggcccagtgatcatgtccat
A0A2I3GEA7_BCL2L2-      gcatcagtgag----------gacagtgctgac-----------------
                                                                          

A0A2I3HBP6_BCL2A1-      ag-aagagga----------------------------------------
A0A2I3HBP6_BCL2A1-      agttacaggaaagatc----------------------------------
A0A2I3HBP6_BCL2A1-      agttacaggaaagatctc--------------------------------
G1R3W6_BCL2L10-01       ------------gatggc--------------------------------
A0A2I3GZF9_BCL2-01      ---------------ggc--------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-03      aaaaacgaagacgatgtcaaatcgttgtctcgagtgatggtccatgtttt
A0A2I3GJZ3_MCL1-02      aaaaacgaagacgatgtcaaatcgttgtctcgagtgatggtccatgtttt
G1RER8_BCL2L1-01        -----agcagccgagagc--------------------------------
A0A2I3GEA7_BCL2L2-      tgaggagaagatggaggc--------------------------------
A0A2I3GEA7_BCL2L2-      tgaggagaagatggaggc--------------------------------
A0A2I3GEA7_BCL2L2-      ------------gggggc--------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      ----------------------aatactgttgactagaaaggacactcca
G1R3W6_BCL2L10-01       --------ttttgtcacttcttcaggaccccctttccgctggctttttgg
A0A2I3GZF9_BCL2-01      ---ctctgtttgatttctcctggctgtctctgaagactctgct-------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-03      cagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttg
A0A2I3GJZ3_MCL1-02      cagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttg
G1RER8_BCL2L1-01        ---cga--------------------------------------------
A0A2I3GEA7_BCL2L2-      ---tgatgcccgttccatctatgttggcaatgtggactatggtgcaacag
A0A2I3GEA7_BCL2L2-      ---tgatgcccgttccatctatgttggcaatgtggactatggtgcaacag
A0A2I3GEA7_BCL2L2-      ---cg-------------------tggcactgggggccctggt-------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      ---tgtgaaat---gctctctttcctg-----------------------
A0A2I3HBP6_BCL2A1-      tattgtgaaaccggcctaatttttctgactcttatggaaacaattgccaa
G1R3W6_BCL2L10-01       agaaaacagctggtccaggcttttctgtcatgcttgttaacaacagcctt
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-03      gtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatc
A0A2I3GJZ3_MCL1-02      gtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatc
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      cagaagagctggaagctcactttcatggctgtggttcagtcaaccgtgtt
A0A2I3GEA7_BCL2L2-      cagaagagctggaagctcactttcatggctgtggttcagtcaaccgtgtt
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      ---------------------aaatg------------------------
A0A2I3HBP6_BCL2A1-      ---------------------aagca------------------------
A0A2I3HBP6_BCL2A1-      cacatacttctactttaaaataaaca------------------------
G1R3W6_BCL2L10-01       catttatttctggacacgatta----------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-03      gaaccattagcagaaagtatcacagacgttctcgtaagg-------acaa
A0A2I3GJZ3_MCL1-02      gaaccattagcagaaagtatcacagacgttctcgtaagg-------acaa
G1RER8_BCL2L1-01        ---------------------aagggcc----------------------
A0A2I3GEA7_BCL2L2-      accatactctgtgacaaatttagtggccatcccaaagggtttgcatatat
A0A2I3GEA7_BCL2L2-      accatactctgtgacaaatttagtggccatcccaaagggtttgcatatat
A0A2I3GEA7_BCL2L2-      ---------------aactgtaggggcctt--------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      -------------------------------ggatgggtttgtggagttc
A0A2I3GJZ3_MCL1-03      aacgggactggctagttaaacaaagaggctgggatgggtttgtggagttc
A0A2I3GJZ3_MCL1-02      aacgggactggctagttaaacaaagaggctgggatgggtttgtggagttc
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      agagttctcagacaaagagtcagtgaggacttccttggccttagatgagt
A0A2I3GEA7_BCL2L2-      agagttctcagacaaagagtcagtgaggacttccttggccttagatgagt
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      ttccatgtagagga-----------------cctagaaggtggcatcaga
A0A2I3GJZ3_MCL1-03      ttccatgtagagga-----------------cctagaaggtggcatcaga
A0A2I3GJZ3_MCL1-02      ttccatgtagagga-----------------cctagaaggtggcatcaga
G1RER8_BCL2L1-01        ----------aggaacgc--------------------------------
A0A2I3GEA7_BCL2L2-      ccctgtttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacaga
A0A2I3GEA7_BCL2L2-      ccctgtttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacaga
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      ccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgc
A0A2I3GEA7_BCL2L2-      ccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgc
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      ---------------------------------------------gcttt
A0A2I3HBP6_BCL2A1-      ---------------------------------------------atact
A0A2I3HBP6_BCL2A1-      ---------------------------------------------acttt
G1R3W6_BCL2L10-01       ---------------------------------------ttatgagtttt
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------aatgtgctgctggctttt
A0A2I3GJZ3_MCL1-03      --------------------------------aatgtgctgctggctttt
A0A2I3GJZ3_MCL1-02      --------------------------------aatgtgctgctggctttt
G1RER8_BCL2L1-01        ----------------------------------------------ttca
A0A2I3GEA7_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2I3GEA7_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2I3GEA7_BCL2L2-      ---------------------------------------------ttttg
                                                                          

A0A2I3HBP6_BCL2A1-      g-----------taa-----------------------------------
A0A2I3HBP6_BCL2A1-      g----------ttga-----------------------------------
A0A2I3HBP6_BCL2A1-      gatgatgtaacttga-----------------------------------
G1R3W6_BCL2L10-01       aaaacttttaacccgcttctacctgcacagctgtga--------------
A0A2I3GZF9_BCL2-01      -cagtttggccctggtgggagcttgcatcaccctgggt---------gcc
A0A2I3GJZ3_MCL1-01      gcaggtgttgctggagtaggagctggtttggcatatctaataagatagcc
A0A2I3GJZ3_MCL1-03      gcaggtgttgctggagtaggagctggtttggcatatctaataagatag--
A0A2I3GJZ3_MCL1-02      gcaggtgttgctggagtaggagctggtttggcatatctaataagatag--
G1RER8_BCL2L1-01        accgctggttcctga-----------------cgggc-------------
A0A2I3GEA7_BCL2L2-      acagcaggccccggggtcgcgtctacaggggccgggctagagcgacatca
A0A2I3GEA7_BCL2L2-      acagcaggccccggggtcgcgtctacaggggccgggctagagcgacatca
A0A2I3GEA7_BCL2L2-      ctagcaag------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      ------------------
A0A2I3HBP6_BCL2A1-      ------------------
A0A2I3HBP6_BCL2A1-      ------------------
G1R3W6_BCL2L10-01       ------------------
A0A2I3GZF9_BCL2-01      tatctgggccacaagtga
A0A2I3GJZ3_MCL1-01      ttactgtaa---------
A0A2I3GJZ3_MCL1-03      ------------------
A0A2I3GJZ3_MCL1-02      ------------------
G1RER8_BCL2L1-01        ------------------
A0A2I3GEA7_BCL2L2-      tggtattccccttactaa
A0A2I3GEA7_BCL2L2-      tggtattccccttactaa
A0A2I3GEA7_BCL2L2-      ---------------tga
                                          

© 1998-2020Legal notice