Dataset for CDS BCL-2-like of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3HBP6_BCL2A1-      atg------------------acagactgc---------------gaatt
A0A2I3HBP6_BCL2A1-      atg------------------acagactgc---------------gaatt
G1R3W6_BCL2L10-01       atggttgaccagttgcggg----agcgcac-----cgagcggctgctggc
A0A2I3GJZ3_MCL1-02      atg-----------tttggcctcagaagaa-----acg-----cggtaat
A0A2I3GJZ3_MCL1-01      atg-----------tttggcctcagaagaa-----acg-----cggtaat
A0A2I3GZF9_BCL2-01      atggcg---cacgctgggagaacagggtacgataaccgggagatagtgat
G1RER8_BCL2L1-01        at----------------gtctcagagcaa-----ccgggagctggtggt
A0A2I3GEA7_BCL2L2-      atggcgaccccagcctcggccccaga-cac-----acgggctctggtggc
A0A2I3GEA7_BCL2L2-      atggcgaccccagcctcggccccaga-cac-----acgggctctggtggc
                        **                     **                         

A0A2I3HBP6_BCL2A1-      tggatatat---ttacaggctagctcaggactatctgcagtacgtcct--
A0A2I3HBP6_BCL2A1-      tggatatat---ttacaggctagctcaggactatctgcagtacgtcct--
G1R3W6_BCL2L10-01       cgactacct------------------ggg------gtgctgcgcccg--
A0A2I3GJZ3_MCL1-02      cggactcaacctctac-------tgtgggg------gggc--cggctt--
A0A2I3GJZ3_MCL1-01      cggactcaacctctac-------tgtgggg------gggc--cggctt--
A0A2I3GZF9_BCL2-01      gaagtacatccattataagctgtcgcagag------gggctacgagtg--
G1RER8_BCL2L1-01        tgactttctctcctacaagctttcccagaa------aggatacagctgga
A0A2I3GEA7_BCL2L2-      agactttgtaggttataagctgaggcagaa------gggttatgtctg--
A0A2I3GEA7_BCL2L2-      agactttgtaggttataagctgaggcagaa------gggttatgtctg--
                                                   *                      

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GJZ3_MCL1-02      ----------gggggccggcagcggcggcgccacccctccgggagggcgg
A0A2I3GJZ3_MCL1-01      ----------gggggccggcagcggcggcgccacccctccgggagggcgg
A0A2I3GZF9_BCL2-01      ----------ggatgcgggagatgtgggcgccgcgcccccgg--gggccg
G1RER8_BCL2L1-01        gtcagtttagtgatgtggaagagaacaggactgaggccccagaagggact
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      ---------acagat-----------------------------------
A0A2I3HBP6_BCL2A1-      ---------acagat-----------------------------------
G1R3W6_BCL2L10-01       -----------ggaa-----------------------------------
A0A2I3GJZ3_MCL1-02      cttttggctacggag-----------------------------aaggag
A0A2I3GJZ3_MCL1-01      cttttggctacggag-----------------------------aaggag
A0A2I3GZF9_BCL2-01      cccccgcaccgggcatcttctcctcccagccggggcacacgccccatcca
G1RER8_BCL2L1-01        gaatcggagatggagacccccagtgccatcaatggcaacc----------
A0A2I3GEA7_BCL2L2-      ----------tggag-----------------------------------
A0A2I3GEA7_BCL2L2-      ----------tggag-----------------------------------
                                    *                                     

A0A2I3HBP6_BCL2A1-      accacagcctgga----------------tcaggtccaagcaa-------
A0A2I3HBP6_BCL2A1-      accacagcctgga----------------tcaggtccaagcaa-------
G1R3W6_BCL2L10-01       -------cccggc-------------------------------------
A0A2I3GJZ3_MCL1-02      gcctcggcccggcgagagatagggggaggggaggccggcgcggtgattgg
A0A2I3GJZ3_MCL1-01      gcctcggcccggcgagagatagggggaggggaggccggcgcggtgattgg
A0A2I3GZF9_BCL2-01      gctgcatcccggg-------acccggtcgccaggacctcgccgctgccga
G1RER8_BCL2L1-01        ----catcctggc-------acctggcggacag--ccccgcggtgaatgg
A0A2I3GEA7_BCL2L2-      --------ctggc-------cccggg------------------------
A0A2I3GEA7_BCL2L2-      --------ctggc-------cccggg------------------------
                                * **                                      

A0A2I3HBP6_BCL2A1-      ------------------------aacgtccagagtgctacaaaacgttg
A0A2I3HBP6_BCL2A1-      ------------------------aacgtccagagtgctacaaaacgttg
G1R3W6_BCL2L10-01       ----------------------------acccccgagccgacgccgtcca
A0A2I3GJZ3_MCL1-02      c-----------------------ggaagcgccggcgcaagccccccgtc
A0A2I3GJZ3_MCL1-01      c-----------------------ggaagcgccggcgcaagccccccgtc
A0A2I3GZF9_BCL2-01      ccccggctgcccccggcgccgccgcggggcctg--cgctcagcccggtgc
G1RER8_BCL2L1-01        agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
A0A2I3GEA7_BCL2L2-      ------------------------gagggcccagcagctgacccgc----
A0A2I3GEA7_BCL2L2-      ------------------------gagggcccagcagctgacccgc----
                                                     *      *             

A0A2I3HBP6_BCL2A1-      cgttctcagtccaaaaagaagtggaaaagaatc---------------tg
A0A2I3HBP6_BCL2A1-      cgttctcagtccaaaaagaagtggaaaagaatc---------------tg
G1R3W6_BCL2L10-01       cgcccgaggc-cgccatgc--tgcgctccgc-----------------gg
A0A2I3GJZ3_MCL1-02      agtcctca---caccagactcccggagggtcgcgcggccgccgcccattg
A0A2I3GJZ3_MCL1-01      agtcctca---caccagactcccggagggtcgcgcggccgccgcccattg
A0A2I3GZF9_BCL2-01      cacctgtggtccacctgaccctccgccaggc-----------------cg
G1RER8_BCL2L1-01        cagcagta---aagcaagcgctgagggaggc-----------------ag
A0A2I3GEA7_BCL2L2-      ------tg---caccaagccatgcgggcagc-----------------tg
A0A2I3GEA7_BCL2L2-      ------tg---caccaagccatgcgggcagc-----------------tg
                                                                         *

A0A2I3HBP6_BCL2A1-      aagccgtgcttggacaatgttaatgttgtgt-------------------
A0A2I3HBP6_BCL2A1-      aagccgtgcttggacaatgttaatgttgtgt-------------------
G1R3W6_BCL2L10-01       ccgccaggttacggcagctccacccgtccttcttctccg---------cc
A0A2I3GJZ3_MCL1-02      gcgccgaggtc----tccgacgtcactgcgacccccgcga---ggctgct
A0A2I3GJZ3_MCL1-01      gcgccgaggtc----tccgacgtcactgcgacccccgcga---ggctgct
A0A2I3GZF9_BCL2-01      gcgatgacttctcccgccgctaccgccgcgacttcgccgagatgtccagc
G1RER8_BCL2L1-01        gcgacgagtttgaactgcggtaccggcgggcattcagtgacctgacatcc
A0A2I3GEA7_BCL2L2-      gagatgagttcgagacccgcttccggcgcaccttctctgatctggcggct
A0A2I3GEA7_BCL2L2-      gagatgagttcgagacccgcttccggcgcaccttctctgatctggcggct
                          *      *                                        

A0A2I3HBP6_BCL2A1-      -------------ccatagacactgccagaacactattc-----------
A0A2I3HBP6_BCL2A1-      -------------ccatagacactgccagaacactattc-----------
G1R3W6_BCL2L10-01       tacctcggc--taccctgggaaccgcgtcgagctggtg------------
A0A2I3GJZ3_MCL1-02      tttcttcgc----tcccacccgccgcgcggcgccgcttgaggagatggaa
A0A2I3GJZ3_MCL1-01      tttcttcgc----tcccacccgccgcgcggcgccgcttgaggagatggaa
A0A2I3GZF9_BCL2-01      cagctgcacctgacgcccttcaccgcgcggggacgcttt-----------
G1RER8_BCL2L1-01        cagctccacatcaccccagggacagcatatcagagcttt-----------
A0A2I3GEA7_BCL2L2-      cagctgcatgtgaccccaggctcagcccaacaacgcttc-----------
A0A2I3GEA7_BCL2L2-      cagctgcatgtgaccccaggctcagcccaacaacgcttc-----------
                                              * **          *             

A0A2I3HBP6_BCL2A1-      aaccaagtgatggaaa-----aggagtttgaagatggcatcattaactgg
A0A2I3HBP6_BCL2A1-      aaccaagtgatggaaa-----aggagtttgaagatggcatcattaactgg
G1R3W6_BCL2L10-01       gtgctgatggcggattccg--tgctctccgacagccccggccccacctgg
A0A2I3GJZ3_MCL1-02      gccccggccgccgacgccatcatgtcgcccgaag---aggagctggacgg
A0A2I3GJZ3_MCL1-01      gccccggccgccgacgccatcatgtcgcccgaag---aggagctggacgg
A0A2I3GZF9_BCL2-01      gccacggtggtggagg-----agctcttcaggga---cggggtgaactgg
G1RER8_BCL2L1-01        gaacaggtagtgaatg-----aactcttccggga---tggggtaaactgg
A0A2I3GEA7_BCL2L2-      acccaggtctccgatg-----aactttttcaagg---gggccccaactgg
A0A2I3GEA7_BCL2L2-      acccaggtctccgatg-----aactttttcaagg---gggccccaactgg
                                     *                                  **

A0A2I3HBP6_BCL2A1-      ggaagaattgtaaccata----------------------------tttg
A0A2I3HBP6_BCL2A1-      ggaagaattgtaaccata----------------------------tttg
G1R3W6_BCL2L10-01       ggcagagtggtgacgctc----------------------------gtgg
A0A2I3GJZ3_MCL1-02      gtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctgg
A0A2I3GJZ3_MCL1-01      gtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctgg
A0A2I3GZF9_BCL2-01      gggaggattgtggccttc----------------------------tttg
G1RER8_BCL2L1-01        ggtcgcattgtggccttt----------------------------ttct
A0A2I3GEA7_BCL2L2-      ggccgccttgtagccttc----------------------------tttg
A0A2I3GEA7_BCL2L2-      ggccgccttgtagccttc----------------------------tttg
                        *   *    *   *                                 *  

A0A2I3HBP6_BCL2A1-      catttgaaggtattct---cgtcaagaaacttctacgacagcga------
A0A2I3HBP6_BCL2A1-      catttgaaggtattct---cgtcaagaaacttctacgacagcga------
G1R3W6_BCL2L10-01       ccttcgcagggacgctgc-tggagagagggc----cgctggtgaccgccc
A0A2I3GJZ3_MCL1-02      agttggtcggggaa---tctggtaataacac----cagtacggacgggtc
A0A2I3GJZ3_MCL1-01      agttggtcggggaa---tctggtaataacac----cagtacggacgggtc
A0A2I3GZF9_BCL2-01      agttcggtggggtcatgtgtgtggagagcgt----caaccggga------
G1RER8_BCL2L1-01        ccttcggcggggcactgtgcgtggaaagcgt----agacaagga------
A0A2I3GEA7_BCL2L2-      tctttggggctgcactgtgtgctgagagtgt----caacaagga------
A0A2I3GEA7_BCL2L2-      tctttggggctgcactgtgtgctgagagtgt----caacaagga------
                          ** *  *           *   * *               **      

A0A2I3HBP6_BCL2A1-      actgccccggatgtggatacttacaaggagatttcgtattttgttg----
A0A2I3HBP6_BCL2A1-      actgccccggatgtggatacttacaaggagatttcgtattttgttg----
G1R3W6_BCL2L10-01       ggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgac
A0A2I3GJZ3_MCL1-02      actaccctcgacgccgccgccagcagaggaggaggaggacgagttgtacc
A0A2I3GJZ3_MCL1-01      actaccctcgacgccgccgccagcagaggaggaggaggacgagttgtacc
A0A2I3GZF9_BCL2-01      ---------gatgtcgcccctggtggacaacatcgccctgtggatg----
G1RER8_BCL2L1-01        ---------gatgcaggtattggtgagtcggattgcagcttggatg----
A0A2I3GEA7_BCL2L2-      ---------gatggaaccactggtgggacaagtgcaggagtggatg----
A0A2I3GEA7_BCL2L2-      ---------gatggaaccactggtgggacaagtgcaggagtggatg----
                                    *                                *    

A0A2I3HBP6_BCL2A1-      -------------------------cagagttcataatgaataacacagg
A0A2I3HBP6_BCL2A1-      -------------------------cagagttcataatgaataacacagg
G1R3W6_BCL2L10-01       gtcgcccgggactgccagcgcctggtggccttgctgagctcgcgcctcgt
A0A2I3GJZ3_MCL1-02      ggcagtcgctggagatcatctctcggtaccttcgggagcaggccaccggc
A0A2I3GJZ3_MCL1-01      ggcagtcgctggagatcatctctcggtaccttcgggagcaggccaccggc
A0A2I3GZF9_BCL2-01      ------------------------actgagtacctgaaccggcacctgca
G1RER8_BCL2L1-01        ------------------------gccacttacctgaatgaccacctaga
A0A2I3GEA7_BCL2L2-      ------------------------gtggcctacttggagacgcggctggc
A0A2I3GEA7_BCL2L2-      ------------------------gtggcctacttggagacgcggctggc
                                                      *                   

A0A2I3HBP6_BCL2A1-      a------------gaatggataaggca-aaacgg---aggct-gg-----
A0A2I3HBP6_BCL2A1-      a------------gaatggataaggca-aaacgg---aggctggg-----
G1R3W6_BCL2L10-01       ggggcagcaccgcgcctggctgcaggc-tcaggg---cggctggg-tgag
A0A2I3GJZ3_MCL1-02      g------------ccaaggacacaaagccaatgggcaggtctggggccac
A0A2I3GJZ3_MCL1-01      g------------ccaaggacacaaagccaatgggcaggtctggggccac
A0A2I3GZF9_BCL2-01      c------------acctggatccagga-taacgg---aggctggg-----
G1RER8_BCL2L1-01        g------------ccttggatccagga-gaacgg---cggctggg-----
A0A2I3GEA7_BCL2L2-      t------------gactggatccacag-cagtgg---gggctggg-----
A0A2I3GEA7_BCL2L2-      t------------gactggatccacag-cagtgg---gggctggg-----
                                         **             **    * ** **     

A0A2I3HBP6_BCL2A1-      ----------------------------------gaaaatggctttgtaa
A0A2I3HBP6_BCL2A1-      ----------------------------------ggaaatggcat-----
G1R3W6_BCL2L10-01       cacgcggcggacaccgggacacg-------gggcgggacgggc-------
A0A2I3GJZ3_MCL1-02      cagcaggaaggcgctggagaccttacgacgggttggggatggcgt-----
A0A2I3GJZ3_MCL1-01      cagcaggaaggcgctggagaccttacgacgggttggggatggcgt-----
A0A2I3GZF9_BCL2-01      -at------gcctttgtggaact-------gtacggccccagcat-----
G1RER8_BCL2L1-01        -at------acttttgtggaact-------ctatgggaacaatgc-----
A0A2I3GEA7_BCL2L2-      -agctggaagctatcaaagctcg-------agtcagggagatgga---gg
A0A2I3GEA7_BCL2L2-      -cg------gagttcacagctct-------atacggggacggggccctgg
                                                                          

A0A2I3HBP6_BCL2A1-      agaagtttgaacctaaatctggct--------------------------
A0A2I3HBP6_BCL2A1-      ---------------aatc-------------------------------
G1R3W6_BCL2L10-01       -agccgggaagcgcccacgaggcc--------------------------
A0A2I3GJZ3_MCL1-02      --gcagcgcaaccatgagacggccttccaaggcatgcttcggaaactgga
A0A2I3GJZ3_MCL1-01      --gcagcgcaaccatgagacggccttccaa--------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        -agcagccgagagccgaaagggcc--------------------------
A0A2I3GEA7_BCL2L2-      aagaagctgagaagctaaaggagctacaga--------------------
A0A2I3GEA7_BCL2L2-      aggaggcgcggcgtctgcgggag---------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GJZ3_MCL1-02      catcaaaaacgaagacgatgtcaaatcgttgtctcgagtgatggtccatg
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GJZ3_MCL1-02      ttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttct
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GJZ3_MCL1-02      tttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctg
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GJZ3_MCL1-02      catcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaac
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        -------------------------------------------aggaa--
A0A2I3GEA7_BCL2L2-      -----------------------------------acgaggtagagaagc
A0A2I3GEA7_BCL2L2-      -------------------------------------------gggaact
                                                                          

A0A2I3HBP6_BCL2A1-      ----------------------------ggatgacttttctagaagttac
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       -----------------------ggcacggatggcttttgtcacttcttc
A0A2I3GJZ3_MCL1-02      gggactggctagttaaacaaagaggctgggatgggtttgtggagttcttc
A0A2I3GJZ3_MCL1-01      ----------------------------ggatgggtttgtggagttcttc
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      agatgaatatgagtccacctccaggcaatgctggcccagtgatcatgtcc
A0A2I3GEA7_BCL2L2-      gggcatcagtgag----------gacagtgctgac---------------
                                                                          

A0A2I3HBP6_BCL2A1-      aggaaagatctcaata-----ctgttgactagaaaggacactccatattg
A0A2I3HBP6_BCL2A1-      -----acatgcctatg-----ctg--------------------------
G1R3W6_BCL2L10-01       aggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
A0A2I3GJZ3_MCL1-02      c--------------------atgtagaggacctagaaggtggcatcaga
A0A2I3GJZ3_MCL1-01      c--------------------atgtagaggacctagaaggtggcatcaga
A0A2I3GZF9_BCL2-01      -----------------------------------gcggcctctgtttga
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      a--------------------ttgaggagaagatggaggctgatgcccgt
A0A2I3GEA7_BCL2L2-      ----------------------------------gggggccg--------
                                                                          

A0A2I3HBP6_BCL2A1-      tgaaaccggcctaatttttctgactcttat--------------------
A0A2I3HBP6_BCL2A1-      ----------------------------gt--------------------
G1R3W6_BCL2L10-01       tctgtcatgcttgttaacaacagccttcat--------------------
A0A2I3GJZ3_MCL1-02      aatgtgctgctggcttttgcaggtgttgctggagtaggagc---------
A0A2I3GJZ3_MCL1-01      aatgtgctgctggcttttgcaggtgttgctggagtaggagc---------
A0A2I3GZF9_BCL2-01      tttctcctggctgtctctgaagactctgct--------------------
G1RER8_BCL2L1-01        --------------cgcttcaaccgctggt--------------------
A0A2I3GEA7_BCL2L2-      tccatctatgttggcaatgtggactatggtgcaacagcagaagagctgga
A0A2I3GEA7_BCL2L2-      -----------tggcactgggggccctggt--------------------
                                                     *                    

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      agctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtg
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------ggaaacaat---------------------------------
A0A2I3HBP6_BCL2A1-      --------agagtcagt---------------------------------
G1R3W6_BCL2L10-01       ttatttctggacacgattattatgagttttaaaac---------------
A0A2I3GJZ3_MCL1-02      --tggtttgg----------------------------------------
A0A2I3GJZ3_MCL1-01      --tggtttgg----------------------------------------
A0A2I3GZF9_BCL2-01      --cagtttgg----------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      acaaatttagtggccatcccaaagggtttgcatatatagagttctcagac
A0A2I3GEA7_BCL2L2-      --aactgtaggggcctt---------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      aaagagtcagtgaggacttccttggccttagatgagtccctgtttagagg
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      aaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagca
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
G1R3W6_BCL2L10-01       --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      caacagaccggggttttccacgagcccgctaccgcgcccggaccaccaac
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      -----------------------------------tgccaacaca-----
A0A2I3HBP6_BCL2A1-      -----------------------------------ggcccacaag-----
G1R3W6_BCL2L10-01       -----------------------------------ttttaacccgcttct
A0A2I3GJZ3_MCL1-02      --------------------------------catatctaataag-----
A0A2I3GJZ3_MCL1-01      --------------------------------catatctaataag-----
A0A2I3GZF9_BCL2-01      -----------------------------------ccctggtggg-----
G1RER8_BCL2L1-01        -----------------------------------tcctgacgggc----
A0A2I3GEA7_BCL2L2-      tacaacagttcccgctctcgattctacagtggttttaacagcaggccccg
A0A2I3GEA7_BCL2L2-      --------------------------------ttttgctagcaag-----
                                                                          

A0A2I3HBP6_BCL2A1-      -------------tacttctactttaaaataaacaactttgatgatgtaa
A0A2I3HBP6_BCL2A1-      -------------aa----------gaggaaaatggctttg---------
G1R3W6_BCL2L10-01       a---------------------------------------cctgcacagc
A0A2I3GJZ3_MCL1-02      ----------------------------------------atag------
A0A2I3GJZ3_MCL1-01      ----------------------------------------atagccttac
A0A2I3GZF9_BCL2-01      ---------------agcttgcatcaccctgggtgcctatctgggccaca
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      gggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctt
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3HBP6_BCL2A1-      cttga
A0A2I3HBP6_BCL2A1-      --taa
G1R3W6_BCL2L10-01       tgtga
A0A2I3GJZ3_MCL1-02      -----
A0A2I3GJZ3_MCL1-01      tgtaa
A0A2I3GZF9_BCL2-01      agtga
G1RER8_BCL2L1-01        -----
A0A2I3GEA7_BCL2L2-      actaa
A0A2I3GEA7_BCL2L2-      --tga
                             

© 1998-2020Legal notice