Dataset for CDS Unclassified of organism Sinocyclocheilus rhinocerous

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A673IHA8_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous (length=690 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttctggggaggatgatgacaccatcaatacaggagtggaggactcctctccaaactcaggcagga
ggctccaggctccctcagccggaggggggaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctacggggcgttacgcgaggctggagaccagatagaaaggatgcaccagcgtgaatttgaggagatgtccca
ccagatgatattcagtcccaatgcagcacaacgcagcttcttagctgtggctgaagagctcttcaaagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggatgc
cttcgtggagttgtacggtcagcagagagactctatgttccacccattgtcgtacctaacgaaagtgcttggattggcag
cactaggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
>gnl|bcl2dbcds|A0A673LRC6_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous (length=654 residues).
atgacttaccgcgcgcgattcccactcaaaacaccggagactttctcgcggctggtgaagtacatccaccataagctctg
gaagaagggatacgtgtgggaagaggaccgcggcggctcccgtcacgacccgttcagcgctcttcacacggtgctacggg
aggctggggacgaactggagcggctttatcagtcggactttgcggagatgtccaaacagctgcatctcacgtccatcaca
gcgcatcagcgcttcaccgcggtcatagatgagctgttcagggacggcgtgaactggggcagaatcatcgcttttttcga
gtttggagggaccgtttgcgtcgaatgcgtgaataaggagatgacggcgcatgtggataacatcgcgagctggatgaccg
agtatctgaacgggccgctgcacggctggatccaggagaacggcggctggcgatgcgcgtcctctgattggccgatagcg
ctgtccgttagaatgcgccagccaatgagcggcggcgattggtcacacccctctcacgcctccgcggtgaagccgtcaat
gacagctgctgtctgcagcagagctgaaggtgtggttctcctgtgtacaactttcaggactgctgttgattcatgcaaac
aggaggatgtttag
>gnl|bcl2dbcds|A0A673LTJ0_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous (length=597 residues).
atgaggtttgactgctgtttgcgcaactgtcggtggagagcgcagtctgacatcgctgggaggaaaatgtcctgttggtt
gagggaacagactttgttgctggcagaagattacatcagcttctgcagtgggatccaacagacgcctcccagcgagtcag
cagaggccatgagatacctggccaaagagatggaacagcagcacagaaccaaattcagatccctctcccaggagttcctg
gacacctgcggatcagatcccagcaagtgtctgcagcgcgtcatgagggaactggtgggagatgggaaactgaactgggg
gagggtggtttccatctttactttcactggagtgctggccagtgagctactgtccaggggagagaattccgactgctccc
ggagattggctgagaccattgctgactaccttggaggggaaaaacaggactggctggtggaaaacggaggctgggagggt
ttctgcacgtttttccacaacgcaagacagctgaaccaagagtcctcgatgaagacagcactgtttgcagcagcaggagt
gggtttagctggtctaacctttctcttagtacgctga
© 1998-2020Legal notice