Dataset for CDS BCL-2 of organism Ursus americanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452R110_BCL2-01      atgccggagacgcgggcgccgcgcccccgggggccgcccccgcgccgggc
A0A452R110_BCL2-02      atgccggagacgcgggcgccgcgcccccgggggccgcccccgcgccgggc
                        **************************************************

A0A452R110_BCL2-01      atcttctcctcccagcctgggctcacccccgcgcccgccaggacctcgcc
A0A452R110_BCL2-02      atcttctcctcccagcctgggctcacccccgcgcccgccaggacctcgcc
                        **************************************************

A0A452R110_BCL2-01      gcttaccgcccccggccgcccccgccgccgccgccgccgccgcgggccct
A0A452R110_BCL2-02      gcttaccgcccccggccgcccccgccgccgccgccgccgccgcgggccct
                        **************************************************

A0A452R110_BCL2-01      gcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccgg
A0A452R110_BCL2-02      gcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccgg
                        **************************************************

A0A452R110_BCL2-01      cgatgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagcc
A0A452R110_BCL2-02      cgatgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagcc
                        **************************************************

A0A452R110_BCL2-01      agctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtg
A0A452R110_BCL2-02      agctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtg
                        **************************************************

A0A452R110_BCL2-01      gaggagctcttcagggatggggtgaactgggggaggattgtggccttctt
A0A452R110_BCL2-02      gaggagctcttcagggatggggtgaactgggggaggattgtggccttctt
                        **************************************************

A0A452R110_BCL2-01      tgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
A0A452R110_BCL2-02      tgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
                        **************************************************

A0A452R110_BCL2-01      ccctggtggacaacattgccctgtggatgactgagtacctgaaccggcac
A0A452R110_BCL2-02      ccctggtggacaacattgccctgtggatgactgagtacctgaaccggcac
                        **************************************************

A0A452R110_BCL2-01      ctgcacacctggatccaggacaacggaggctgggatgcctttgtggagtt
A0A452R110_BCL2-02      ctgcacacctggatccaggacaacggaggctggg----------------
                        **********************************                

A0A452R110_BCL2-01      gtacggccccagcatgcagcctctgtttgacttctcctggctgtctctga
A0A452R110_BCL2-02      --------------------------------------------------
                                                                          

A0A452R110_BCL2-01      aggccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcc
A0A452R110_BCL2-02      -------------------------------------cacactaa-----
                                                             *** **       

A0A452R110_BCL2-01      tacctgggccacaagtga
A0A452R110_BCL2-02      ------------------
                                          

© 1998-2020Legal notice