Dataset for CDS BCL2L1 of organism Sinocyclocheilus rhinocerous

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A673M4N6_BCL2L1-      atgtcttactatcaccaagaactggtggtattttttattaaatataaact
A0A673IGS5_BCL2L1-      atgtcttactatcaccaagaactggtggtattttttattaaatataaact
A0A673M4N6_BCL2L1-      atgtcttactatcaccaagaactggtggtattttttattaaatataaact

A0A673M4N6_BCL2L1-      ctcacagaggaactacccctacaatcacattgaatttacagaagacacaa
A0A673IGS5_BCL2L1-      ctcgcagaggaactacccctacaaccacattgaatttacagaagacacaa
A0A673M4N6_BCL2L1-      ctcacagaggaactacccctacaatcacattgaatttacagaagacacaa
                        *** ******************** *************************

A0A673M4N6_BCL2L1-      atcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaaca
A0A673IGS5_BCL2L1-      atcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaaca
A0A673M4N6_BCL2L1-      atcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaaca

A0A673M4N6_BCL2L1-      acgaccctcgttaatggctccctaaacggaacaagtactggttccactgg
A0A673IGS5_BCL2L1-      acgaccctcgttaatggctccctaaacggaacaagtactggttccactgg
A0A673M4N6_BCL2L1-      acgaccctcgttaatggctccctaaacggaacaagtactggttccactgg

A0A673M4N6_BCL2L1-      gaccccaccaaggtcccccgcttcaaccccccagcgtcagacgaacggga
A0A673IGS5_BCL2L1-      gaccccaccaaggtcccccgcttcaaccccccagcgtcagacgaacggga
A0A673M4N6_BCL2L1-      gaccccaccaaggtcccccgcttcaaccccccagcgtcagacgaacggga

A0A673M4N6_BCL2L1-      ctgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgag
A0A673IGS5_BCL2L1-      ctgggggtctggacgctgtaaaggaggcgcttcgcgattctgccaacgag
A0A673M4N6_BCL2L1-      ctgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgag
                        ************* ** *********************************

A0A673M4N6_BCL2L1-      tttgagctgcgttattcccaagcattcaacgacctgtcgtcgcagctcca
A0A673IGS5_BCL2L1-      tttgagctgcgttattcccaagcattcaacgacctgtcctcgcagctcca
A0A673M4N6_BCL2L1-      tttgagctgcgttattcccaagcattcaacgacctgtcgtcgcagctcca
                        ************************************** ***********

A0A673M4N6_BCL2L1-      catcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
A0A673IGS5_BCL2L1-      catcacgcctgccacggcgtaccagagcttcgagagcgtgatggatgagg
A0A673M4N6_BCL2L1-      catcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
                        *************** **********************************

A0A673M4N6_BCL2L1-      tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttc
A0A673IGS5_BCL2L1-      tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttt
A0A673M4N6_BCL2L1-      tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttc

A0A673M4N6_BCL2L1-      ggaggggctctgtgtgttgagtgcgtggagaaggagatgagcccgctagt
A0A673IGS5_BCL2L1-      ggaggggctctgtgtgttgagtgcgtggagaaggagatgagcccactagt
A0A673M4N6_BCL2L1-      ggaggggctctgtgtgttgagtgcgtggagaaggagatgagcccgctagt
                        ******************************************** *****

A0A673M4N6_BCL2L1-      gggaagcatcgcggattggatgaccgtctacctagacaacaaaattcagc
A0A673IGS5_BCL2L1-      gggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagc
A0A673M4N6_BCL2L1-      gggaagcatcgcggattggatgaccgtctacctagacaacaaaattcagc
                        *************** **********************************

A0A673M4N6_BCL2L1-      cctggatccagagccaaggaggatggg------------------ttgga
A0A673IGS5_BCL2L1-      cctggatccagagccaaggaggatgggaacgcttcgcagagatctttgga
A0A673M4N6_BCL2L1-      cctggatccagagccaaggaggatgggaacgcttcgcagagatctttgga
                        ***************************                  *****

A0A673M4N6_BCL2L1-      cg------agtggcaggtaatggag------------------------g
A0A673IGS5_BCL2L1-      aaagatgcagcggcagagagcagaaaatcacaagaaaacttcaagaagtg
A0A673M4N6_BCL2L1-      aaagatgcagtggcagagagcagaaaatcacaagaaaacttcaagaagtg
                                ** *****  *   **                         *

A0A673M4N6_BCL2L1-      ggtcctggt-ccagtcagctttttctct----ttgtgatcagggctgcga
A0A673IGS5_BCL2L1-      gttgctggtgggaatgaccttgctcacgggtgtcgtggtcgggtc-----
A0A673M4N6_BCL2L1-      gttgctggcgggaatgaccttgctcactggtgtcgtggtcgggtc-----
                        * * ****    * * * ***  ** *     * *** ** ** *     

A0A673M4N6_BCL2L1-      tctgattg------------ggtga
A0A673IGS5_BCL2L1-      actcattgcacaaaaacgcctgtga
A0A673M4N6_BCL2L1-      actcattgcacagaaacgcctgtga
                         ** ****             ****

© 1998-2021Legal notice