Dataset for CDS MCL-1 of organism Nothobranchius furzeri

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1A8A7I9_MCL1-01      atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctca
A0A1A8A7I9_MCL1-03      atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctca
A0A1A8A7I9_MCL1-02      atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctca
                        **************************************************

A0A1A8A7I9_MCL1-01      aaatggagtcgtggatggaccattacactacggaccgggagattcccctc
A0A1A8A7I9_MCL1-03      aaatggagtcgtggatggaccattacactacggaccgggagattcccctc
A0A1A8A7I9_MCL1-02      aaatggagtcgtggatggaccattacactacggaccgggagattcccctc
                        **************************************************

A0A1A8A7I9_MCL1-01      ctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagag
A0A1A8A7I9_MCL1-03      ctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagag
A0A1A8A7I9_MCL1-02      ctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagag
                        **************************************************

A0A1A8A7I9_MCL1-01      tccggtgacggccccaaacgcccgagcaacctggaagtgtctccgcacaa
A0A1A8A7I9_MCL1-03      tccggtgacggccccaaacgcccgagcaacctggaagtgtctccgcacaa
A0A1A8A7I9_MCL1-02      tccggtgacggccccaaacgcccgagcaacctggaagtgtctccgcacaa
                        **************************************************

A0A1A8A7I9_MCL1-01      tggatttgctgctaaacgcttcagccacgaggaggaggacggctctctgc
A0A1A8A7I9_MCL1-03      tggatttgctgctaaacgcttcagccacgaggaggaggacggctctctgc
A0A1A8A7I9_MCL1-02      tggatttgctgctaaacgcttcagccacgaggaggaggacggctctctgc
                        **************************************************

A0A1A8A7I9_MCL1-01      cgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggt
A0A1A8A7I9_MCL1-03      cgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggt
A0A1A8A7I9_MCL1-02      cgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggt
                        **************************************************

A0A1A8A7I9_MCL1-01      catgccggagatgaggcgctggcgaacgacaccagacaactaatcaaccg
A0A1A8A7I9_MCL1-03      catgccggagatgaggcgctggcgaacgacaccagacaactaatcaaccg
A0A1A8A7I9_MCL1-02      catgccggagatgaggcgctggcgaacgacaccagacaactaatcaaccg
                        **************************************************

A0A1A8A7I9_MCL1-01      cttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
A0A1A8A7I9_MCL1-03      cttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
A0A1A8A7I9_MCL1-02      cttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
                        **************************************************

A0A1A8A7I9_MCL1-01      gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacac
A0A1A8A7I9_MCL1-03      gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacac
A0A1A8A7I9_MCL1-02      gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacac
                        **************************************************

A0A1A8A7I9_MCL1-01      agatacgcttacaaaggtatggctgcgaaatgcacttccgatgacctgac
A0A1A8A7I9_MCL1-03      agatacgcttacaaaggtatggctgcgaaatgcacttccgatgacctgac
A0A1A8A7I9_MCL1-02      agatacgcttacaaaggtatggctgcgaaatgcacttccgatgacctgac
                        **************************************************

A0A1A8A7I9_MCL1-01      gttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaact
A0A1A8A7I9_MCL1-03      gttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaact
A0A1A8A7I9_MCL1-02      gttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaact
                        **************************************************

A0A1A8A7I9_MCL1-01      ggggtcggatcgtgagcctgctggccttcggggcggtggtggcccagtac
A0A1A8A7I9_MCL1-03      ggggtcggatcgtgagcctgctggccttcggggcggtggtggcccagtac
A0A1A8A7I9_MCL1-02      ggggtcggatcgtgagcctgctggccttcggggcggtggtggcccagtac
                        **************************************************

A0A1A8A7I9_MCL1-01      cagaaggacaacgggaggcaaaacaacgtagagctagtcagccatgaggt
A0A1A8A7I9_MCL1-03      cagaaggacaacgggaggcaaaacaacgtagagctagtcagccatgaggt
A0A1A8A7I9_MCL1-02      cagaaggacaacgggaggcaaaacaacgtagagctagtcagccatgaggt
                        **************************************************

A0A1A8A7I9_MCL1-01      ttcaacctacctgttgtctcaacagagagactttctgctcagaaacaact
A0A1A8A7I9_MCL1-03      ttcaacctacctgttgtctcaacagagagactttctgctcagaaacaact
A0A1A8A7I9_MCL1-02      ttcaacctacctgttgtctcaacagagagactttctgctcagaaacaact
                        **************************************************

A0A1A8A7I9_MCL1-01      catggcaaggctttgtggagttctttcgtgtaacagacccagagtcaaca
A0A1A8A7I9_MCL1-03      catggcaaggctttgtggagttctttcgtgtaacagacccagagtcaaca
A0A1A8A7I9_MCL1-02      catggcaaggctttgtggagttctttcgtgtaacagacccagagtcaaca
                        **************************************************

A0A1A8A7I9_MCL1-01      gtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
A0A1A8A7I9_MCL1-03      gtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
A0A1A8A7I9_MCL1-02      gtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
                        **************************************************

A0A1A8A7I9_MCL1-01      tctagccctgctgatcag--------------------------------
A0A1A8A7I9_MCL1-03      tctagccctgctgatcag--------------------------------
A0A1A8A7I9_MCL1-02      tctagccctgctgatcagttgttgcaggcatgacaccagttttcagacag
                        ******************                                

A0A1A8A7I9_MCL1-01      -------------------gtga
A0A1A8A7I9_MCL1-03      -------------------gtga
A0A1A8A7I9_MCL1-02      ttccctcaataccttcatattga
                                            ***

© 1998-2021Legal notice