Dataset for CDS MCL-1 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q95KR3_MCL1-01          atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg
A0A287BK44_MCL1-02      atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg
A0A287BK44_MCL1-01      atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg
                        **************************************************

Q95KR3_MCL1-01          gggggccggattggggcctggaagcggcagcagc----------------
A0A287BK44_MCL1-02      gggggccggattggggcctggaagcggcagcagcgcctccgctccgggag
A0A287BK44_MCL1-01      gggggccggattggggcctggaagcggcagcagcgcctccgctccgggag
                        **********************************                

Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      gccgtctcttggctacgggaaaagaggccacggcccggcaagaggtaggg
A0A287BK44_MCL1-01      gccgtctcttggctacgggaaaagaggccacggcccggcaagaggtaggg
                                                                          

Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ggaggggaagccggcatggtgattggcggaagcgccggcgcgagcccccc
A0A287BK44_MCL1-01      ggaggggaagccggcatggtgattggcggaagcgccggcgcgagcccccc
                                                                          

Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      gtccactcctgcgccagacgcccggagggtcgcgcggccctcgcccattg
A0A287BK44_MCL1-01      gtccactcctgcgccagacgcccggagggtcgcgcggccctcgcccattg
                                                                          

Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      gcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttc
A0A287BK44_MCL1-01      gcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttc
                                                                          

Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      gcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcctc
A0A287BK44_MCL1-01      gcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcctc
                                                                          

Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      cgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
A0A287BK44_MCL1-01      cgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
                                                                          

Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggag
A0A287BK44_MCL1-01      ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggag
                                                                          

Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      gccagtagtggccccggcacggacggctcgctcccctcgacgccgccccc
A0A287BK44_MCL1-01      gccagtagtggccccggcacggacggctcgctcccctcgacgccgccccc
                                                                          

Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ggcagaggaggaggaggacgagttataccggcagtccctggagattatct
A0A287BK44_MCL1-01      ggcagaggaggaggaggacgagttataccggcagtccctggagattatct
                                                                          

Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaatg
A0A287BK44_MCL1-01      ctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaatg
                                                                          

Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ggcgggtctggggccgccagccggaaggcgttagagaccctgcgacgggt
A0A287BK44_MCL1-01      ggcgggtctggggccgccagccggaaggcgttagagaccctgcgacgggt
                                                                          

Q95KR3_MCL1-01          -------------------------------gccttccaaggcatgcttc
A0A287BK44_MCL1-02      cggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttc
A0A287BK44_MCL1-01      cggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttc
                                                       *******************

Q95KR3_MCL1-01          ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A287BK44_MCL1-02      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A287BK44_MCL1-01      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
                        **************************************************

Q95KR3_MCL1-01          atggtccacgttttaagtgacggagtaacaaactggggcaggattgtgac
A0A287BK44_MCL1-02      atggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
A0A287BK44_MCL1-01      atggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
                        ************** ***********************************

Q95KR3_MCL1-01          tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatc
A0A287BK44_MCL1-02      tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatc
A0A287BK44_MCL1-01      tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatc
                        **************************************************

Q95KR3_MCL1-01          aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
A0A287BK44_MCL1-02      aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
A0A287BK44_MCL1-01      aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
                        **************************************************

Q95KR3_MCL1-01          aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
A0A287BK44_MCL1-02      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
A0A287BK44_MCL1-01      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
                        **************************************************

Q95KR3_MCL1-01          ggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc
A0A287BK44_MCL1-02      ggagttcttccatgtagaggacctagaaggcggcatcag-----------
A0A287BK44_MCL1-01      ggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc
                        ***************************************           

Q95KR3_MCL1-01          tggcttttgcaggtgttgctggagtaggagctggtttggcatatctaata
A0A287BK44_MCL1-02      ------------------------------------------atctaata
A0A287BK44_MCL1-01      tggcttttgcaggtgttgctggagtaggagctggtttggcatatctaata
                                                                  ********

Q95KR3_MCL1-01          agatag--------
A0A287BK44_MCL1-02      agatagccttttaa
A0A287BK44_MCL1-01      agatag--------
                        ******        

© 1998-2020Legal notice