Dataset for CDS MCL-1 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4X1SEZ6_MCL1-02      atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg
Q95KR3_MCL1-01          atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg
A0A287B149_MCL1-02      atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg
A0A287B149_MCL1-03      atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg
A0A4X1SEZ6_MCL1-01      atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgg

A0A4X1SEZ6_MCL1-02      gggggccggattggggcctggaagcggcagcagcgcctccgctccgggag
Q95KR3_MCL1-01          gggggccggattggggcctggaagcggcagcagc----------------
A0A287B149_MCL1-02      gggggccggattggggcctggaagcggcagcagcgcctccgctccgggag
A0A287B149_MCL1-03      gggggccggattggggcctggaagcggcagcagcgcctccgctccgggag
A0A4X1SEZ6_MCL1-01      gggggccggattggggcctggaagcggcagcagcgcctccgctccgggag

A0A4X1SEZ6_MCL1-02      gccgtctcttggctacgggaaaagaggccacggcccggcaagaggtaggg
Q95KR3_MCL1-01          --------------------------------------------------
A0A287B149_MCL1-02      gccgtctcttggctacgggaaaagaggccacggcccggcaagaggtaggg
A0A287B149_MCL1-03      gccgtctctt----------------------------------------
A0A4X1SEZ6_MCL1-01      gccgtctcttggctacgggaaaagaggccacggcccggcaagaggtaggg

A0A4X1SEZ6_MCL1-02      ggaggggaagccggcatggtgattggcggaagcgccggcgcgagcccccc
Q95KR3_MCL1-01          --------------------------------------------------
A0A287B149_MCL1-02      ggaggggaagccggcatggtgattggcggaagcgccggcgcgagcccccc
A0A287B149_MCL1-03      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      ggaggggaagccggcatggtgattggcggaagcgccggcgcgagcccccc

A0A4X1SEZ6_MCL1-02      gtccactcctgcgccagacgcccggagggtcgcgcggccctcgcccattg
Q95KR3_MCL1-01          --------------------------------------------------
A0A287B149_MCL1-02      gtccactcctgcgccagacgcccggagggtcgcgcggccctcgcccattg
A0A287B149_MCL1-03      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      gtccactcctgcgccagacgcccggagggtcgcgcggccctcgcccattg

A0A4X1SEZ6_MCL1-02      gcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttc
Q95KR3_MCL1-01          --------------------------------------------------
A0A287B149_MCL1-02      gcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttc
A0A287B149_MCL1-03      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      gcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttc

A0A4X1SEZ6_MCL1-02      gcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcctc
Q95KR3_MCL1-01          --------------------------------------------------
A0A287B149_MCL1-02      gcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcctc
A0A287B149_MCL1-03      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      gcgcccacccgcctcgcgtcgccgcctgaagagatggaatccccggcctc

A0A4X1SEZ6_MCL1-02      cgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
Q95KR3_MCL1-01          --------------------------------------------------
A0A287B149_MCL1-02      cgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
A0A287B149_MCL1-03      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      cgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc

A0A4X1SEZ6_MCL1-02      ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggag
Q95KR3_MCL1-01          --------------------------------------------------
A0A287B149_MCL1-02      ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggag
A0A287B149_MCL1-03      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggag

A0A4X1SEZ6_MCL1-02      gccagtagtggccccggcacggacggctcgctcccctcgacgccgccccc
Q95KR3_MCL1-01          --------------------------------------------------
A0A287B149_MCL1-02      gccagtagtggccccggcacggacggctcgctcccctcgacgccgccccc
A0A287B149_MCL1-03      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      gccagtagtggccccggcacggacggctcgctcccctcgacgccgccccc

A0A4X1SEZ6_MCL1-02      ggcagaggaggaggaggacgagttataccggcagtccctggagattatct
Q95KR3_MCL1-01          --------------------------------------------------
A0A287B149_MCL1-02      ggcagaggaggaggaggacgagttataccggcagtccctggagattatct
A0A287B149_MCL1-03      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      ggcagaggaggaggaggacgagttataccggcagtccctggagattatct

A0A4X1SEZ6_MCL1-02      ctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaatg
Q95KR3_MCL1-01          --------------------------------------------------
A0A287B149_MCL1-02      ctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaatg
A0A287B149_MCL1-03      -------------------ggcaaccggcgccaaggacgcgaagccaatg
A0A4X1SEZ6_MCL1-01      ctcggtaccttcgggagcaggcaaccggcgccaaggacgcgaagccaatg

A0A4X1SEZ6_MCL1-02      ggcgggtctggggccgccagccggaaggcgttagagaccctgcgacgggt
Q95KR3_MCL1-01          --------------------------------------------------
A0A287B149_MCL1-02      ggcgggtctggggccgccagccggaaggcgttagagaccctgcgacgggt
A0A287B149_MCL1-03      ggcgggtctggggccgccagccggaaggcgttagagaccctgcgacgggt
A0A4X1SEZ6_MCL1-01      ggcgggtctggggccgccagccggaaggcgttagagaccctgcgacgggt

A0A4X1SEZ6_MCL1-02      cggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttc
Q95KR3_MCL1-01          -------------------------------gccttccaaggcatgcttc
A0A287B149_MCL1-02      cggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttc
A0A287B149_MCL1-03      cggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttc
A0A4X1SEZ6_MCL1-01      cggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttc

A0A4X1SEZ6_MCL1-02      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
Q95KR3_MCL1-01          ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A287B149_MCL1-02      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A287B149_MCL1-03      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A4X1SEZ6_MCL1-01      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg

A0A4X1SEZ6_MCL1-02      atggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
Q95KR3_MCL1-01          atggtccacgttttaagtgacggagtaacaaactggggcaggattgtgac
A0A287B149_MCL1-02      atggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
A0A287B149_MCL1-03      atggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
A0A4X1SEZ6_MCL1-01      atggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
                        ************** ***********************************

A0A4X1SEZ6_MCL1-02      tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatc
Q95KR3_MCL1-01          tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatc
A0A287B149_MCL1-02      tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatc
A0A287B149_MCL1-03      tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatc
A0A4X1SEZ6_MCL1-01      tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatc

A0A4X1SEZ6_MCL1-02      aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
Q95KR3_MCL1-01          aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
A0A287B149_MCL1-02      aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
A0A287B149_MCL1-03      aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta
A0A4X1SEZ6_MCL1-01      aagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgta

A0A4X1SEZ6_MCL1-02      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
Q95KR3_MCL1-01          aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
A0A287B149_MCL1-02      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
A0A287B149_MCL1-03      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
A0A4X1SEZ6_MCL1-01      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt

A0A4X1SEZ6_MCL1-02      ggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc
Q95KR3_MCL1-01          ggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc
A0A287B149_MCL1-02      ggagttcttccatgtagaggacctagaaggcggcatcag-----------
A0A287B149_MCL1-03      ggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc
A0A4X1SEZ6_MCL1-01      ggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc

A0A4X1SEZ6_MCL1-02      tggcttttgcag--------agaaaagcaagtgg-----------caaga
Q95KR3_MCL1-01          tggcttttgcaggtgttgctggagtaggagctggtttggcatatctaata
A0A287B149_MCL1-02      ------------------------------------------atctaata
A0A287B149_MCL1-03      tggcttttgcaggtgttgctggagtaggagctggtttggcatatctaata
A0A4X1SEZ6_MCL1-01      tggcttttgcaggtgttgctggagtaggagctggtttggcatatctaata
                                                                      ** *

A0A4X1SEZ6_MCL1-02      ggattatgactga-
Q95KR3_MCL1-01          agatag--------
A0A287B149_MCL1-02      agatagccttttaa
A0A287B149_MCL1-03      agatag--------
A0A4X1SEZ6_MCL1-01      agatag--------

© 1998-2020Legal notice