Dataset for CDS MCL-1 of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A287B149_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=597 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagct
gcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A287B149_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1011 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagatctaataagatagccttttaa
>gnl|bcl2dbcds|A0A287B149_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|A0A4X1SEZ6_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=597 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagct
gcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4X1SEZ6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|A0A4X1SEZ6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1044 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcagagaaaagcaagtggcaagaggattatga
ctga
>gnl|bcl2dbcds|Q95KR3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=459 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtcc
acgttttaagtgacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttg
aagagtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactg
gctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgc
tgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
© 1998-2020Legal notice