Dataset for CDS BCL2L2 of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I2YPX6_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
A0A2I2YPX6_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
A0A2I2YPX6_BCL2L2-      atggcgaccccagcctcggccccagacaca-cgggctctggtggcagact
A0A2I2YPX6_BCL2L2-      atggcgaccccagcctcggccccagacaca-cgggctctggtggcagact
                        ****** *  * **  ****  ***   ** ****  ***  *** * * 

A0A2I2YPX6_BCL2L2-      ---ggggctccgggccggggcggcgacgccatcttgtgcccggggccggt
A0A2I2YPX6_BCL2L2-      ---ggggctccgggccggggcggcgacgccatcttgtgcccggggccggt
A0A2I2YPX6_BCL2L2-      ttgtaggttataagctgaggcagaagggtta---tgtctgtggagctggc
A0A2I2YPX6_BCL2L2-      ttgtaggttataagctgaggcagaagggtta---tgtctgtggagctggc
                             ** *    ** * *** *    *  *   ***    ** ** ** 

A0A2I2YPX6_BCL2L2-      ----ggggaggccggggagggggccccggggggcgcaggggactacggga
A0A2I2YPX6_BCL2L2-      ----ggggaggccggggagggggccccggggggcgcaggggactacggga
A0A2I2YPX6_BCL2L2-      cccggggagggcccagcagctgaccc-----gctgcaccaagccatgcgg
A0A2I2YPX6_BCL2L2-      cccggggagggcccagcagctgaccc-----gctgcaccaagccatgcgg
                            ***  ****  * **  * ***     *  ***     * * * * 

A0A2I2YPX6_BCL2L2-      acggcctg----gagtctgag------------------------gaact
A0A2I2YPX6_BCL2L2-      acggcctg----gagtctgag------------------------gaact
A0A2I2YPX6_BCL2L2-      gcagctggagatgagttcgagacccgcttccggcgcaccttctctgatct
A0A2I2YPX6_BCL2L2-      gcagctggagatgagttcgagacccgcttccggcgcaccttctctgatct
                         * **  *    ****  ***                        ** **

A0A2I2YPX6_BCL2L2-      ggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaag
A0A2I2YPX6_BCL2L2-      ggagcctgagga--------------------------------------
A0A2I2YPX6_BCL2L2-      ggcggctcagctgcatgtg-----------accccaggctcagcccaaca
A0A2I2YPX6_BCL2L2-      ggcggctcagctgcatgtg-----------accccaggctcagcccaaca
                        ** * ** **                                        

A0A2I2YPX6_BCL2L2-      aggagccgccccggcccc------------------gcgcccccccggga
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      acgcttcacccaggtctccgatgaactttttcaagggggccccaactggg
A0A2I2YPX6_BCL2L2-      acgcttcacccaggtctccgatgaactttttcaagggggccccaactggg
                                                                          

A0A2I2YPX6_BCL2L2-      gctcc----gggccctgggcctggttcgggagcccccggcagccaagag-
A0A2I2YPX6_BCL2L2-      ------------------------------------------ccaagag-
A0A2I2YPX6_BCL2L2-      gccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagt
A0A2I2YPX6_BCL2L2-      gccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagt
                                                                  *  **** 

A0A2I2YPX6_BCL2L2-      ------gaggaggaggagcc------gggac--------tggtcgagggt
A0A2I2YPX6_BCL2L2-      ------gaggaggaggagcc------gggac--------tggtcgagggt
A0A2I2YPX6_BCL2L2-      gtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggt
A0A2I2YPX6_BCL2L2-      gtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggt
                               *****  *** **      *****          ** ** ***

A0A2I2YPX6_BCL2L2-      gac---ccgggggacggcgc-------------------cattgaggacc
A0A2I2YPX6_BCL2L2-      gac---ccgggggacggcgc-------------------cattgaggacc
A0A2I2YPX6_BCL2L2-      ggcctacctggagacgcggctggctgactggatccacagcagtgggggct
A0A2I2YPX6_BCL2L2-      ggcctacctggagacgcggctggctgactggatccacagcagtgggggct
                        * *   ** ** ****  **                   ** ** ** * 

A0A2I2YPX6_BCL2L2-      cggagctggaagctatcaaagctcgagtcagggagatgga---ggaagaa
A0A2I2YPX6_BCL2L2-      cggagctggaagctatcaaagctcgagtcagggagatgga---ggaagaa
A0A2I2YPX6_BCL2L2-      gggagctggaagctatcaaagctcgagtcagggagatgga---ggaagaa
A0A2I2YPX6_BCL2L2-      gggcg------gagttcacagctctatacggggacggggccctggaggag
                         ** *      *   *** ***** *  * ****   **    *** ** 

A0A2I2YPX6_BCL2L2-      gctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatat
A0A2I2YPX6_BCL2L2-      gctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatat
A0A2I2YPX6_BCL2L2-      gctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatat
A0A2I2YPX6_BCL2L2-      gcgcggcgtctgcgggag---------------gggaactgggcatcagt
                        **   *   **   ****               * ***   *       *

A0A2I2YPX6_BCL2L2-      gagtccacctccaggcaatgctggaccagtgatcatgtccattgaggaga
A0A2I2YPX6_BCL2L2-      gagtccacctccaggcaatgctggaccagtgatcatgtccattgaggaga
A0A2I2YPX6_BCL2L2-      gagtccacctccaggcaatgctggaccagtgatcatgtccattgaggaga
A0A2I2YPX6_BCL2L2-      gag----------gacagtgct----------------------------
                        ***          * ** ****                            

A0A2I2YPX6_BCL2L2-      agatggaggctgatgcccgttccatctatgttggcaatgtggactatggt
A0A2I2YPX6_BCL2L2-      agatggaggctgatgcccgttccatctatgttggcaatgtggactatggt
A0A2I2YPX6_BCL2L2-      agatggaggctgatgcccgttccatctatgttggcaatgtggactatggt
A0A2I2YPX6_BCL2L2-      -gacgggggccg-------------------tggcactgggggccctggt
                         ** ** *** *                   ***** ** ** *  ****

A0A2I2YPX6_BCL2L2-      gcaacagcagaagagctggaagctcactttcatggctgtggttcagtcaa
A0A2I2YPX6_BCL2L2-      gcaacagcagaagagctggaagctcactttcatggctgtggttcagtcaa
A0A2I2YPX6_BCL2L2-      gcaacagcagaagagctggaagctcactttcatggctgtggttcagtcaa
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I2YPX6_BCL2L2-      ccgtgttaccatactctgtgacaaatttagtggccatcccaaagggtttg
A0A2I2YPX6_BCL2L2-      ccgtgttaccatactctgtgacaaatttagtggccatcccaaagggtttg
A0A2I2YPX6_BCL2L2-      ccgtgttaccatactctgtgacaaatttagtggccatcccaaagggtttg
A0A2I2YPX6_BCL2L2-      ----------------------aactgtaggggcctt-------------
                                              ** * *** **** *             

A0A2I2YPX6_BCL2L2-      catatatagagttctcagacaaagagtcagtgaggacttccttggcctta
A0A2I2YPX6_BCL2L2-      catatatagagttctcagacaaagagtcagtgaggacttccttggcctta
A0A2I2YPX6_BCL2L2-      catatatagagttctcagacaaagagtcagtgaggacttccttggcctta
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I2YPX6_BCL2L2-      gatgagtccctatttagaggaaggcaaatca-------------------
A0A2I2YPX6_BCL2L2-      gatgagtccctatttagaggaaggcaaatca-------------------
A0A2I2YPX6_BCL2L2-      gatgagtccctatttagaggaaggcaaatcaaggttgactttaaggctat
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I2YPX6_BCL2L2-      --------------------aggtgatcccaaaacgaaccaacagaccag
A0A2I2YPX6_BCL2L2-      --------------------aggtgatcccaaaacgaaccaacagaccag
A0A2I2YPX6_BCL2L2-      catttgttcatctctgactcaggtgatcccaaaacgaaccaacagaccag
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I2YPX6_BCL2L2-      gcatcagcacaacagaccggggttttccacgagcccgctaccgcgcccgg
A0A2I2YPX6_BCL2L2-      gcatcagcacaacagaccggggttttccacgagcccgctaccgcgcccgg
A0A2I2YPX6_BCL2L2-      gcatcagcacaacagaccggggttttccacgagcccgctaccgcgcccgg
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I2YPX6_BCL2L2-      accaccaactacaacagttcccgctctcgattctacagtggttttaacag
A0A2I2YPX6_BCL2L2-      accaccaactacaacagttcccgctctcgattctacagtggttttaacag
A0A2I2YPX6_BCL2L2-      accaccaactacaacagttcccgctctcgattctacagtggttttaacag
A0A2I2YPX6_BCL2L2-      -----------------------------------------ttttgctag
                                                                 ****   **

A0A2I2YPX6_BCL2L2-      caggccccggggtcgcgtctacaggggccgggctagagcgacatcatggt
A0A2I2YPX6_BCL2L2-      caggccccggggtcgcgtctacaggggccgggctagagcgacatcatggt
A0A2I2YPX6_BCL2L2-      caggccccggggtcgcgtctacaggggccgggctagagcgacatcatggt
A0A2I2YPX6_BCL2L2-      caag----------------------------------------------
                        ** *                                              

A0A2I2YPX6_BCL2L2-      attccccttactaa
A0A2I2YPX6_BCL2L2-      attccccttactaa
A0A2I2YPX6_BCL2L2-      attccccttactaa
A0A2I2YPX6_BCL2L2-      -----------tga
                                   * *

© 1998-2022Legal notice