Dataset for CDS BAX-like of Organism Lynx canadensis

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A667FZZ3_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Lynx canadensis GN=BAK1 (length=636 residues).
atggcatccgggcaaggcccaggtcctcccaggcaggagtgtgaagagactgccccgtctgctacttctgaggagcaggt
agcccgggacaccgaggaggttttccgcagctatgtttttcaccgttatcagcaggagcaggaggctgagggggcagctg
cgcctactgacccagaaatagtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgccatc
attggggacaacatcaaccagcgctacgattcagagttccaggccatgctgcagcgcctgcaacccacagcagagaacgc
ctatgaacttttcaccaagattgcctcgagtctatttgagagcggcatcaactggggccgagtggtggctctcctgggct
ttggctaccgcctggctctacacatctaccagcacggcctgaccggcttcctgggccaggtgaccaaactggtggtcgac
gtcatgctgcgtcactgcattgcccggtggattgcgcagaggggcggctgggtggcagccctgaacttgggaaatggccc
catcgtgaacgtgctgatagttctgtctgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A667FZZ3_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Lynx canadensis GN=BAK1 (length=462 residues).
atggcatccgggcaaggcccaggtcctcccaggcaggagtgtgaagagactgccccgtctgctacttctgaggagcaggt
agcccgggacaccgaggaggttttccgcagctatgtttttcaccgttatcagcaggagcaggaggctgagggggcagctg
cgcctactgacccagaaatagtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgccatc
attggggacaacatcaaccagcgctacgattcagagttccaggccatgctgcagcgcctgcaacccacagcagagaacgc
ctatgaacttttcaccaagattgcctcgaggccagcagcaacacccacagtctatttgagagcggcatcaactggggccg
agtggtggctctcctgggctttggctaccgcctggctctacacatctaccagcacggcctga
>gnl|bcl2dbcds|A0A667HL10_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Lynx canadensis GN=BOK (length=642 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggccgggagttcgtgcatgcgcgactgctgcgcgccggcctcgcctggaacgcgcccg
aacgcgccgctcccgcccccggaggccgcctggcggaggtgtgcgcggtgctgctgcgcctgggagatgagctggagctg
atccggcccagcatctaccgcaacgtggctcgtcagctgaacatctccctgcagtctgagacagtggtgaccgacgcctt
cctggccgtggcagcacaaatcttctccgcaggcatcacgtggggcaaggtggtgtccctgtactcagtggctgcggggc
tggccgtagactgtgtgcggcaggcccagcccgccgtggtccacgctatcgtcgactgcctcggggagtttgtgcgcaag
accctggcgccctggctgcggaggcgcggcggatggaccgatgtcctcaagtgtgtggtcagcaccgagcccggcttccg
ctcacactggctggtggccgcactctgcagcttcggccgcttcctgaaggccgccttcttcgtgctgttgccagagagat
ga
>gnl|bcl2dbcds|A0A667HL10_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Lynx canadensis GN=BOK (length=621 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggccgggagttcgtgcatgcgcgactgctgcgcgccggcctcgcctggaacgcgcccg
aacgcgccgctcccgcccccggaggccgcctggcggaggtgtgcgcggtgctgctgcgcctgggagatgagctggagctg
atccggcccagcatctaccgcaacgtggctcgtcagctgaacatctccctgcagtctgagacagtggtgaccgacgcctt
cctggccgtggcagcacaaatcttctccgcagaccgatgtcctcaagtgtgtggtcagcaccgagcccggcttccgctca
cactggctggtggccgcactctgcagcttcggccgcttcctgaaggccgccttcttcgtgctgttgccagagagatgagc
cgctggctcgggcagaggccgaagccaggctctccgacccaggagacccccggccctcgaaagcgccaacgtcctcccca
accaggctgggaacgctccgatcctcagagccccgcctcggtgccggaggccctgccctga
>gnl|bcl2dbcds|A0A667HTQ5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Lynx canadensis GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacgcccgagctggccttggagcaggtgccccaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggagatgaactggacagtaacatggaattgcagaggatgatt
gcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttttccgatggcaacttcaactg
gggccgggtcgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatcc
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtgctgactgcgtcactcaccat
ctggaaaaagatgggctga
>gnl|bcl2dbcds|A0A667HTQ5_BAX-02 BCL2-associated X gene OS=[Eukaryota] Lynx canadensis GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgcagctgtggacacagactccccccgcgaggtctttttccgagtggcagcggagatgttttccgatg
gcaacttcaactggggccgggtcgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtg
cccgagctgatccggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccaggg
tggttgggacggcctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggccggagtgctgactg
cgtcactcaccatctggaaaaagatgggctga
© 1998-2023Legal notice