Dataset for CDS BAX-like of Organism Lynx canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A667HL10_BOK-01       atggaggtgctgcggc----------gctcctcggtcttcgccg------
A0A667HL10_BOK-02       atggaggtgctgcggc----------gctcctcggtcttcgccg------
A0A667HTQ5_BAX-01       atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A667HTQ5_BAX-02       atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A667FZZ3_BAK1-01      atggc---atccgggca---------aggcccaggtcctcccag------
A0A667FZZ3_BAK1-02      atggc---atccgggca---------aggcccaggtcctcccag------
                        ****         **              *   ** *    * *      

A0A667HL10_BOK-01       ccgagatcatggacgcctttgaccgctcgccca-----------------
A0A667HL10_BOK-02       ccgagatcatggacgcctttgaccgctcgccca-----------------
A0A667HTQ5_BAX-01       gca-gatcatgaagacaggggcccttttgcttcagggtttcatccaagat
A0A667HTQ5_BAX-02       gca-gatcatgaagacaggggcccttttgcttcagg--------------
A0A667FZZ3_BAK1-01      gcaggagtgtgaagagactgccccgtctgctac-----------------
A0A667FZZ3_BAK1-02      gcaggagtgtgaagagactgccccgtctgctac-----------------
                         *  **   ** *         **    **                    

A0A667HL10_BOK-01       --------------------------------------------------
A0A667HL10_BOK-02       --------------------------------------------------
A0A667HTQ5_BAX-01       cgagcagggcgaatggggggagagacgcccgagctggccttggagcaggt
A0A667HTQ5_BAX-02       --------------------------------------------------
A0A667FZZ3_BAK1-01      --------------------------------------------------
A0A667FZZ3_BAK1-02      --------------------------------------------------
                                                                          

A0A667HL10_BOK-01       --------------------------------------------------
A0A667HL10_BOK-02       --------------------------------------------------
A0A667HTQ5_BAX-01       gccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcg
A0A667HTQ5_BAX-02       --------------------------------------------------
A0A667FZZ3_BAK1-01      --------------------------------------------------
A0A667FZZ3_BAK1-02      --------------------------------------------------
                                                                          

A0A667HL10_BOK-01       --------------------------ccgacaagga-gctggtggcccag
A0A667HL10_BOK-02       --------------------------ccgacaagga-gctggtggcccag
A0A667HTQ5_BAX-01       gagatgaactggacagtaacatggaattgcagaggatgattgcagctgtg
A0A667HTQ5_BAX-02       ---------------------------------ggatgattgcagctgtg
A0A667FZZ3_BAK1-01      ---------------------------ttctgagga-gcaggtagcccgg
A0A667FZZ3_BAK1-02      ---------------------------ttctgagga-gcaggtagcccgg
                                                         *** *   *  **   *

A0A667HL10_BOK-01       gccaagg---cgctcggccgggagttcgtgcatgc-gcgact--gctgcg
A0A667HL10_BOK-02       gccaagg---cgctcggccgggagttcgtgcatgc-gcgact--gctgcg
A0A667HTQ5_BAX-01       gacacagactccccccgcgaggtctttttccgagtggcagcggagatgtt
A0A667HTQ5_BAX-02       gacacagactccccccgcgaggtctttttccgagtggcagcggagatgtt
A0A667FZZ3_BAK1-01      gacac------------cgaggaggttttcc-----gcagctatgttttt
A0A667FZZ3_BAK1-02      gacac------------cgaggaggttttcc-----gcagctatgttttt
                        * **             *  **   *  * *     **  *   * *   

A0A667HL10_BOK-01       cgccggcctcgcctggaac--gcgcccga------acgcgccgctcccgc
A0A667HL10_BOK-02       cgccggcctcgcctggaac--gcgcccga------acgcgccgctcccgc
A0A667HTQ5_BAX-01       ttccgatggcaacttcaactgg-ggccgggtcgttgccctcttctacttt
A0A667HTQ5_BAX-02       ttccgatggcaacttcaactgg-ggccgggtcgttgccctcttctacttt
A0A667FZZ3_BAK1-01      caccgttatcagcaggagcaggaggctgagggggcagctgcgcctactga
A0A667FZZ3_BAK1-02      caccgttatcagcaggagcaggaggctgagggggcagctgcgcctactga
                          ***    *  *   * *  * * * *            *  ** *   

A0A667HL10_BOK-01       ccccgga--ggccgcctggcggaggtgtgcgcggtgctgctgcgcctggg
A0A667HL10_BOK-02       ccccgga--ggccgcctggcggaggtgtgcgcggtgctgctgcgcctggg
A0A667HTQ5_BAX-01       gccagca------aactggt------gctcaaggccctgt-gtaccaag-
A0A667HTQ5_BAX-02       gccagca------aactggt------gctcaaggccctgt-gtaccaag-
A0A667FZZ3_BAK1-01      cccagaaatagtcaccttgc------ccctagaacctagcagcaccatg-
A0A667FZZ3_BAK1-02      cccagaaatagtcaccttgc------ccctagaacctagcagcaccatg-
                         ** * *        ** *                   *  *  **  * 

A0A667HL10_BOK-01       agatgagctggagctgatccgg------cccagcatctaccgcaacgtgg
A0A667HL10_BOK-02       agatgagctggagctgatccgg------cccagcatctaccgcaacgtgg
A0A667HTQ5_BAX-01       ----gtgcccgagctgatccgg------accatcat-----------ggg
A0A667HTQ5_BAX-02       ----gtgcccgagctgatccgg------accatcat-----------ggg
A0A667FZZ3_BAK1-01      ----gggc---aggtgggtcggcagctcgccatcat-----------tgg
A0A667FZZ3_BAK1-02      ----gggc---aggtgggtcggcagctcgccatcat-----------tgg
                            * **   ** **   ***       *** ***            **

A0A667HL10_BOK-01       ctcgtcag-------ctgaacatctccctgcagtctgagacagtggtg-a
A0A667HL10_BOK-02       ctcgtcag-------ctgaacatctccctgcagtctgagacagtggtg-a
A0A667HTQ5_BAX-01       ctggaca--------ctggacttccttcgagagc----ggc--tgctg--
A0A667HTQ5_BAX-02       ctggaca--------ctggacttccttcgagagc----ggc--tgctg--
A0A667FZZ3_BAK1-01      --ggacaacatcaaccagcgctacgattcagagttccaggccatgctgca
A0A667FZZ3_BAK1-02      --ggacaacatcaaccagcgctacgattcagagttccaggccatgctgca
                           * **        * *  *  *       **     * *  ** **  

A0A667HL10_BOK-01       ccgacgccttcctggccgtggcagcacaaatcttctccgcaggcatcacg
A0A667HL10_BOK-02       ccgacgccttcctggccgtggcagcacaaatcttctccgca---------
A0A667HTQ5_BAX-01       --g-------gctggatccaggaccaggg--tggtt--------------
A0A667HTQ5_BAX-02       --g-------gctggatccaggaccaggg--tggtt--------------
A0A667FZZ3_BAK1-01      gcg-------cctgcaacccacagcagagaacgcct--------------
A0A667FZZ3_BAK1-02      gcg-------cctgcaacccacagcagagaacgcct--------------
                          *        ***        * **         *              

A0A667HL10_BOK-01       tggggcaaggtggtgtccctgtactcagtggctgcggggctggccgtaga
A0A667HL10_BOK-02       --------------------------------------------------
A0A667HTQ5_BAX-01       --------------------------------------------------
A0A667HTQ5_BAX-02       --------------------------------------------------
A0A667FZZ3_BAK1-01      --------------------------------------------------
A0A667FZZ3_BAK1-02      --------------------------------------------------
                                                                          

A0A667HL10_BOK-01       ctgtgtgcggcaggcccagcccgccgtggtccacgctatcgtcgactgcc
A0A667HL10_BOK-02       --------------------------------------------------
A0A667HTQ5_BAX-01       --------------------------------------------------
A0A667HTQ5_BAX-02       --------------------------------------------------
A0A667FZZ3_BAK1-01      --------------------------------------------------
A0A667FZZ3_BAK1-02      --------------------------------------------------
                                                                          

A0A667HL10_BOK-01       tcggggagtttgtgcgcaagaccctggcgccctggctgcggaggcgcggc
A0A667HL10_BOK-02       --------------------------------------------------
A0A667HTQ5_BAX-01       -------------------------------------------------g
A0A667HTQ5_BAX-02       -------------------------------------------------g
A0A667FZZ3_BAK1-01      --------------------------------------------------
A0A667FZZ3_BAK1-02      --------------------------------------------------
                                                                          

A0A667HL10_BOK-01       ggatggaccgatgtcctcaagtgtgtggtcagca----------------
A0A667HL10_BOK-02       -----gaccgatgtcctcaagtgtgtggtcagca----------------
A0A667HTQ5_BAX-01       ggacggcctcctctcctactttgggacacccacg----------------
A0A667HTQ5_BAX-02       ggacggcctcctctcctactttgggacacccacg----------------
A0A667FZZ3_BAK1-01      --atgaacttttcaccaagattg------cctcg----------------
A0A667FZZ3_BAK1-02      --atgaacttttcaccaagattg------cctcgaggccagcagcaacac
                               *   *  **     **      *  *                 

A0A667HL10_BOK-01       -----------ccgagcccggcttccgctcacactggctggtggccgcac
A0A667HL10_BOK-02       -----------ccgagcccggcttccgctcacactggctggtggccgcac
A0A667HTQ5_BAX-01       --------tggcagacagtgaccatctttgtggccgg--agtgctgact-
A0A667HTQ5_BAX-02       --------tggcagacagtgaccatctttgtggccgg--agtgctgact-
A0A667FZZ3_BAK1-01      ----agtctatttgagagcggcatcaactggggcc-g--agtggtggctc
A0A667FZZ3_BAK1-02      ccacagtctatttgagagcggcatcaactggggcc-g--agtggtggctc
                                     **    * *      *    *  *   ***    *  

A0A667HL10_BOK-01       tctgcagcttcggccgcttcctgaaggccgccttcttcgtgctgttgcca
A0A667HL10_BOK-02       tctgcagcttcggccgcttcctgaaggccgccttcttcgtgctgttgcca
A0A667HTQ5_BAX-01       ------gcgtcactcaccatctg------g-------------------a
A0A667HTQ5_BAX-02       ------gcgtcactcaccatctg------g-------------------a
A0A667FZZ3_BAK1-01      tcctgggctttggctaccgcctg------gctctacacat-------cta
A0A667FZZ3_BAK1-02      tcctgggctttggctaccgcctg------gctctacacat-------cta
                              ** *      *   ***      *                   *

A0A667HL10_BOK-01       gagagatga-----------------------------------------
A0A667HL10_BOK-02       gagagatgagccgc------------------------------------
A0A667HTQ5_BAX-01       aaaagatgggctga------------------------------------
A0A667HTQ5_BAX-02       aaaagatgggctga------------------------------------
A0A667FZZ3_BAK1-01      ccagcacggcctgaccggcttcctgggccaggtgaccaaactggtggtcg
A0A667FZZ3_BAK1-02      ccagcacggcctga------------------------------------
                             * *                                          

A0A667HL10_BOK-01       --------------------------------------------------
A0A667HL10_BOK-02       ----------------tggctcgggcagaggccgaagccaggctctccga
A0A667HTQ5_BAX-01       --------------------------------------------------
A0A667HTQ5_BAX-02       --------------------------------------------------
A0A667FZZ3_BAK1-01      acgtcatgctgcgtcactgcattgcccggtggattgcgcagaggggcggc
A0A667FZZ3_BAK1-02      --------------------------------------------------
                                                                          

A0A667HL10_BOK-01       --------------------------------------------------
A0A667HL10_BOK-02       cccaggagacccccggccctcgaaagcgccaacgtcctccccaaccaggc
A0A667HTQ5_BAX-01       --------------------------------------------------
A0A667HTQ5_BAX-02       --------------------------------------------------
A0A667FZZ3_BAK1-01      tgggtggcagccctgaacttgggaaatggccccatcgtgaacgtgctgat
A0A667FZZ3_BAK1-02      --------------------------------------------------
                                                                          

A0A667HL10_BOK-01       --------------------------------------------------
A0A667HL10_BOK-02       tgggaacgctccgatcctcagagccccgcctcggtgccggaggccctgcc
A0A667HTQ5_BAX-01       --------------------------------------------------
A0A667HTQ5_BAX-02       --------------------------------------------------
A0A667FZZ3_BAK1-01      agttctgtctgtggttctgttgggccagtttgtggtacgaagattcttca
A0A667FZZ3_BAK1-02      --------------------------------------------------
                                                                          

A0A667HL10_BOK-01       --------
A0A667HL10_BOK-02       ctga----
A0A667HTQ5_BAX-01       --------
A0A667HTQ5_BAX-02       --------
A0A667FZZ3_BAK1-01      aatcatga
A0A667FZZ3_BAK1-02      --------
                                

© 1998-2023Legal notice