Dataset for CDS BCL2L1 of organism Cynoglossus semilaevis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8UWG7_BCL2L1-      actttgacctttaatattaacagaaaactggtggtcgactacatacagta
A0A3P8VMA1_BCL2L1-      atgtcgtgc------agtaacagagaattggttaagttctttttaggtta
                        *  * *  *      * ******* ** ****      **   **   **

A0A3P8UWG7_BCL2L1-      taaactttcccagaggaactttcccgtccaccacctgggactcggtgatt
A0A3P8VMA1_BCL2L1-      taagctttctcagaggaact-------------------acccagaatct
                        *** ***** **********                   ** * *    *

A0A3P8UWG7_BCL2L1-      ctccaaacaggactgatggggaagaggcagggttgggcgcagagcagcgg
A0A3P8VMA1_BCL2L1-      ctt---------ctgatgttg-------aggattggg-ggagaacagcgt
                        **          ******  *       *** ***** * *** ***** 

A0A3P8UWG7_BCL2L1-      acaagtacgca---cgccaacgggactgtaaacggcacaagttctgggac
A0A3P8VMA1_BCL2L1-      gaaggtgaggaggtcaccacagcgtccagtaatggcgt---tcctcaga-
                          * **  * *   * ***  * * *    ** ***     * **  ** 

A0A3P8UWG7_BCL2L1-      gccgcctgcatctccactgcggcagcagcattcggcgtcggatacaagtc
A0A3P8VMA1_BCL2L1-      --ctccttcagctgtgctgcagca-ctgcagt--------------ggtg
                          * *** ** **   **** *** * *** *               ** 

A0A3P8UWG7_BCL2L1-      tggactccattaaagaggctctgcgggactcggccaacgagtttgaactg
A0A3P8VMA1_BCL2L1-      cagaggctgtaaaggctgctctcaaggactcagctgacgagtttgaactt
                          **  *  * ** *  *****   ****** **  ************* 

A0A3P8UWG7_BCL2L1-      cgatacgcgcgggccttcagcgatctgcaccagcagctgcacatcacacc
A0A3P8VMA1_BCL2L1-      cgcttcacacaagcctttcgtaaccttttcttaaagctggacctcactcc
                        ** * * * *  *****  *  * **   *    ***** ** **** **

A0A3P8UWG7_BCL2L1-      agccactgcctaccaaagtttcgagaatgtgatggacgaagtgttccggg
A0A3P8VMA1_BCL2L1-      ggacacagtctaccacagttttaagagcgtgatggatgaggtcttcagag
                         * *** * ****** *****  ***  ******** ** ** *** * *

A0A3P8UWG7_BCL2L1-      acggtgtcaattggggtcgcatcatagggctcttcgccttcggcggggcg
A0A3P8VMA1_BCL2L1-      acggagtcaactggggacgcatagtcggcctgtttactttcggaggagta
                        **** ***** ***** *****  * ** ** **  * ***** ** *  

A0A3P8UWG7_BCL2L1-      ctgagtgtcgagtgcgtggagaaagagatgagtcagctggtggccaggat
A0A3P8VMA1_BCL2L1-      ctgtgtgtggaatgtgtgcagaggaatatgagtgagttagttccccgcat
                        *** **** ** ** *** ***   * ****** ** * **  ** * **

A0A3P8UWG7_BCL2L1-      tgcggattggatgacagtctatcttgacaaccacatccagccatggatcg
A0A3P8VMA1_BCL2L1-      tgcagactggatgaccatgtacttggatgaatacattgatccatggatcc
                        *** ** ********  * **  * **  *  ****  * ********* 

A0A3P8UWG7_BCL2L1-      aaacccaaggtggatgggagcattttgcggaactctttggt-caggatg-
A0A3P8VMA1_BCL2L1-      agagccaaggaggctgggaccgttttgctgagatttttggcacagactgt
                        * * ****** ** ***** * ****** **  * *****  ***  ** 

A0A3P8UWG7_BCL2L1-      ----cagcagcggagagccgg-aggtcacaggagagttttaagaaatggt
A0A3P8VMA1_BCL2L1-      attccaagaacgaggagttgtcgggacacag-------tgagaagatggc
                            **  * **  ***  *   ** *****       * *  * **** 

A0A3P8UWG7_BCL2L1-      tgctggctgggatgacgctggtgacaggcgtggtggtgggctccctgatt
A0A3P8VMA1_BCL2L1-      tgctagtgggagcaggcctgcttgcagcagtgttgattggtgttctgatc
                        **** *  **       *** *  ***  *** ** * **    ***** 

A0A3P8UWG7_BCL2L1-      gcccagaaacgtctctga
A0A3P8VMA1_BCL2L1-      actaaaaagcat---tga
                         *  * ** * *   ***

© 1998-2020Legal notice