Dataset for CDS BCL-2-like of organism Malurus cyaneus samueli

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C5X4L3_BCL2A1-      atg-----------------------------------gaaactgctgag
A0A8C5TLV4_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
A0A8C5U1E1_BCL2L1-      atg-----tccag-------------cagtaaccgggagttagtgattga
                        ***                                   *  * ** *   

A0A8C5X4L3_BCL2A1-      ttctattacgtttattacctcgc---------------------------
A0A8C5TLV4_BCL2-01      gtacatccactataaactctcgcagaggggatacgactgggctgccagc-
A0A8C5U1E1_BCL2L1-      ctttgtttcctacaagctctcacagaaaggatacagctgga--gtcagct
                         *   *    *  *    *** *                           

A0A8C5X4L3_BCL2A1-      ----------------------tcaagattacctg---------------
A0A8C5TLV4_BCL2-01      -gaggacagggcacccctgcctccaggtct--ctctgctcctgctgctgc
A0A8C5U1E1_BCL2L1-      ggaggaggagg-----atgagaacaggactgactttgcaggggaggagga
                                               ** *  *  **                

A0A8C5X4L3_BCL2A1-      -----cagtatgtgctcc----aggaatcccacctcgcac----------
A0A8C5TLV4_BCL2-01      tg---cggttgctgctgctgctgggacttcctctgatcacac-tgggctg
A0A8C5U1E1_BCL2L1-      cgacatggacggtgtcctcaatgggagcccctcctggcacgcacccacca
                               *    **         ***   ** *    ***          

A0A8C5X4L3_BCL2A1-      --------------------------------------------------
A0A8C5TLV4_BCL2-01      gtgtctccgcaccccgagccccccggctcggctgctgctagccacacgcc
A0A8C5U1E1_BCL2L1-      gccacatagtgaacggagccaccgtgcaccggagcagc----------ct

A0A8C5X4L3_BCL2A1-      --cagcccaga---------------ccagggttgctca---cgtcttga
A0A8C5TLV4_BCL2-01      cccggccgaggggctgcgccccgcaccccaggttgtccacctcgtcctgc
A0A8C5U1E1_BCL2L1-      cgaagtccatgagatccgtcgagcagccgacgtgaggca---ggcactga
                            * * *                 **   **    **    *   ** 

A0A8C5X4L3_BCL2A1-      ga------agcatcgcatcttccctgcaagagcaaaccgaggaggctctc
A0A8C5TLV4_BCL2-01      gccaggcgggagacgagttctcccgacgct-----accagagggactttg
A0A8C5U1E1_BCL2L1-      gagaggcgggggatgagtttgagctgaggt-----accggcgggcgttca
                        *        *    *  *     *           ***   * *  *   

A0A8C5X4L3_BCL2A1-      aggccactcctggacaccattgacatcacctctgtagctgctgccaagag
A0A8C5TLV4_BCL2-01      cccaaatgtctggccagc-tgcacctcacgccctt---cacggccaggag
A0A8C5U1E1_BCL2L1-      gcgacctcacttcccagc-tccacatcactcccag---cacagcgtatca
                                 **   ** * *  ** ****  *        * **      

A0A8C5X4L3_BCL2A1-      aattttcaacggagtcatggaagaaaagtttgctgatggaaatactaact
A0A8C5TLV4_BCL2-01      ccgcttcgtggcggtggtggaggagctcttccgagatggg---gttaact
A0A8C5U1E1_BCL2L1-      gagctttgagcaggtagtgaacgaactgttccgcgatgga---gtgaact
                            **       **  ** * **    **    *****       ****

A0A8C5X4L3_BCL2A1-      ggggacgaattatgaccatatttacatttggaggtcttctcaccaagaag
A0A8C5TLV4_BCL2-01      ggggcagaattgtggccttctttgagttcggcggtgtgat-------gtg
A0A8C5U1E1_BCL2L1-      ggggccgcatcgtggctttcttctcttttggtggagcctt-------gtg
                        ****  * **  ** *  * **    ** ** **     *         *

A0A8C5X4L3_BCL2A1-      cttcaagagcacggggttcagctgactgcagaggagaag-----------
A0A8C5TLV4_BCL2-01      cgtggagagc----------gtcaaccg----ggagatgtctcccctcgt
A0A8C5U1E1_BCL2L1-      cgtggagagt----------gttgtcaa----ggagatgcgggtattggt
                        * *  ****           *    *      ***** *           

A0A8C5X4L3_BCL2A1-      -gaggagatctcttatttcatcacagagtacatcataaacaacaaagctg
A0A8C5TLV4_BCL2-01      agacaacatcgccgcctggatgaccgagtacctgaaccggcacctgcaca
A0A8C5U1E1_BCL2L1-      gaaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatc
                          *    ***      *  ** **   **** * *      **       

A0A8C5X4L3_BCL2A1-      aatggattgatgcgaacggtggctgggaaaac-------ggcttcctaac
A0A8C5TLV4_BCL2-01      actggatccaggacaatggaggctgggatgcctttgtggagttgtatggc
A0A8C5U1E1_BCL2L1-      cctggatccaggagaatggcggatgggagcgctttgtggacctctatggg
                          *****  * *  ** ** ** *****   *          *   *   

A0A8C5X4L3_BCL2A1-      aaagtt---------------------tgaaagaagatcactactgtctt
A0A8C5TLV4_BCL2-01      aacagt-------------------------atgaggcctttgttcgatt
A0A8C5U1E1_BCL2L1-      aacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatg
                        **   *                         *  **  *         * 

A0A8C5X4L3_BCL2A1-      tctccaaaattacagccctgtttatagctgttgtctccttgttcagagag
A0A8C5TLV4_BCL2-01      tctcctggatctctctgaagac--tatcctgagtctggttctggtgggag
A0A8C5U1E1_BCL2L1-      gctcctga----caggggcgacggtggccggag--tgcttctgctgggat
                         ****       *      *    *  *    *  *  ** *   * ** 

A0A8C5X4L3_BCL2A1-      t-----------------------------actactga
A0A8C5TLV4_BCL2-01      cttgcatcactcttggcgcatatcttggacataagtag
A0A8C5U1E1_BCL2L1-      c----------cctg--------ctgagccgcaagtga
                                                         * *  

© 1998-2023Legal notice