Dataset for CDS BCL-2-like of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------

A0A2K5TMD1_BCL2A1-      -------------------------------------------------a
A0A2K5TMD1_BCL2A1-      -------------------------------------------------a
A0A2K5UDI5_BCL2-01      -------------------------------------------------a
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      ttcccagaaaggatacagctggagtcaatttagtgatgtggaagagaaca
I7GKS6_BCL2L1-01        -----------------------------------atgtggaagagaaca
A0A2K5VPG2_BCL2L1-      -----------------------------------atgtggaagagaaca
A0A2K5V0Q3_BCL2L2-      -------------------------------------------------a
A0A2K5V0Q3_BCL2L2-      -------------------------------------------------a
A0A2K5TKG9_BCL2L10      -------------------------------------------------a
A0A2K5W0W9_MCL1-01      -------------------------------------------------a
A0A2K5W0W9_MCL1-03      -------------------------------------------------a
I7G687_MCL1-01          -------------------------------------------------a

A0A2K5TMD1_BCL2A1-      tgacagactgtg---------aatttgg----------------------
A0A2K5TMD1_BCL2A1-      tgacagactgtg---------aatttgg----------------------
A0A2K5UDI5_BCL2-01      tggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaag
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      ggactgaggccccagaa----gggactg-aatcgg---------------
I7GKS6_BCL2L1-01        ggactgaggccccagaa----gggactg-aatcgg---------------
A0A2K5VPG2_BCL2L1-      ggactgaggccccagaa----gggactg-aatcgg---------------
A0A2K5V0Q3_BCL2L2-      tggc-gacccca---------gcctcgg-ccccag---------------
A0A2K5V0Q3_BCL2L2-      tggc-gacccca---------gcctcgg-ccccag---------------
A0A2K5TKG9_BCL2L10      tggctgaccc-----------gttgcgg-gagcgc---------------
A0A2K5W0W9_MCL1-01      tgtttggcctcaaaaga----aacgcggtaatcgg---------------
A0A2K5W0W9_MCL1-03      tgtttggcctcaaaaga----aacgcggtaatcgg---------------
I7G687_MCL1-01          tgtttggcctcaaaaga----aacgcggtaatcgg---------------

A0A2K5TMD1_BCL2A1-      ----------atatattta--caggctagctcaggactatttgcagtacg
A0A2K5TMD1_BCL2A1-      ----------atatattta--caggctagctcaggactatttgcagtacg
A0A2K5UDI5_BCL2-01      tacatccactataagctgtcgcagaggggctacgagtgggatgcggggga
Q2PFS6_BCL2L1-01        ------------atggagacccccagtgccatcaat-----ggcaaccca
A0A2K5VPG2_BCL2L1-      ----------agatggagacccccagtgccatcaat-----ggcaaccca
I7GKS6_BCL2L1-01        ----------agatggagacccccagtgccatcaat-----ggcaaccca
A0A2K5VPG2_BCL2L1-      ----------agatggagacccccagtgccatcaat-----ggcaaccca
A0A2K5V0Q3_BCL2L2-      ----------a----------cacacgggctctggt-----ggcagactt
A0A2K5V0Q3_BCL2L2-      ----------a----------cacacgggctctggt-----ggcagactt
A0A2K5TKG9_BCL2L10      ----------a----------ccgagcggctcct-------ggccgacta
A0A2K5W0W9_MCL1-01      ----------a----------ctcaacctctactgcgggggggccggct-
A0A2K5W0W9_MCL1-03      ----------a----------ctcaacctctactgcgggggggccggct-
I7G687_MCL1-01          ----------a----------ctcaacctctactgtgggggggccggct-
                                             *       *            **      

A0A2K5TMD1_BCL2A1-      ttctgc----------------agataccacaacctggat----------
A0A2K5TMD1_BCL2A1-      ttctgc----------------agataccacaacctggat----------
A0A2K5UDI5_BCL2-01      tgtggg----------------cgcggcgacccctggggccgcccccgca
Q2PFS6_BCL2L1-01        tcctgg------------------------cacctggtgg----------
A0A2K5VPG2_BCL2L1-      tcctgg------------------------cacctggtgg----------
I7GKS6_BCL2L1-01        tcctgg--------------------------------------------
A0A2K5VPG2_BCL2L1-      tcctgg--------------------------------------------
A0A2K5V0Q3_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtgga----------
A0A2K5V0Q3_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtgga----------
A0A2K5TKG9_BCL2L10      tctggg------------------gtgctgcgcccgggaa----------
A0A2K5W0W9_MCL1-01      --tggg------------------ggccggcagcggcgg-----------
A0A2K5W0W9_MCL1-03      --tggg------------------ggccggcagcggcgg-----------
I7G687_MCL1-01          --tggg------------------ggccggcagcagcgg-----------

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      ccgggcatcttctcctcccagcccgggcacacgccccatcccgccgcgtc
Q2PFS6_BCL2L1-01        -------------------------------------------------a
A0A2K5VPG2_BCL2L1-      -------------------------------------------------a
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -------------------------------------------------g
A0A2K5V0Q3_BCL2L2-      -------------------------------------------------g
A0A2K5TKG9_BCL2L10      -------------------------------------------------c
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------

A0A2K5TMD1_BCL2A1-      -cgggtcc----aagcaaaac-----------------------------
A0A2K5TMD1_BCL2A1-      -cgggtcc----aagcaaaac-----------------------------
A0A2K5UDI5_BCL2-01      ccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccg
Q2PFS6_BCL2L1-01        cagccccgcggtgaatggagc--cactggccacagcagcagtttggatgc
A0A2K5VPG2_BCL2L1-      cagccccgcggtgaatggagc--cactggccacagcagcagtttggatgc
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ctggcccc----ggggagggc--c--------------------------
A0A2K5V0Q3_BCL2L2-      ctggcccc----ggggagggc--c--------------------------
A0A2K5TKG9_BCL2L10      ccggcacccctgagccaaggc--cgtccacgccc----------------
A0A2K5W0W9_MCL1-01      -cgccacccctccgggagggc--ggcttttggctacggagaaggaggcct
A0A2K5W0W9_MCL1-03      -cgccacccctccgggagggc--ggctttt--------------------
I7G687_MCL1-01          -cgccacccctccgggagggc--ggcttttggctacggagaaggaggcct

A0A2K5TMD1_BCL2A1-      ----------------------------gtccagagtgcta---------
A0A2K5TMD1_BCL2A1-      ----------------------------gtccagagtgcta---------
A0A2K5UDI5_BCL2-01      ccgccgccgccgccgccgcggggcctgcgctcagcccggtgccacctgtg
Q2PFS6_BCL2L1-01        cc----------------------gggaggtgatccccatggcagcagta
A0A2K5VPG2_BCL2L1-      cc----------------------gggaggtgatccccatggcagcagta
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ------------------------cagcagctgacccgctg---------
A0A2K5V0Q3_BCL2L2-      ------------------------cagcagctgacccgctg---------
A0A2K5TKG9_BCL2L10      --------------------------gaggccgccgtgctg---------
A0A2K5W0W9_MCL1-01      cggcccggcgagagatagggggaggggaggccggcacggtgattggcgga
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          cggcccggcgagagatagggggaggggaggccggcacggtgattggcgga

A0A2K5TMD1_BCL2A1-      -------caaaaggttgcattctcagtccaaaaagaagtggaaaagaatc
A0A2K5TMD1_BCL2A1-      -------caaaaggttgcattctcagtccaaaaagaagtggaaaagaatc
A0A2K5UDI5_BCL2-01      gtc----cacctgaccctccgccaggccggtgac------------gact
Q2PFS6_BCL2L1-01        aagcaagcgctgagggaggcaggcgac-------------------gagt
A0A2K5VPG2_BCL2L1-      aagcaagcgctgagggaggcaggcgac-------------------gagt
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -------caccaagccatgcgggcagctggagat------------gagt
A0A2K5V0Q3_BCL2L2-      -------caccaagccatgcgggcagctggagat------------gagt
A0A2K5TKG9_BCL2L10      ------------cgctccgcggccgcc-------------------aggt
A0A2K5W0W9_MCL1-01      agcgccggcgcaagccccccggccgccctcacgccagacgcccggagggt
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          agcgccggcgcaagccccccggccgccctcacgccagacgcccggagggt

A0A2K5TMD1_BCL2A1-      tgaagccatgct--------------------------------------
A0A2K5TMD1_BCL2A1-      tgaagccatgct--------------------------------------
A0A2K5UDI5_BCL2-01      tctcccgccgctacc-----------------------------------
Q2PFS6_BCL2L1-01        ttgaactgcggtacc-----------------------------------
A0A2K5VPG2_BCL2L1-      ttgaactgcggtacc-----------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tcgagacccgcttcc-----------------------------------
A0A2K5V0Q3_BCL2L2-      tcgagacccgcttcc-----------------------------------
A0A2K5TKG9_BCL2L10      tacggcagctccacc-----------------------------------
A0A2K5W0W9_MCL1-01      cgcgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          cgcgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagcc

A0A2K5TMD1_BCL2A1-      ------tggacaatgttaatg-----------------------------
A0A2K5TMD1_BCL2A1-      ------tggacaatgttaatg-----------------------------
A0A2K5UDI5_BCL2-01      ------gccgcgacttcgccg--------------agatgtccagccagc
Q2PFS6_BCL2L1-01        ------ggcgggcgttcagtg--------------acctgacatcccagc
A0A2K5VPG2_BCL2L1-      ------ggcgggcgttcagtg--------------acctgacatcccagc
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ------ggcgcaccttctctg--------------atctggcggctcagc
A0A2K5V0Q3_BCL2L2-      ------ggcgcaccttctctg--------------atctggcggctcagc
A0A2K5TKG9_BCL2L10      ------ggtccttcttctccgcctaccgcggctaccccgggaaccgcgtc
A0A2K5W0W9_MCL1-01      ccgcgaggctgcttttctttgcgcccacccgccgcgcggggccgcttgag
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          ccgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgag

A0A2K5TMD1_BCL2A1-      ---ttgcatccatagacactgccagaacactattcaatca----------
A0A2K5TMD1_BCL2A1-      ---ttgcatccatagacactgccagaacactattcaatca----------
A0A2K5UDI5_BCL2-01      tgcacctgacgcccttcaccgcgcggggacgctttgccac----------
Q2PFS6_BCL2L1-01        tccacatcaccccagggacagcatatcagagctttgaaca----------
A0A2K5VPG2_BCL2L1-      tccacatcaccccagggacagcatatcagagctttgaaca----------
I7GKS6_BCL2L1-01        -------caccccagggacagcatatcagagctttgaaca----------
A0A2K5VPG2_BCL2L1-      ----------------gacagcatatcagagctttgaaca----------
A0A2K5V0Q3_BCL2L2-      tgcatgtgaccccaggctcagcacagcaacgcttcaccca----------
A0A2K5V0Q3_BCL2L2-      tgcatgtgaccccaggctcagcacagcaacgcttcaccca----------
A0A2K5TKG9_BCL2L10      gagctggtggcgctgatggcggaggccgt---------------------
A0A2K5W0W9_MCL1-01      gagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagct
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          gagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagct

A0A2K5TMD1_BCL2A1-      -------------------agtgatggaaaaggagtttgaagatggcatc
A0A2K5TMD1_BCL2A1-      -------------------agtgatggaaaaggagtttgaagatggcatc
A0A2K5UDI5_BCL2-01      -------------------ggtggtggaggagctcttcagggacggggtg
Q2PFS6_BCL2L1-01        -------------------agtagtgaatgaactcttccgggatggggta
A0A2K5VPG2_BCL2L1-      -------------------ggtagtgaatgaactcttccgggatggggta
I7GKS6_BCL2L1-01        -------------------ggtagtgaatgaactcttccgggatggggta
A0A2K5VPG2_BCL2L1-      -------------------ggtagtgaatgaactcttccgggatggggta
A0A2K5V0Q3_BCL2L2-      -------------------ggtctccgatgaacttttccaagggggcccc
A0A2K5V0Q3_BCL2L2-      -------------------ggtctccgatgaacttttccaagggggcccc
A0A2K5TKG9_BCL2L10      -------------------gctctccgacagc---------cccggcccc
A0A2K5W0W9_MCL1-01      ggacgggtacgagccggagcctctcgggaagcggccggctgtcctgcccc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          ggacgggtacgagccggagcctctcgggaagcggccggctgtcctgcccc

A0A2K5TMD1_BCL2A1-      attaactggggaag---------aattgtaaccatatttgc---------
A0A2K5TMD1_BCL2A1-      attaactggggaag---------aattgtaaccatatttgc---------
A0A2K5UDI5_BCL2-01      ---aactgggggag---------gatcgtggccttctttga---------
Q2PFS6_BCL2L1-01        ---aactggggtcg---------cattgtggcctttttctc---------
A0A2K5VPG2_BCL2L1-      ---aactggggtcg---------cattgtggcctttttctc---------
I7GKS6_BCL2L1-01        ---aactggggtcg---------cattgtggcctttttctc---------
A0A2K5VPG2_BCL2L1-      ---aactggggtcg---------cattgtggcctttttctc---------
A0A2K5V0Q3_BCL2L2-      ---aactggggccg---------ccttgtagccttctttgt---------
A0A2K5V0Q3_BCL2L2-      ---aactggggccg---------ccttgtagccttctttgt---------
A0A2K5TKG9_BCL2L10      ---acctggggcagggtggtgtcgctggtgaccttcgcggg---------
A0A2K5W0W9_MCL1-01      ---tgctggagttggtcggggaatctggtaatagccccagtacggatggg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          ---tgctggagttggtcggggaatctggtaatagccccagtacggatggg

A0A2K5TMD1_BCL2A1-      -------atttgaag--gtattctcatcaagaaacttctacgac------
A0A2K5TMD1_BCL2A1-      -------atttgaag--gtattctcatcaagaaacttctacgac------
A0A2K5UDI5_BCL2-01      -------gttcggtggggtcatgtgtgtggagagcgtcaaccgg------
Q2PFS6_BCL2L1-01        -------cttcggcggggcactgtgcgtggaaagcgtagacaag------
A0A2K5VPG2_BCL2L1-      -------cttcggcggggcactgtgcgtggaaagcgtagacaag------
I7GKS6_BCL2L1-01        -------cttcggcggggcactgtgcgtggaaagcgtagacaag------
A0A2K5VPG2_BCL2L1-      -------cttcggcggggcactgtgcgtggaaagcgtagacaag------
A0A2K5V0Q3_BCL2L2-      -------ctttggggctgcactgtgtgctgagagtgtcaacaag------
A0A2K5V0Q3_BCL2L2-      -------ctttggggctgcactgtgtgctgagagtgtcaacaag------
A0A2K5TKG9_BCL2L10      -----------gacgctg--ctg---------------------------
A0A2K5W0W9_MCL1-01      tcactaccctcgacgccg--ccgccagcagaggaggaggaggacgagttg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          tcactaccctcgacgccg--ccgccagcagaggaggaggaggacgagttg

A0A2K5TMD1_BCL2A1-      -------------------------------------agcgaattgcccc
A0A2K5TMD1_BCL2A1-      -------------------------------------agcgaattgcccc
A0A2K5UDI5_BCL2-01      -------------------------------------gagatgtcgcccc
Q2PFS6_BCL2L1-01        -------------------------------------gagatgcaggtat
A0A2K5VPG2_BCL2L1-      -------------------------------------gagatgcaggtat
I7GKS6_BCL2L1-01        -------------------------------------gagatgcaggtat
A0A2K5VPG2_BCL2L1-      -------------------------------------gagatgcaggtat
A0A2K5V0Q3_BCL2L2-      -------------------------------------gagatggaaccac
A0A2K5V0Q3_BCL2L2-      -------------------------------------gagatggaaccac
A0A2K5TKG9_BCL2L10      -------------------------------------gagagagagccgc
A0A2K5W0W9_MCL1-01      taccggcagtcgctggagattatctctcggtaccttcgggagcaggccac
A0A2K5W0W9_MCL1-03      --------------------------------------------ggccac
I7G687_MCL1-01          taccggcagtcgctggagattatctctcggtaccttcgggagcaggccac

A0A2K5TMD1_BCL2A1-      ggatgtgga--------tacttataaggagatttcgtattttgttgc---
A0A2K5TMD1_BCL2A1-      ggatgtgga--------tacttataaggagatttcgtattttgttgc---
A0A2K5UDI5_BCL2-01      tggtg----gacaacatcgccctgtggatgactgag----tacc------
Q2PFS6_BCL2L1-01        tggtg------------agtcggatcgcagcttggatggccacttacc--
A0A2K5VPG2_BCL2L1-      tggtg------------agtcggatcgcagcttggatggccacttacc--
I7GKS6_BCL2L1-01        tggtg------------agtcggatcgcagcttggatggccacttacc--
A0A2K5VPG2_BCL2L1-      tggtg------------agtcggatcgcagcttggatggccacttacc--
A0A2K5V0Q3_BCL2L2-      tggtg----ggaca---agtgcaggagtggatggtg-gcctacc------
A0A2K5V0Q3_BCL2L2-      tggtg----ggaca---agtgcaggagtggatggtg-gcctacc------
A0A2K5TKG9_BCL2L10      tggtgac----------agcctggtggaagaagcgg-ggcttccagccgc
A0A2K5W0W9_MCL1-01      cggcgccaaggacacaaagccaatgggcaggtctgg-ggccaccagcag-
A0A2K5W0W9_MCL1-03      cggcgccaaggacacaaagccaatgggcaggtctgg-ggccaccagcag-
I7G687_MCL1-01          cggcgccaaggacacaaagccaatgggcaggtctgg-ggccaccagcag-
                         *  *                     *  *                    

A0A2K5TMD1_BCL2A1-      ---tgagttcataatgaataacaca-------ggagaatggataaggcaa
A0A2K5TMD1_BCL2A1-      ---tgagttcataatgaataacaca-------ggagaatggataaggcaa
A0A2K5UDI5_BCL2-01      ---tgaaccggcacctg---------------cacacctggatccaggat
Q2PFS6_BCL2L1-01        ---tgaatgaccaccta---------------gagccttggatccaggag
A0A2K5VPG2_BCL2L1-      ---tgaatgaccaccta---------------gagccttggatccaggag
I7GKS6_BCL2L1-01        ---tgaatgaccaccta---------------gagccttggatccaggag
A0A2K5VPG2_BCL2L1-      ---tgaatgaccaccta---------------gagccttggatccaggag
A0A2K5V0Q3_BCL2L2-      ---tggagacgcggctg---------------gctgactggatccacagc
A0A2K5V0Q3_BCL2L2-      ---tggagacgcggctg---------------gctgactggatccacagc
A0A2K5TKG9_BCL2L10      ggctgaaggagcaggag---------------ggcgacgtcgcccgggac
A0A2K5W0W9_MCL1-01      ----gaaggctctggagaccttacgacgggttggggatggcgtgcag---
A0A2K5W0W9_MCL1-03      ----gaaggctctggagaccttacgacgggttggggatggcgtgcag---
I7G687_MCL1-01          ----gaaggctctggagaccttacgacgggttggggatggcgtgcag---

A0A2K5TMD1_BCL2A1-      aacggaggctggggg-----------------------------------
A0A2K5TMD1_BCL2A1-      aacggaggct-ggga-----------------------------------
A0A2K5UDI5_BCL2-01      aacggaggctgggac-----gcctttgtggaact----------------
Q2PFS6_BCL2L1-01        aacggcggctgggac-----acttttgtggaactctat------------
A0A2K5VPG2_BCL2L1-      aacggcggctgggac-----acttttgtggaactctat------------
I7GKS6_BCL2L1-01        aacggcggctgggac-----acttttgtggaactctat------------
A0A2K5VPG2_BCL2L1-      aacggcggctgggac-----acttttgtggaactctat------------
A0A2K5V0Q3_BCL2L2-      agtgggggctgggcg------gagtt-cacagctctatacgggg------
A0A2K5V0Q3_BCL2L2-      agtgggggctgggagctggaagctat-caaagctcgagtcagggagatgg
A0A2K5TKG9_BCL2L10      tgccagcgcctggtg------gccttgctgagctcgc-------------
A0A2K5W0W9_MCL1-01      cgcaaccacgagacg------gccttccaa--------------------
A0A2K5W0W9_MCL1-03      cgcaaccacgagacg------gccttccaaggcatgcttcggaaactgga
I7G687_MCL1-01          cgcaaccacgagacg------gccttccaaggcatgcttcggaaactgga
                                *  *                                      

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ---------------------------------acgggg-----------
A0A2K5V0Q3_BCL2L2-      aggaagaagctgagaagctaaaggagctacagaacgaggta---------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      catcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatg
I7G687_MCL1-01          catcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatg

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      ttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttct
I7G687_MCL1-01          tttttagcgacggcgtaacaaactggggcaggattgtgactctcatttct

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      tttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctg
I7G687_MCL1-01          tttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctg

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      ---------------------------------------------gtacg
Q2PFS6_BCL2L1-01        -----------------------------------------gggaacaat
A0A2K5VPG2_BCL2L1-      -----------------------------------------gggaacaat
I7GKS6_BCL2L1-01        -----------------------------------------gggaacaat
A0A2K5VPG2_BCL2L1-      -----------------------------------------gggaacaat
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -----------gagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K5TKG9_BCL2L10      --------------------------------ggctcgcggggcagcacc
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      catcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaac
I7G687_MCL1-01          catcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaac

A0A2K5TMD1_BCL2A1-      ----------------------------aaatggc-------acaatcac
A0A2K5TMD1_BCL2A1-      ----------------------------aaatggctttgtaaagaagttt
A0A2K5UDI5_BCL2-01      gccccag-------------------catgcggcctctgtttgatttctc
Q2PFS6_BCL2L1-01        gcagcagcc--gagagccgaaagggccaggagcgcttcaaccgctggttc
A0A2K5VPG2_BCL2L1-      gcagcagcc--gagagccgaaagggccaggagcgcttcaaccgctggttc
I7GKS6_BCL2L1-01        gcagcagcc--gagagccgaaagggccaggagcgcttcaaccgctggttc
A0A2K5VPG2_BCL2L1-      gcagcagcc--gagagccgaaagggccaggagcgcttcaaccgctggttc
A0A2K5V0Q3_BCL2L2-      ----------------ccctggaggaggcg-cggcgtctg----------
A0A2K5V0Q3_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K5TKG9_BCL2L10      gcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
A0A2K5W0W9_MCL1-01      ----------------------------ggatgggtttgtggagttcttc
A0A2K5W0W9_MCL1-03      gggactggctagttaaacaaagaggctgggatgggtttgtggagttcttc
I7G687_MCL1-01          gggactggctagttaaacaaagaggctgggatgggtttgtggagttcttc

A0A2K5TMD1_BCL2A1-      ---------------------------------------atgcctat---
A0A2K5TMD1_BCL2A1-      ---------------------------------------gaacctaa---
A0A2K5UDI5_BCL2-01      -------------------------------------------ctggctg
Q2PFS6_BCL2L1-01        -------------------------------------------ctgacgg
A0A2K5VPG2_BCL2L1-      -------------------------------------------ctgacgg
I7GKS6_BCL2L1-01        -------------------------------------------ctgacgg
A0A2K5VPG2_BCL2L1-      -------------------------------------------ctgacgg
A0A2K5V0Q3_BCL2L2-      --------------------------------cgggaggggaactgg---
A0A2K5V0Q3_BCL2L2-      catctatgttggcaatgtggactatggtgcaacagcagaagagctggaag
A0A2K5TKG9_BCL2L10      a-----------------------------------ggagcccctttccg
A0A2K5W0W9_MCL1-01      cat-------------------------------gtagaggacctagaag
A0A2K5W0W9_MCL1-03      cat-------------------------------gtagaggacctagaag
I7G687_MCL1-01          cat-------------------------------gtagaggacctagaag

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgac
A0A2K5TKG9_BCL2L10      ctg-----------------------------------------------
A0A2K5W0W9_MCL1-01      gtg-----------------------------------------------
A0A2K5W0W9_MCL1-03      gtg-----------------------------------------------
I7G687_MCL1-01          gtg-----------------------------------------------

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      aaatttagtggccatcccaaaggatttgcgtatatagagttctcagacaa
A0A2K5TKG9_BCL2L10      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------

A0A2K5TMD1_BCL2A1-      -g-ctagtagagtca-----------------------------------
A0A2K5TMD1_BCL2A1-      -atctggctggatga-----------------------------------
A0A2K5UDI5_BCL2-01      ----tctctgaagac-----------------------------------
Q2PFS6_BCL2L1-01        -gcatgactgtgg-------------------------------------
A0A2K5VPG2_BCL2L1-      -gcatgactgtgg-------------------------------------
I7GKS6_BCL2L1-01        -gcatgactgtgg-------------------------------------
A0A2K5VPG2_BCL2L1-      -gcatgactgtgg-------------------------------------
A0A2K5V0Q3_BCL2L2-      -gcatcagtgaggac-----------------------------------
A0A2K5V0Q3_BCL2L2-      agagtcagtgaggacttccttggccttagatgagtccctatttagaggaa
A0A2K5TKG9_BCL2L10      -gctttttggagaaa-----------------------------------
A0A2K5W0W9_MCL1-01      -gcatc----agaaa-----------------------------------
A0A2K5W0W9_MCL1-03      -gcatc----agaaa-----------------------------------
I7G687_MCL1-01          -gcatc----agaaa-----------------------------------

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      ----------tctg------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ----------agtg------------------------------------
A0A2K5V0Q3_BCL2L2-      ggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A2K5TKG9_BCL2L10      ----------actg------------------------------------
A0A2K5W0W9_MCL1-01      ----------tgtg------------------------------------
A0A2K5W0W9_MCL1-03      ----------tgtg------------------------------------
I7G687_MCL1-01          ----------tgtg------------------------------------

A0A2K5TMD1_BCL2A1-      -gtggcc-------------------------------------------
A0A2K5TMD1_BCL2A1-      -cttttc-------------------------------------------
A0A2K5UDI5_BCL2-01      -ctcagtttggccc------------------------------------
Q2PFS6_BCL2L1-01        -ccggcgtggttct------------------------------------
A0A2K5VPG2_BCL2L1-      -ccggcgtggttct------------------------------------
I7GKS6_BCL2L1-01        -ccggcgtggttct------------------------------------
A0A2K5VPG2_BCL2L1-      -ccggcgtggttct------------------------------------
A0A2K5V0Q3_BCL2L2-      -ctgacggggg---------------------------------------
A0A2K5V0Q3_BCL2L2-      acagaccggggttttccacgagcccgctaccgcgcccggaccaccaacta
A0A2K5TKG9_BCL2L10      -ctgatccaggctttcctggca----------------------------
A0A2K5W0W9_MCL1-01      -ctg--ctggcttttgcaggtg----------------------------
A0A2K5W0W9_MCL1-03      -ctg--ctggcttttgcaggtg----------------------------
I7G687_MCL1-01          -ctg--ctggcttttgcaggtg----------------------------

A0A2K5TMD1_BCL2A1-      ------------------------cacaag---aagaaaatggctttgta
A0A2K5TMD1_BCL2A1-      ------------------------tagaagttacaggaaagatctgtgaa
A0A2K5UDI5_BCL2-01      ------------------------tggtgggagcttgcatcaccctgg--
Q2PFS6_BCL2L1-01        --------------------------------------gctgggctca--
A0A2K5VPG2_BCL2L1-      --------------------------------------gctgggctca--
I7GKS6_BCL2L1-01        --------------------------------------gctgggctca--
A0A2K5VPG2_BCL2L1-      --------------------------------------gctgggctca--
A0A2K5V0Q3_BCL2L2-      ------------------------ccgtggc----actgggggccctg--
A0A2K5V0Q3_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
A0A2K5TKG9_BCL2L10      ------------------------tgcttg--ttagcaacagccttcg--
A0A2K5W0W9_MCL1-01      ------------------------ttgctggagtaggagctggtttgg--
A0A2K5W0W9_MCL1-03      ------------------------ttgctggagtaggagctggtttgg--
I7G687_MCL1-01          ------------------------ttgctggagtaggagctggtttgg--

A0A2K5TMD1_BCL2A1-      a-------------------------------------------------
A0A2K5TMD1_BCL2A1-      atgctatctctcctgaagcaatactgt-----------------------
A0A2K5UDI5_BCL2-01      ---gtgcctatctgggcc------------------------------ac
Q2PFS6_BCL2L1-01        ---ctcttcagtcggaaa--------------------------------
A0A2K5VPG2_BCL2L1-      ---ctcttcagtcggaaa--------------------------------
I7GKS6_BCL2L1-01        ---ctcttcagtcggaaa--------------------------------
A0A2K5VPG2_BCL2L1-      ---ctcttcagtcggaaa--------------------------------
A0A2K5V0Q3_BCL2L2-      ---gtaactgtaggggcc--------------------ttttttgctagc
A0A2K5V0Q3_BCL2L2-      gtcgtgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A2K5TKG9_BCL2L10      --gttatct--ctggacacgattatta-----------------------
A0A2K5W0W9_MCL1-01      --catatctaataagatagccttactg-----------------------
A0A2K5W0W9_MCL1-03      --catatctaataagatag-------------------------------
I7G687_MCL1-01          --catatctaataagatag-------------------------------

A0A2K5TMD1_BCL2A1-      ------
A0A2K5TMD1_BCL2A1-      ---tga
A0A2K5UDI5_BCL2-01      aagtga
Q2PFS6_BCL2L1-01        ---tga
A0A2K5VPG2_BCL2L1-      ---tga
I7GKS6_BCL2L1-01        ---tga
A0A2K5VPG2_BCL2L1-      ---tga
A0A2K5V0Q3_BCL2L2-      aagtga
A0A2K5V0Q3_BCL2L2-      ---taa
A0A2K5TKG9_BCL2L10      ---tga
A0A2K5W0W9_MCL1-01      ---taa
A0A2K5W0W9_MCL1-03      ------
I7G687_MCL1-01          ------

© 1998-2020Legal notice