Dataset for CDS BCL-2-like of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

21 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5TMD1_BCL2A1-      ------------------------------------------atgacaga
A0A2K5TMD1_BCL2A1-      ------------------------------------------atgacaga
A0A7N9CNB8_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      ------------------atgtctcagagcaaccgggagctggtggttga
A0A2K5VPG2_BCL2L1-      ------------------atgtctcagagcaaccgggagctggtggttga
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -----atgccccttctgattctctctccatatattcatgccagtgtttca
A0A2K5V0Q3_BCL2L2-      -----atgccccttctgattctctctccatatattcatgccagtgtttca
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -----atgccccttctgattctctctccatatattcatgccagtgtttca
A0A2K5V0Q3_BCL2L2-      -----atgccccttctgattctctctccatatattcatgccagtgtttca
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -----atgccccttctgattctctctccatatattcatgccagtgtttca
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      -------------------------------------------------a
I7G687_MCL1-01          -------------------------------------------------a
A0A2K5W0Y7_MCL1-03      -------------------------------------------------a
A0A2K5W0Y7_MCL1-01      -------------------------------------------------a
A0A2K5W0Y7_MCL1-02      -------------------------------------------------a
                                                                          

A0A2K5TMD1_BCL2A1-      ctgtgaatttggatatatttac----------------------------
A0A2K5TMD1_BCL2A1-      ctgtgaatttggatatatttac----------------------------
A0A7N9CNB8_BCL2-01      gtacatccactataagctgt------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcaattta
A0A2K5VPG2_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcaattta
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tccttgcctcttatagctgccc----------------------------
A0A2K5V0Q3_BCL2L2-      tccttgcctcttatagctgccc----------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tccttgcctcttatagctgccc----------------------------
A0A2K5V0Q3_BCL2L2-      tccttgcctcttatagctgccc----------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tccttgcctcttatagctgccc----------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      ctgtagagtccttgagaggc------------------------------
I7G687_MCL1-01          tgtttggcctcaaaagaaacgc----------------------------
A0A2K5W0Y7_MCL1-03      tgtttggcctcaaaagaaacgc----------------------------
A0A2K5W0Y7_MCL1-01      tgtttggcctcaaaagaaacgc----------------------------
A0A2K5W0Y7_MCL1-02      tgtttggcctcaaaagaaacgc----------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      ------------------aggctagctcaggactatttgcagtacgttct
A0A2K5TMD1_BCL2A1-      ------------------aggctagctcaggactatttgcagtacgttct
A0A7N9CNB8_BCL2-01      cgcagaggggctacgagtgggatgcgggggatgtgggcgcggcgacccct
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      gtgatgtggaagagaacaggactgaggccccagaagggactgaatcggag
A0A2K5VPG2_BCL2L1-      gtgatgtggaagagaacaggactgaggccccagaagggactgaatcggag
I7GKS6_BCL2L1-01        ---atgtggaagagaacaggactgaggccccagaagggactgaatcggag
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ------------------------------------------------gg
A0A2K5V0Q3_BCL2L2-      ------------------------------------------------gg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ------------------------------------------------gg
A0A2K5V0Q3_BCL2L2-      ------------------------------------------------gg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ------------------------------------------------gg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      ------cggacc--------------------atggct----gacccgtt
I7G687_MCL1-01          ggtaatcggactcaacctctactgtgggggggccggcttgggggccggca
A0A2K5W0Y7_MCL1-03      ggtaatcggactcaacctctactgtgggggggccggcttgggggccggca
A0A2K5W0Y7_MCL1-01      ggtaatcggactcaacctctactgtgggggggccggcttgggggccggca
A0A2K5W0Y7_MCL1-02      ggtaatcggactcaacctctactgtgggggggccggcttgggggccggca
                                                                          

A0A2K5TMD1_BCL2A1-      gcagataccacaac------ctggatcgggtccaagcaaaacgtccagag
A0A2K5TMD1_BCL2A1-      gcagataccacaac------ctggatcgggtccaagcaaaacgtccagag
A0A7N9CNB8_BCL2-01      ggggccgcccccgcaccgggcatcttctcctcccagcc------cgggca
Q2PFS6_BCL2L1-01        atggagacccccag----------tgccatcaatggcaacccatcctggc
A0A2K5VPG2_BCL2L1-      atggagacccccag----------tgccatcaatggcaacccatcctggc
A0A2K5VPG2_BCL2L1-      atggagacccccag----------tgccatcaatggcaacccatcctggc
I7GKS6_BCL2L1-01        atggagacccccag----------tgccatcaatggcaacccatcctgg-
A0A2K5V0Q3_BCL2L2-      atggcgaccccagc----------ctcggccccagaca------cacggg
A0A2K5V0Q3_BCL2L2-      atggcgaccccagc----------ctcggccccagaca------cacggg
A0A2K5V0Q3_BCL2L2-      atggcgaccccagc----------ctcggccccagaca------cacggg
A0A2K5V0Q3_BCL2L2-      atggcgaccccagc----------ctcggccccagaca------cacggg
A0A2K5V0Q3_BCL2L2-      atggcgaccccagc----------ctcggccccagaca------cacggg
A0A2K5V0Q3_BCL2L2-      atggcgaccccagc----------ctcggccccagaca------cacggg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      atggcgaccccagc----------ctcggccccagaca------cacggg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      gcgggagcg-cacc---------gagcggctcctggcc--------gact
I7G687_MCL1-01          gcagcggcgccacccctccgggagggcggcttttggctacggagaaggag
A0A2K5W0Y7_MCL1-03      gcggcggcgccaca---ccgggagggcggcttttggctacggagaaggag
A0A2K5W0Y7_MCL1-01      gcggcggcgccaca---ccgggagggcggcttttggctacggagaaggag
A0A2K5W0Y7_MCL1-02      gcggcggcgccaca---ccgggagggcggctttt----------------
                                                                          

A0A2K5TMD1_BCL2A1-      tgct--------------------------------------acaaaagg
A0A2K5TMD1_BCL2A1-      tgct--------------------------------------acaaaagg
A0A7N9CNB8_BCL2-01      cccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgc
Q2PFS6_BCL2L1-01        acctgg-------------------------tggacagccccgcggtgaa
A0A2K5VPG2_BCL2L1-      acctgg-------------------------tggacagccccgcggtgaa
A0A2K5VPG2_BCL2L1-      acctgg-------------------------tggacagccccgcggtgaa
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ctctgg-------------------------tggcagactttgtag----
A0A2K5V0Q3_BCL2L2-      ctctgg-------------------------tggcagactttgtag----
A0A2K5V0Q3_BCL2L2-      ctctgg-------------------------tggcagactttgtag----
A0A2K5V0Q3_BCL2L2-      ctctgg-------------------------tggcagactttgtag----
A0A2K5V0Q3_BCL2L2-      ctctgg-------------------------tggcagactttgtag----
A0A2K5V0Q3_BCL2L2-      ctctgg-------------------------tggcagactttgtag----
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ctctgg-------------------------tggcagactttgtag----
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      atctggggccgtcca-----------------------------------
I7G687_MCL1-01          gcctcggcccggcgagagatagggggaggggaggccggcacggtgattgg
A0A2K5W0Y7_MCL1-03      gcctcggcccggcgagagatagggggaggggaggccggcacggtgattgg
A0A2K5W0Y7_MCL1-01      gcctcggcccggcgagagatagggggaggggaggccggcacggtgattgg
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      ttgcattctcagtccaaaaagaag--------------------------
A0A2K5TMD1_BCL2A1-      ttgcattctcagtccaaaaagaag--------------------------
A0A7N9CNB8_BCL2-01      cgaccccggctgcccccgccgccg-------ccgccgtcgcggggcctgc
Q2PFS6_BCL2L1-01        tggagccactggccacagcagcagtttggatgcccgggaggtgatccc--
A0A2K5VPG2_BCL2L1-      tggagccactggccacagcagcagtttggatgcccgggaggtgatccc--
A0A2K5VPG2_BCL2L1-      tggagccactggccacagcagcagtttggatgcccgggaggtgatccc--
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ----gttataagctgaggcagaagggttatgtctgtggagctggccccgg
A0A2K5V0Q3_BCL2L2-      ----gttataagctgaggcagaagggttatgtctgtggagctggccccgg
A0A2K5V0Q3_BCL2L2-      ----gttataagctgaggcagaagggttatgtctgtggagctggccccgg
A0A2K5V0Q3_BCL2L2-      ----gttataagctgaggcagaagggttatgtctgtggagctggccccgg
A0A2K5V0Q3_BCL2L2-      ----gttataagctgaggcagaagggttatgtctgtggagctggccccgg
A0A2K5V0Q3_BCL2L2-      ----gttataagctgaggcagaagggttatgtctgtggagctggccccgg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ----gttataagctgaggcagaagggttatgtctgtggagctggccccgg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      ---------cgcccgaggccgccgtgctgcgctc----------------
I7G687_MCL1-01          cggaagcgccggcgcaagccccccggccgccctcacgccagacgcccgga
A0A2K5W0Y7_MCL1-03      cggaagcgccggcgcaagcccccgg---gccctcacgccagacgcccgga
A0A2K5W0Y7_MCL1-01      cggaagcgccggcgcaagcccccgg---gccctcacgccagacgcccgga
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      ---------------------------------------------tggaa
A0A2K5TMD1_BCL2A1-      ---------------------------------------------tggaa
A0A7N9CNB8_BCL2-01      gctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtg
Q2PFS6_BCL2L1-01        ------catggcagcag------taaagcaagcgctgagggaggcaggcg
A0A2K5VPG2_BCL2L1-      ------catggcagcag------taaagcaagcgctgagggaggcaggcg
A0A2K5VPG2_BCL2L1-      ------catggcagcag------taaagcaagcgctgagggaggcaggcg
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggag
A0A2K5V0Q3_BCL2L2-      ggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggag
A0A2K5V0Q3_BCL2L2-      ggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggag
A0A2K5V0Q3_BCL2L2-      ggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggag
A0A2K5V0Q3_BCL2L2-      ggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggag
A0A2K5V0Q3_BCL2L2-      ggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggag
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggag
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      ------cgcggccgcc---------------aggttacggcagctccacc
I7G687_MCL1-01          gggtcgcgcggccgccgcccattggcgcggaggtccccgacgtcaccgcg
A0A2K5W0Y7_MCL1-03      gggtcgcgcggccgccgcccattggcgcggaggtccccgacgtcaccgcg
A0A2K5W0Y7_MCL1-01      gggtcgcgcggccgccgcccattggcgcggaggtccccgacgtcaccgcg
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      aagaatctgaag-----------------------------------cca
A0A2K5TMD1_BCL2A1-      aagaatctgaag-----------------------------------cca
A0A7N9CNB8_BCL2-01      acgacttc-------------------tcccgccgctaccgccgcgactt
Q2PFS6_BCL2L1-01        acgagtttgaac-------------------tgcggtaccggcgggcgtt
A0A2K5VPG2_BCL2L1-      acgagtttgaac-------------------tgcggtaccggcgggcgtt
A0A2K5VPG2_BCL2L1-      acgagtttgaac-------------------tgcggtaccggcgggcgtt
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      atgagttcgaga-------------------cccgcttccggcgcacctt
A0A2K5V0Q3_BCL2L2-      atgagttcgaga-------------------cccgcttccggcgcacctt
A0A2K5V0Q3_BCL2L2-      atgagttcgaga-------------------cccgcttccggcgcacctt
A0A2K5V0Q3_BCL2L2-      atgagttcgaga-------------------cccgcttccggcgcacctt
A0A2K5V0Q3_BCL2L2-      atgagttcgaga-------------------cccgcttccggcgcacctt
A0A2K5V0Q3_BCL2L2-      atgagttcgaga-------------------cccgcttccggcgcacctt
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      atgagttcgaga-------------------cccgcttccggcgcacctt
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      ggtccttc----------ttctccgcctaccgcggctaccccgggaaccg
I7G687_MCL1-01          agccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgccgct
A0A2K5W0Y7_MCL1-03      agccccgcgagg------ttctttgcgcccacccgccgcgcggggccgct
A0A2K5W0Y7_MCL1-01      agccccgcgagg------ttctttgcgcccacccgccgcgcggggccgct
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      tgcttggacaatgttaatgttgcat----ccatagacactgccagaacac
A0A2K5TMD1_BCL2A1-      tgcttggacaatgttaatgttgcat----ccatagacactgccagaacac
A0A7N9CNB8_BCL2-01      cgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggac
Q2PFS6_BCL2L1-01        cagtgacctgacatcccagctccacatcaccccagggacagcatatcaga
A0A2K5VPG2_BCL2L1-      cagtgacctgacatcccagctccacatcaccccagggacagcatatcaga
A0A2K5VPG2_BCL2L1-      cagtgacctgacatcccagctccacatcaccccagggacagcatatcaga
I7GKS6_BCL2L1-01        ---------------------------caccccagggacagcatatcaga
A0A2K5V0Q3_BCL2L2-      ctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaac
A0A2K5V0Q3_BCL2L2-      ctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaac
A0A2K5V0Q3_BCL2L2-      ctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaac
A0A2K5V0Q3_BCL2L2-      ctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaac
A0A2K5V0Q3_BCL2L2-      ctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaac
A0A2K5V0Q3_BCL2L2-      ctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaac
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaac
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      cgtcgagctggtggcgctgatggcggaggccgt-----------------
I7G687_MCL1-01          tgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagagg
A0A2K5W0Y7_MCL1-03      tgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagagg
A0A2K5W0Y7_MCL1-01      tgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagagg
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      tattcaatcaagtgatggaaaaggagtttgaagatg----------gcat
A0A2K5TMD1_BCL2A1-      tattcaatcaagtgatggaaaaggagtttgaagatg----------gcat
A0A7N9CNB8_BCL2-01      gctttgccacggtggtggaggagctcttcagggacg-------------g
Q2PFS6_BCL2L1-01        gctttgaacaagtagtgaatgaactcttccgggatg-------------g
A0A2K5VPG2_BCL2L1-      gctttgaaca----------------------------------------
A0A2K5VPG2_BCL2L1-      gctttgaacaggtagtgaatgaactcttccgggatg-------------g
I7GKS6_BCL2L1-01        gctttgaacaggtagtgaatgaactcttccgggatg-------------g
A0A2K5V0Q3_BCL2L2-      gcttcacccaggtctccgatgaacttttccaagggg-------------g
A0A2K5V0Q3_BCL2L2-      gcttcacccaggtctccgatgaacttttccaagggg-------------g
A0A2K5V0Q3_BCL2L2-      gcttcacccaggtctccgatgaacttttccaagggg-------------g
A0A2K5V0Q3_BCL2L2-      gcttcacccaggtctccgatgaacttttccaagggg-------------g
A0A2K5V0Q3_BCL2L2-      gcttcacccaggtctccgatgaacttttccaagggg-------------g
A0A2K5V0Q3_BCL2L2-      gcttcacccaggtctccgatgaacttttccaagggg-------------g
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gcttcacccaggtctccgatgaacttttccaagggg-------------g
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      -----------------------gctctccgacagc---------cccgg
I7G687_MCL1-01          agctggacgggtacgagccggagcctctcgggaagcggccggctgtcctg
A0A2K5W0Y7_MCL1-03      agctggacgggtacgagccggagcctctcgggaagcggccggctgtcctg
A0A2K5W0Y7_MCL1-01      agctggacgggtacgagccggagcctctcgggaagcggccggctgtcctg
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      cattaactggggaagaattgtaaccatatttgcatttg----------aa
A0A2K5TMD1_BCL2A1-      cattaactggggaagaattgtaaccatatttgcatttg----------aa
A0A7N9CNB8_BCL2-01      ggtgaactgggggaggatcgtggccttctttgagttcggt--------gg
Q2PFS6_BCL2L1-01        ggtaaactggggtcgcattgtggcctttttctccttcggc--------gg
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      ggtaaactggggtcgcattgtggcctttttctccttcggc--------gg
I7GKS6_BCL2L1-01        ggtaaactggggtcgcattgtggcctttttctccttcggc--------gg
A0A2K5V0Q3_BCL2L2-      ccccaactggggccgccttgtagccttctttgtctttggg--------gc
A0A2K5V0Q3_BCL2L2-      ccccaactggggccgccttgtagccttctttgtctttggg--------gc
A0A2K5V0Q3_BCL2L2-      ccccaactggggccgccttgtagccttctttgtctttggg--------gc
A0A2K5V0Q3_BCL2L2-      ccccaactggggccgccttgtagccttctttgtctttggg--------gc
A0A2K5V0Q3_BCL2L2-      ccccaactggggccgccttgtagccttctttgtctttggg--------gc
A0A2K5V0Q3_BCL2L2-      ccccaactggggccgccttgtagccttctttgtctttggg--------gc
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ccccaactggggccgccttgtagccttctttgtctttggg--------gc
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      ccccacctggggcagggtggtgtcgctggtgaccttcgcg--------gg
I7G687_MCL1-01          cccctgctggagttggtcggggaatctggtaatagccccagtacggatgg
A0A2K5W0Y7_MCL1-03      cccctgctggagttggtcggggaatctggtaatagccccagtacggatgg
A0A2K5W0Y7_MCL1-01      cccctgctggagttggtcggggaatctggtaatagccccagtacggatgg
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      ggtattctcatcaagaaacttctacgacagcgaattgccccggatgtgga
A0A2K5TMD1_BCL2A1-      ggtattctcatcaagaaacttctacgacagcgaattgccccggatgtgga
A0A7N9CNB8_BCL2-01      ggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg----
Q2PFS6_BCL2L1-01        ggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtg----
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      ggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtg----
I7GKS6_BCL2L1-01        ggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtg----
A0A2K5V0Q3_BCL2L2-      tgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtg----
A0A2K5V0Q3_BCL2L2-      tgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtg----
A0A2K5V0Q3_BCL2L2-      tgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtg----
A0A2K5V0Q3_BCL2L2-      tgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtg----
A0A2K5V0Q3_BCL2L2-      tgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtg----
A0A2K5V0Q3_BCL2L2-      tgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtg----
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtg----
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      gacgctgc-tggagagagagccgctggtgacag------cctggtg----
I7G687_MCL1-01          gtcactac-cctcgacgccgccgccagcagagg------aggagga----
A0A2K5W0Y7_MCL1-03      gtcactac-cctcgacgccgccgccagcagagg------aggagga----
A0A2K5W0Y7_MCL1-01      gtcactac-cctcgacgccgccgccagcagagg------aggagga----
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      tacttataaggagatttcgtattttgttgctg-----------------a
A0A2K5TMD1_BCL2A1-      tacttataaggagatttcgtattttgttgctg-----------------a
A0A7N9CNB8_BCL2-01      -------gacaacatcgccctgtggatgactg-----------------a
Q2PFS6_BCL2L1-01        -------agtcggatcgcagcttggatggcca-----------------c
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      -------agtcggatcgcagcttggatggcca-----------------c
I7GKS6_BCL2L1-01        -------agtcggatcgcagcttggatggcca-----------------c
A0A2K5V0Q3_BCL2L2-      -------ggacaagtgcaggagtggatggtgg-----------------c
A0A2K5V0Q3_BCL2L2-      -------ggacaagtgcaggagtggatggtgg-----------------c
A0A2K5V0Q3_BCL2L2-      -------ggacaagtgcaggagtggatggtgg-----------------c
A0A2K5V0Q3_BCL2L2-      -------ggacaagtgcaggagtggatggtgg-----------------c
A0A2K5V0Q3_BCL2L2-      -------ggacaagtgcaggagtggatggtgg-----------------c
A0A2K5V0Q3_BCL2L2-      -------ggacaagtgcaggagtggatggtgg-----------------c
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -------ggacaagtgcaggagtggatggtgg-----------------c
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      -------gaagaagcggggcttccagccgcgg------------------
I7G687_MCL1-01          -------ggacgagttgtaccggcagtcgctggagattatctctcggtac
A0A2K5W0Y7_MCL1-03      -------ggacgagttgtaccggcagtcgctggagattatctctcggtac
A0A2K5W0Y7_MCL1-01      -------ggacgagttgtaccggcagtcgctggagattatctctcggtac
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      gttcataatgaataacacaggagaatggataaggcaaaacgga----ggc
A0A2K5TMD1_BCL2A1-      gttcataatgaataacacaggagaatggataaggcaaaacgga----ggc
A0A7N9CNB8_BCL2-01      gtacctgaaccggcacctgcacacctggatccaggataacgga----ggc
Q2PFS6_BCL2L1-01        ttacctgaatgaccacctagagccttggatccaggagaacggc----ggc
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      ttacctgaatgaccacctagagccttggatccaggagaacggc----ggc
I7GKS6_BCL2L1-01        ttacctgaatgaccacctagagccttggatccaggagaacggc----ggc
A0A2K5V0Q3_BCL2L2-      ctacctggagacgcggctggctgactggatccacagcagtggg----ggc
A0A2K5V0Q3_BCL2L2-      ctacctggagacgcggctggctgactggatccacagcagtggg----ggc
A0A2K5V0Q3_BCL2L2-      ctacctggagacgcggctggctgactggatccacagcagtggg----ggc
A0A2K5V0Q3_BCL2L2-      ctacctggagacgcggctggctgactggatccacagcagtggg----ggc
A0A2K5V0Q3_BCL2L2-      ctacctggagacgcggctggctgactggatccacagcagtggg----ggc
A0A2K5V0Q3_BCL2L2-      ctacctggagacgcggctggctgactggatccacagcagtggg----ggc
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ctacctggagacgcggctggctgactggatccacagcagtggg----ggc
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      ctgaaggagcaggagggcgacgtc-----------------------gcc
I7G687_MCL1-01          cttcgggagcaggccaccggcgccaaggacacaaagccaatgggcaggtc
A0A2K5W0Y7_MCL1-03      cttcgggagcaggccaccggcgccaaggacacaaagccaatgggcaggtc
A0A2K5W0Y7_MCL1-01      cttcgggagcaggccaccggcgccaaggacacaaagccaatgggcaggtc
A0A2K5W0Y7_MCL1-02      -----------ggccaccggcgccaaggacacaaagccaatgggcaggtc
                                                                          

A0A2K5TMD1_BCL2A1-      t-g-----------------------------------------------
A0A2K5TMD1_BCL2A1-      tgg-----------------------------------------------
A0A7N9CNB8_BCL2-01      tgg-----------------------------------------------
Q2PFS6_BCL2L1-01        tgg-----------------------------------------------
A0A2K5VPG2_BCL2L1-      --g-----------------------------------------------
A0A2K5VPG2_BCL2L1-      tgg-----------------------------------------------
I7GKS6_BCL2L1-01        tgg-----------------------------------------------
A0A2K5V0Q3_BCL2L2-      tgg------------------gcggag-----------------------
A0A2K5V0Q3_BCL2L2-      tggttatcccagatcactgaagctgagatggctgatgaagtaatttgcag
A0A2K5V0Q3_BCL2L2-      tg------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tggttatcccagatcactgaagctgagatggctgatgaagtaatttgcag
A0A2K5V0Q3_BCL2L2-      tggttatcccagatcactgaagctgagatggctgatgaagtaatttgcag
A0A2K5V0Q3_BCL2L2-      tggttatcccagatcactgaagctgagatggctgatgaagtaatttgcag
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tggttatcccagatcactgaagctgagatggctgatgaagtaatttgcag
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      cgg-----------------------------------------------
I7G687_MCL1-01          tgg-----------------------------------------------
A0A2K5W0Y7_MCL1-03      tgg-----------------------------------------------
A0A2K5W0Y7_MCL1-01      tgg-----------------------------------------------
A0A2K5W0Y7_MCL1-02      tgg-----------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ----------------------------------ttcacagctct-----
A0A2K5V0Q3_BCL2L2-      tgaaattttaagcgactgtgactctgctccaagttccccagatctc----
A0A2K5V0Q3_BCL2L2-      ------------------------------------------------gg
A0A2K5V0Q3_BCL2L2-      tgaaattttaagcgactgtgactctgctccaagttccccagatctcgagg
A0A2K5V0Q3_BCL2L2-      tgaaattttaagcgactgtgactctgctccaagttccccagatctcgagg
A0A2K5V0Q3_BCL2L2-      tgaaattttaagcgactgtgactctgctccaagttccccagatctcgagg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tgaaattttaagcgactgtgactctgctccaagttccccagatctcgagg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -------------------------------------atacggggacggg
A0A2K5V0Q3_BCL2L2-      -----------------------------------gagtttgaagccggg
A0A2K5V0Q3_BCL2L2-      agctggaagctatcaaagctcgagtcagggagatggaggaagaagctgag
A0A2K5V0Q3_BCL2L2-      agctggaagctatcaaagctcgagtcagggagatggaggaagaagctgag
A0A2K5V0Q3_BCL2L2-      agctggaagctatcaaagctcgagtcagggagatggaggaagaagctgag
A0A2K5V0Q3_BCL2L2-      agctggaagctatcaaagctcgagtcagggagatggaggaagaagctgag
A0A2K5V0Q3_BCL2L2-      --------------------------------atggaggaagaagctgag
A0A2K5V0Q3_BCL2L2-      agctggaagctatcaaagctcgagtcagggagatggaggaagaagctgag
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gccctggaggaggcgcggc-------------------------------
A0A2K5V0Q3_BCL2L2-      ca------------------------------------------------
A0A2K5V0Q3_BCL2L2-      aagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtcc
A0A2K5V0Q3_BCL2L2-      aagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtcc
A0A2K5V0Q3_BCL2L2-      aagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtcc
A0A2K5V0Q3_BCL2L2-      aagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtcc
A0A2K5V0Q3_BCL2L2-      aagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtcc
A0A2K5V0Q3_BCL2L2-      aagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtcc
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      -----------------------------------------ggaa-----
A0A2K5TMD1_BCL2A1-      -----------------------------------------ggga-----
A0A7N9CNB8_BCL2-01      ------------------------------gacgcctttgtggaa-----
Q2PFS6_BCL2L1-01        ------------------------------gacacttttgtggaa-----
A0A2K5VPG2_BCL2L1-      ------------------------------gacacttttgtggaa-----
A0A2K5VPG2_BCL2L1-      ------------------------------gacacttttgtggaa-----
I7GKS6_BCL2L1-01        ------------------------------gacacttttgtggaa-----
A0A2K5V0Q3_BCL2L2-      ------------------------------gtctgcgggaggggaactgg
A0A2K5V0Q3_BCL2L2-      ------------------------------gtccgttcgggggca-----
A0A2K5V0Q3_BCL2L2-      acctccaggcaatgctggcccagtgatcatgtccattgaggagaagatgg
A0A2K5V0Q3_BCL2L2-      acctccaggcaatgctggcccagtgatcatgtccattgaggagaagatgg
A0A2K5V0Q3_BCL2L2-      acctccaggcaatgctggcccagtgatcatgtccattgaggagaagatgg
A0A2K5V0Q3_BCL2L2-      acctccaggcaatgctggcccagtgatcatgtccattgaggagaagatgg
A0A2K5V0Q3_BCL2L2-      acctccaggcaatgctggcccagtgatcatgtccattgaggagaagatgg
A0A2K5V0Q3_BCL2L2-      acctccaggcaatgctggcccagtgatcatgtccattgaggagaagatgg
A0A2K5V0Q3_BCL2L2-      ----------------------------atgtccattgaggagaagatgg
A0A2K5TKG9_BCL2L10      ------------------------------gactgccagcg---------
I7G687_MCL1-01          ------------------------------ggccaccagcaggaa-----
A0A2K5W0Y7_MCL1-03      ------------------------------ggccaccagcaggaa-----
A0A2K5W0Y7_MCL1-01      ------------------------------ggccaccagcaggaa-----
A0A2K5W0Y7_MCL1-02      ------------------------------ggccaccagcaggaa-----
                                                                          

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A7N9CNB8_BCL2-01      -------------------------------------ctgtac-------
Q2PFS6_BCL2L1-01        -------------------------------------ctctatgggaaca
A0A2K5VPG2_BCL2L1-      -------------------------------------ctctatgggaaca
A0A2K5VPG2_BCL2L1-      -------------------------------------ctctatgggaaca
I7GKS6_BCL2L1-01        -------------------------------------ctctatgggaaca
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      aggctgatgcccgttccatctatgttggcaatgtggactatggtgcaaca
A0A2K5V0Q3_BCL2L2-      aggctgatgcccgttccatctatgttggcaatgtggactatggtgcaaca
A0A2K5V0Q3_BCL2L2-      aggctgatgcccgttccatctatgttggcaatgtggactatggtgcaaca
A0A2K5V0Q3_BCL2L2-      aggctgatgcccgttccatctatgttggcaatgtggactatggtgcaaca
A0A2K5V0Q3_BCL2L2-      aggctgatgcccgttccatctatgttggcaatgtggactatggtgcaaca
A0A2K5V0Q3_BCL2L2-      aggctgatgcccgttccatctatgttggcaatgtggactatggtgcaaca
A0A2K5V0Q3_BCL2L2-      aggctgatgcccgttccatctatgttggcaatgtggactatggtgcaaca
A0A2K5TKG9_BCL2L10      -----------------------------cctggtggccttgctg-agct
I7G687_MCL1-01          --------------------------ggctctggagaccttacgacgggt
A0A2K5W0Y7_MCL1-03      --------------------------ggctctggagaccttacgacgggt
A0A2K5W0Y7_MCL1-01      --------------------------ggctctggagaccttacgacgggt
A0A2K5W0Y7_MCL1-02      --------------------------ggctctggagaccttacgacgggt
                                                                          

A0A2K5TMD1_BCL2A1-      ----aatggctttgtaaagaagtttgaacct-------------------
A0A2K5TMD1_BCL2A1-      ----aatggc-------acaatcacatgcct-------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        atgcagcagccgagagccga------------------------------
A0A2K5VPG2_BCL2L1-      atgcagcagccgagagccga------------------------------
A0A2K5VPG2_BCL2L1-      atgcagcagccgagagccga------------------------------
I7GKS6_BCL2L1-01        atgcagcagccgagagccga------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -------------aggttcac-----------------------------
A0A2K5V0Q3_BCL2L2-      gcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgt
A0A2K5V0Q3_BCL2L2-      gcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgt
A0A2K5V0Q3_BCL2L2-      gcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgt
A0A2K5V0Q3_BCL2L2-      gcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgt
A0A2K5V0Q3_BCL2L2-      gcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgt
A0A2K5V0Q3_BCL2L2-      gcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgt
A0A2K5V0Q3_BCL2L2-      gcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgt
A0A2K5TKG9_BCL2L10      cgcggctcgcgggcagcac-----cgcgcctggcttc-------------
I7G687_MCL1-01          tggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttc
A0A2K5W0Y7_MCL1-03      tggggatggcgtgcagcgcaaccacgagacggccttccaa----------
A0A2K5W0Y7_MCL1-01      tggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttc
A0A2K5W0Y7_MCL1-02      tggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttc
                                                                          

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ---------ctgtcacgaaacgagtgtcactccttcgaatctcgc-----
A0A2K5V0Q3_BCL2L2-      taccatactctgtgacaaatttagtggccatcccaaaggatttgcgtata
A0A2K5V0Q3_BCL2L2-      taccatactctgtgacaaatttagtggccatcccaaaggatttgcgtata
A0A2K5V0Q3_BCL2L2-      taccatactctgtgacaaatttagtggccatcccaaaggatttgcgtata
A0A2K5V0Q3_BCL2L2-      taccatactctgtgacaaatttagtggccatcccaaaggatttgcgtata
A0A2K5V0Q3_BCL2L2-      taccatactctgtgacaaatttagtggccatcccaaaggatttgcgtata
A0A2K5V0Q3_BCL2L2-      taccatactctgtgacaaatttagtggccatcccaaaggatttgcgtata
A0A2K5V0Q3_BCL2L2-      taccatactctgtgacaaatttagtggccatcccaaaggatttgcgtata
A0A2K5TKG9_BCL2L10      --------------------------------------------------
I7G687_MCL1-01          ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K5W0Y7_MCL1-01      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A2K5W0Y7_MCL1-02      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
                                                                          

A0A2K5TMD1_BCL2A1-      -----------------------------aaatctggctgga--------
A0A2K5TMD1_BCL2A1-      -----------------------------atg-ctagtagag--------
A0A7N9CNB8_BCL2-01      -----------------------------ggccccagcatgcggcctctg
Q2PFS6_BCL2L1-01        ---------------a-------------agggccag-gagcgct-----
A0A2K5VPG2_BCL2L1-      ---------------a-------------agggccag-gagcgct-----
A0A2K5VPG2_BCL2L1-      ---------------a-------------agggccag-gagcgct-----
I7GKS6_BCL2L1-01        ---------------a-------------agggccag-gagcgct-----
A0A2K5V0Q3_BCL2L2-      ------------------------------gcatcagtgagga-------
A0A2K5V0Q3_BCL2L2-      ------------------------------gagccaatcagca-------
A0A2K5V0Q3_BCL2L2-      tagagttctcagacaa-------------agagtcagtgaggacttcctt
A0A2K5V0Q3_BCL2L2-      tagagttctcagacaa-------------agagtcagtgaggacttcctt
A0A2K5V0Q3_BCL2L2-      tagagttctcagacaa-------------agagtcagtgaggacttcctt
A0A2K5V0Q3_BCL2L2-      tagagttctcagacaa-------------agagtcagtgaggacttcctt
A0A2K5V0Q3_BCL2L2-      tagagttctcagacaa-------------agagtcagtgaggacttcctt
A0A2K5V0Q3_BCL2L2-      tagagttctcagacaa-------------agagtcagtgaggacttcctt
A0A2K5V0Q3_BCL2L2-      tagagttctcagacaa-------------agagtcagtgaggacttcctt
A0A2K5TKG9_BCL2L10      -----------------------------aggctcagggcggatggcttt
I7G687_MCL1-01          atggtccatgtttttagcgacggcgtaacaaactggggcaggattgtgac
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K5W0Y7_MCL1-01      atggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgac
A0A2K5W0Y7_MCL1-02      atggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgac
                                                                          

A0A2K5TMD1_BCL2A1-      --tgacttttctagaagtt-------------------------------
A0A2K5TMD1_BCL2A1-      --tcagtggcccacaag---------------------------------
A0A7N9CNB8_BCL2-01      tttgatttctcc--------------------------------------
Q2PFS6_BCL2L1-01        ----------tcaaccgct--------------------------ggttc
A0A2K5VPG2_BCL2L1-      ----------tcaaccgct--------------------------ggttc
A0A2K5VPG2_BCL2L1-      ----------tcaaccgct--------------------------ggttc
I7GKS6_BCL2L1-01        ----------tcaaccgct--------------------------ggttc
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --tctgagactgggccact--------------------------gcggt
A0A2K5V0Q3_BCL2L2-      ggccttaga-tgagtccct--------------------------attta
A0A2K5V0Q3_BCL2L2-      ggccttaga-tgagtccct--------------------------attta
A0A2K5V0Q3_BCL2L2-      ggccttaga-tgagtccct--------------------------attta
A0A2K5V0Q3_BCL2L2-      ggccttaga-tgagtccct--------------------------attta
A0A2K5V0Q3_BCL2L2-      ggccttaga-tgagtccct--------------------------attta
A0A2K5V0Q3_BCL2L2-      ggccttaga-tgagtccct--------------------------attta
A0A2K5V0Q3_BCL2L2-      ggccttaga-tgagtccct--------------------------attta
A0A2K5TKG9_BCL2L10      tgtcacttcttcaggagcc-------------------------------
I7G687_MCL1-01          tctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaacc
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K5W0Y7_MCL1-01      tctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaacc
A0A2K5W0Y7_MCL1-02      tctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaacc
                                                                          

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        ctgacgggca----------------------------------------
A0A2K5VPG2_BCL2L1-      ctgacgggca----------------------------------------
A0A2K5VPG2_BCL2L1-      ctgacgggca----------------------------------------
I7GKS6_BCL2L1-01        ctgacgggca----------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gaggcgatcgga--------------------------------------
A0A2K5V0Q3_BCL2L2-      gaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatc
A0A2K5V0Q3_BCL2L2-      gaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatc
A0A2K5V0Q3_BCL2L2-      gaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatc
A0A2K5V0Q3_BCL2L2-      gaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatc
A0A2K5V0Q3_BCL2L2-      gaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatc
A0A2K5V0Q3_BCL2L2-      gaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatc
A0A2K5V0Q3_BCL2L2-      gaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatc
A0A2K5TKG9_BCL2L10      ----------------------------------------cctttccg--
I7G687_MCL1-01          aagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgta
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K5W0Y7_MCL1-01      aagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgta
A0A2K5W0Y7_MCL1-02      aagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgta
                                                                          

A0A2K5TMD1_BCL2A1-      ------------------------acaggaaagatctgtgaaatgctatc
A0A2K5TMD1_BCL2A1-      -------------------------aagaaaatggctttgtaa-------
A0A7N9CNB8_BCL2-01      --------------tggctgtctctgaagactctgctcagtttggccctg
Q2PFS6_BCL2L1-01        --------tgactgtggccggc---------gtggttctgctgggctcac
A0A2K5VPG2_BCL2L1-      --------tgactgtggccggc---------gtggttctgctgggctcac
A0A2K5VPG2_BCL2L1-      --------tgactgtggccggc---------gtggttctgctgggctcac
I7GKS6_BCL2L1-01        --------tgactgtggccggc---------gtggttctgctgggctcac
A0A2K5V0Q3_BCL2L2-      --cagtgctgacgggg---------------gccgtggcactgggggccc
A0A2K5V0Q3_BCL2L2-      --------agattggtcctttcca-------gtcgcctagctagggcca-
A0A2K5V0Q3_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgcgcccggaccac
A0A2K5V0Q3_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgcgcccggaccac
A0A2K5V0Q3_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgcgcccggaccac
A0A2K5V0Q3_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgcgcccggaccac
A0A2K5V0Q3_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgcgcccggaccac
A0A2K5V0Q3_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgcgcccggaccac
A0A2K5V0Q3_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgcgcccggaccac
A0A2K5TKG9_BCL2L10      --------------ctggctttttggagaaaactgctgatccaggctttc
I7G687_MCL1-01          aggacaaaacgggactggctagttaaacaaagaggctgggatgggtttg-
A0A2K5W0Y7_MCL1-03      --------------------------------------ggatgggtttg-
A0A2K5W0Y7_MCL1-01      aggacaaaacgggactggctagttaaacaaagaggctgggatgggtttg-
A0A2K5W0Y7_MCL1-02      aggacaaaacgggactggctagttaaacaaagaggctgggatgggtttg-
                                                                          

A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A7N9CNB8_BCL2-01      gtggga------------------------gcttgcatcac---------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      t-----------------------------g---gtaactg--taggggc
A0A2K5V0Q3_BCL2L2-      ----------------------------------atcacgg------agc
A0A2K5V0Q3_BCL2L2-      c-----------------------------aactacaacag--ttcccgc
A0A2K5V0Q3_BCL2L2-      c-----------------------------aactacaacag--ttcccgc
A0A2K5V0Q3_BCL2L2-      c-----------------------------aactacaacag--ttcccgc
A0A2K5V0Q3_BCL2L2-      c-----------------------------aactacaacag--ttcccgc
A0A2K5V0Q3_BCL2L2-      c-----------------------------aactacaacag--ttcccgc
A0A2K5V0Q3_BCL2L2-      c-----------------------------aactacaacag--ttcccgc
A0A2K5V0Q3_BCL2L2-      c-----------------------------aactacaacag--ttcccgc
A0A2K5TKG9_BCL2L10      ctggcatgctt-------------------gttagcaacag---------
I7G687_MCL1-01          -tggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgct
A0A2K5W0Y7_MCL1-03      -tggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgct
A0A2K5W0Y7_MCL1-01      -tggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgct
A0A2K5W0Y7_MCL1-02      -tggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgct
                                                                          

A0A2K5TMD1_BCL2A1-      -------tctcctgaagc--------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A7N9CNB8_BCL2-01      -------cctgggtgcctatctgg--------------------------
Q2PFS6_BCL2L1-01        -------tcttca-------------------------------------
A0A2K5VPG2_BCL2L1-      -------tcttca-------------------------------------
A0A2K5VPG2_BCL2L1-      -------tcttca-------------------------------------
I7GKS6_BCL2L1-01        -------tcttca-------------------------------------
A0A2K5V0Q3_BCL2L2-      cttttttgcta--------------gcaag--------------------
A0A2K5V0Q3_BCL2L2-      gtcctatacttc-------------gcgggccc-----------------
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca-
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca-
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca-
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca-
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5TKG9_BCL2L10      -------ccttcggttatctctgga----------------cac------
I7G687_MCL1-01          gctggcttttgcaggtgttgctggagtaggagctggtttggcat------
A0A2K5W0Y7_MCL1-03      gctggcttttgcaggtgttgctggagtaggagctggtttggcat------
A0A2K5W0Y7_MCL1-01      gctggcttttgcaggtgttgctggagtaggagctggtttggcat------
A0A2K5W0Y7_MCL1-02      gctggcttttgcaggtgttgctggagtaggagctggtttggcat------
                                                                          

A0A2K5TMD1_BCL2A1-      -aatactgttga--------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A7N9CNB8_BCL2-01      -gccacaagtga--------------------------------------
Q2PFS6_BCL2L1-01        -gtcggaaatga--------------------------------------
A0A2K5VPG2_BCL2L1-      -gtcggaaatga--------------------------------------
A0A2K5VPG2_BCL2L1-      -gtcggaaatga--------------------------------------
I7GKS6_BCL2L1-01        -gtcggaaatga--------------------------------------
A0A2K5V0Q3_BCL2L2-      ---------tga--------------------------------------
A0A2K5V0Q3_BCL2L2-      -gcccg---tag--------------------------------------
A0A2K5V0Q3_BCL2L2-      -ggtcaggatag--------------------------------------
A0A2K5V0Q3_BCL2L2-      -ggtcaggatag--------------------------------------
A0A2K5V0Q3_BCL2L2-      -ggtcaggatag--------------------------------------
A0A2K5V0Q3_BCL2L2-      gggccgggctagagcgacatcatggt------ttctgtag----------
A0A2K5V0Q3_BCL2L2-      gggccgggctagagcgacatcatggtattccccttactaaaaaaagtgtg
A0A2K5V0Q3_BCL2L2-      gggccgggctagagcgacatcatggtattccccttactaa----------
A0A2K5V0Q3_BCL2L2-      gggccgggctagagcgacatcatggtattccccttactaa----------
A0A2K5TKG9_BCL2L10      -gattattatga--------------------------------------
I7G687_MCL1-01          -atctaataagatag-----------------------------------
A0A2K5W0Y7_MCL1-03      -atctaataagatagccttactgtaa------------------------
A0A2K5W0Y7_MCL1-01      -atctaataagatag-----------------------------------
A0A2K5W0Y7_MCL1-02      -atctaataagatag-----------------------------------
                                                                          

A0A2K5TMD1_BCL2A1-      ------
A0A2K5TMD1_BCL2A1-      ------
A0A7N9CNB8_BCL2-01      ------
Q2PFS6_BCL2L1-01        ------
A0A2K5VPG2_BCL2L1-      ------
A0A2K5VPG2_BCL2L1-      ------
I7GKS6_BCL2L1-01        ------
A0A2K5V0Q3_BCL2L2-      ------
A0A2K5V0Q3_BCL2L2-      ------
A0A2K5V0Q3_BCL2L2-      ------
A0A2K5V0Q3_BCL2L2-      ------
A0A2K5V0Q3_BCL2L2-      ------
A0A2K5V0Q3_BCL2L2-      ------
A0A2K5V0Q3_BCL2L2-      tattag
A0A2K5V0Q3_BCL2L2-      ------
A0A2K5V0Q3_BCL2L2-      ------
A0A2K5TKG9_BCL2L10      ------
I7G687_MCL1-01          ------
A0A2K5W0Y7_MCL1-03      ------
A0A2K5W0Y7_MCL1-01      ------
A0A2K5W0Y7_MCL1-02      ------
                              

© 1998-2022Legal notice