Dataset for CDS Unclassified of organism Canis lupus familiaris

[Download (right click)]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C0TKY6_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Canis lupus familiaris (length=1668 residues).
atgggcacgacgctccccgcttcccggggcggggtgcgcagcagcgccacggcgggcatcgccctgggcacggcgccggg
cgcgcgcggcaggtgcccggcggggcgcgggggcgcgggggggggggcggcgggcatcgccctgggcacggcgccgggcg
ggggtgcgggggccgcgggggcgcgggggggcgcgcgagggggggcggcgggcatcgccctgggcacggcgccgggcgcg
cgcggcaggtgcccgggcgggggcgcggggccgcggggggcgcgcagggcgggggggcccacggcggggggttcggccgc
cgcggccccgctcgcaccgcccgcgtcagcgccggagggcggggccgcggcggggcgaaggcagccggagccgcgccggg
ggccgctcccgcccgctcgccggccaggcctccgccgcccgcgcgcccgctcacccgcgtccccgcttccctccccgccg
cgtcccggcgcgaagatggcaaccgacgggctgcacgagaaccagacgctggcgtcgctgaagagcgaggccgagagcct
caagggcaagctggaggaggagcgggccaagctgcacgacgtggagctgcaccaggtggccgagcgggtggaagccctgg
ggcagtttgtcatgaagaccagaaggaccctcaaaggccatggaaacaaagttctctgcatggactggtgcaaagataag
agaaggatcgtgagctcatcccaggatgggaaggtgatcgtgtgggattccttcactactaacaaggagcacgcggtcac
tatgccctgcacatgggtgatggcctgtgcgtacgccccgtcgggatgtgccattgcatgtggtggcttggataataagt
gttctgtgtatccactgacgtttgacaaaaatgaaaacatggctgccaaaaagaagtctgtcgcgatgcacaccaactac
ttgtcggcctgcagcttcaccaactcagacatgcagatcctgacagcgagcggcgacgggacatgcgccctgtgggacgt
ggagagcggacaactgctgcagagctttcacgggcacggggctgacgtcctgtgcttggacctggccccctcagaaacgg
gcaacaccttcgtatctgggggatgtgacaagaaagccatggtatgggacatgcgctccggccagtgcgtgcaggccttt
gaaacacacgaatctgacatcaacagtgtccggtactacccaagtggagatgcctttgcttcaggatcagatgatgctac
gtgtcgtctctatgacctccgggcagacagagaggttgccatctattccaaagagagtatcatatttggagcatccagtg
tggacttctccctcagtggtcgcctactatttgctggatacaacgattataccatcaatgtctgggatgttcttaagggg
tcccgagtctccatcctgtttggacatgaaaaccgagtcagcactctgcgagtttcccctgatgggactgctttttgttc
aggatcatgggatcataccctaagagatggcttttgtctcttcttcacacccatgctgccatcttcttggaaaagactac
tggtcaaggttcttctgtcatgctttgccacaatgatcttaatctacttctggaaaagattatcatga
>gnl|bcl2dbcds|A0A8C0TKY6_uncBCL2L10-02 Putative BCL2-like 10 gene OS=[Eukaryota] Canis lupus familiaris (length=1188 residues).
atgtgtgatcagacctttctcgttaatgtgtttggctcctgtgacaaatgtttcaaacaacgggctctgagacccgtttt
caagaaatctcaacagctcagctactgttcaacatgtgcagaaatcatggcaaccgacgggctgcacgagaaccagacgc
tggcgtcgctgaagagcgaggccgagagcctcaagggcaagctggaggaggagcgggccaagctgcacgacgtggagctg
caccaggtggccgagcgggtggaagccctggggcagtttgtcatgaagaccagaaggaccctcaaaggccatggaaacaa
agttctctgcatggactggtgcaaagataagagaaggatcgtgagctcatcccaggatgggaaggtgatcgtgtgggatt
ccttcactactaacaaggagcacgcggtcactatgccctgcacatgggtgatggcctgtgcgtacgccccgtcgggatgt
gccattgcatgtggtggcttggataataagtgttctgtgtatccactgacgtttgacaaaaatgaaaacatggctgccaa
aaagaagtctgtcgcgatgcacaccaactacttgtcggcctgcagcttcaccaactcagacatgcagatcctgacagcga
gcggcgacgggacatgcgccctgtgggacgtggagagcggacaactgctgcagagctttcacgggcacggggctgacgtc
ctgtgcttggacctggccccctcagaaacgggcaacaccttcgtatctgggggatgtgacaagaaagccatggtatggga
catgcgctccggccagtgcgtgcaggcctttgaaacacacgaatctgacatcaacagtgtccggtactacccaagtggag
atgcctttgcttcaggatcagatgatgctacgtgtcgtctctatgacctccgggcagacagagaggttgccatctattcc
aaagagagtatcatatttggagcatccagtgtggacttctccctcagtggtcgcctactatttgctggatacaacgatta
taccatcaatgtctgggatgttcttaaggggtcccgagtctccatcctgtttggacatgaaaaccgagtcagcactctgc
gagtttcccctgatgggactgctttttgttcaggatcatgggatcataccctaagagtctgggcttaa
>gnl|bcl2dbcds|A0A8C0TKY6_uncBCL2L10-03 Putative BCL2-like 10 gene OS=[Eukaryota] Canis lupus familiaris (length=1149 residues).
atggggataacagtatccattcagggtgactgttgtgatttattaacgcaaagtgcttggaacagtgcctggcaccagga
cttctacatggcaaccgacgggctgcacgagaaccagacgctggcgtcgctgaagagcgaggccgagagcctcaagggca
agctggaggaggagcgggccaagctgcacgacgtggagctgcaccaggtggccgagcgggtggaagccctggggcagttt
gtcatgaagaccagaaggaccctcaaaggccatggaaacaaagttctctgcatggactggtgcaaagataagagaaggat
cgtgagctcatcccaggatgggaaggtgatcgtgtgggattccttcactactaacaaggagcacgcggtcactatgccct
gcacatgggtgatggcctgtgcgtacgccccgtcgggatgtgccattgcatgtggtggcttggataataagtgttctgtg
tatccactgacgtttgacaaaaatgaaaacatggctgccaaaaagaagtctgtcgcgatgcacaccaactacttgtcggc
ctgcagcttcaccaactcagacatgcagatcctgacagcgagcggcgacgggacatgcgccctgtgggacgtggagagcg
gacaactgctgcagagctttcacgggcacggggctgacgtcctgtgcttggacctggccccctcagaaacgggcaacacc
ttcgtatctgggggatgtgacaagaaagccatggtatgggacatgcgctccggccagtgcgtgcaggcctttgaaacaca
cgaatctgacatcaacagtgtccggtactacccaagtggagatgcctttgcttcaggatcagatgatgctacgtgtcgtc
tctatgacctccgggcagacagagaggttgccatctattccaaagagagtatcatatttggagcatccagtgtggacttc
tccctcagtggtcgcctactatttgctggatacaacgattataccatcaatgtctgggatgttcttaaggggtcccgagt
ctccatcctgtttggacatgaaaaccgagtcagcactctgcgagtttcccctgatgggactgctttttgttcaggatcat
gggatcataccctaagagtctgggcttaa
>gnl|bcl2dbcds|A0A8C0TKY6_uncBCL2L10-04 Putative BCL2-like 10 gene OS=[Eukaryota] Canis lupus familiaris (length=1557 residues).
atgggcacgacgctccccgcttcccggggcggggtgcgcagcagcgccacggcgggcatcgccctgggcacggcgccggg
cgcgcgcggcaggtgcccggcggggcgcgggggcgcgggggggggggcggcgggcatcgccctgggcacggcgccgggcg
ggggtgcgggggccgcgggggcgcgggggggcgcgcgagggggggcggcgggcatcgccctgggcacggcgccgggcgcg
cgcggcaggtgcccgggcgggggcgcggggccgcggggggcgcgcagggcgggggggcccacggcggggggttcggccgc
cgcggccccgctcgcaccgcccgcgtcagcgccggagggcggggccgcggcggggcgaaggcagccggagccgcgccggg
ggccgctcccgcccgctcgccggccaggcctccgccgcccgcgcgcccgctcacccgcgtccccgcttccctccccgccg
cgtcccggcgcgaagatggcaaccgacgggctgcacgagaaccagacgctggcgtcgctgaagagcgaggccgagagcct
caagggcaagctggaggaggagcgggccaagctgcacgacgtggagctgcaccaggtggccgagcgggtggaagccctgg
ggcagtttgtcatgaagaccagaaggaccctcaaaggccatggaaacaaagttctctgcatggactggtgcaaagataag
agaaggatcgtgagctcatcccaggatgggaaggtgatcgtgtgggattccttcactactaacaaggagcacgcggtcac
tatgccctgcacatgggtgatggcctgtgcgtacgccccgtcgggatgtgccattgcatgtggtggcttggataataagt
gttctgtgtatccactgacgtttgacaaaaatgaaaacatggctgccaaaaagaagtctgtcgcgatgcacaccaactac
ttgtcggcctgcagcttcaccaactcagacatgcagatcctgacagcgagcggcgacgggacatgcgccctgtgggacgt
ggagagcggacaactgctgcagagctttcacgggcacggggctgacgtcctgtgcttggacctggccccctcagaaacgg
gcaacaccttcgtatctgggggatgtgacaagaaagccatggtatgggacatgcgctccggccagtgcgtgcaggccttt
gaaacacacgaatctgacatcaacagtgtccggtactacccaagtggagatgcctttgcttcaggatcagatgatgctac
gtgtcgtctctatgacctccgggcagacagagaggttgccatctattccaaagagagtatcatatttggagcatccagtg
tggacttctccctcagtggtcgcctactatttgctggatacaacgattataccatcaatgtctgggatgttcttaagggg
tcccgagtctccatcctgtttggacatgaaaaccgagtcagcactctgcgagtttcccctgatgggactgctttttgttc
aggatcatgggatcataccctaagagtctgggcttaa
>gnl|bcl2dbcds|A0A8C0TKY6_uncBCL2L10-05 Putative BCL2-like 10 gene OS=[Eukaryota] Canis lupus familiaris (length=852 residues).
atggcaaccgacgggctgcacgagaaccagacgctggcgtcgctgaagagcgaggccgagagcctcaagggcaagctgga
ggaggagcgggccaagctgcacgacgtggagctgcaccaggtggccgagcgggtggaagccctggggcagtttgtcatga
agaccagaaggaccctcaaaggccatggaaacaaagttctctgcatggactggtgcaaagataagagaaggatcgtgagc
tcatcccaggatgggaaggtgatcgtgtgggattccttcactactaacaagatcctgacagcgagcggcgacgggacatg
cgccctgtgggacgtggagagcggacaactgctgcagagctttcacgggcacggggctgacgtcctgtgcttggacctgg
ccccctcagaaacgggcaacaccttcgtatctgggggatgtgacaagaaagccatggtatgggacatgcgctccggccag
tgcgtgcaggcctttgaaacacacgaatctgacatcaacagtgtccggtactacccaagtggagatgcctttgcttcagg
atcagatgatgctacgtgtcgtctctatgacctccgggcagacagagaggttgccatctattccaaagagagtatcatat
ttggagcatccagtgtggacttctccctcagtggtcgcctactatttgctggatacaacgattataccatcaatgtctgg
gatgttcttaaggggtcccgagtctccatcctgtttggacatgaaaaccgagtcagcactctgcgagtttcccctgatgg
gactgctttttgttcaggatcatgggatcataccctaagagtctgggcttaa
© 1998-2022Legal notice