Dataset for CDS BCL-2 of organism Ailuropoda melanoleuca

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1LIC9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=705 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgctcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctcgccgccaccgcccccggccgcccccgccgccgccgccgccgcgggccctgcg
ctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactt
cgcggagatgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttca
gggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggag
atgtcgcccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaa
cggaggctgggatgcctttgtggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtctctgaagg
ccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
© 1998-2022Legal notice