Dataset for CDS BAX of Organism Amphilophus citrinellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q0R008_BAX-01      atgtacagcatcatagcatctgttctgtgcagcaggaaccattgcatcag
A0A3Q0S1T8_BAX-01      ----------------------------gaagtgggaactatt-------
                                                   * **  ***** ***       

A0A3Q0R008_BAX-01      agcgctggaaaacctcaggtctgaggatgctgatatgctcacttttcttc
A0A3Q0S1T8_BAX-01      -ttgctaaaggacttcatctatgag-------------------------
                          ***  *  ** ***  * ****                         

A0A3Q0R008_BAX-01      attgcatccaccacatgtatgtgatcacacgcataaacacag-aggaccc
A0A3Q0S1T8_BAX-01      -------------------cgtgttcggagacatggagacagcaatactg
                                           *** **  *  ***  * **** *  **  

A0A3Q0R008_BAX-01      tagtcggcatgtcacctctgaggatctgggaggaaggccagatgaacaac
A0A3Q0S1T8_BAX-01      tagtgacgagg--------gagcagctgggtggaa-cccagctgactgac
                       ****    * *        *** * ***** ****  **** ***   **

A0A3Q0R008_BAX-01      aggatccacaaatcaaagaagtggtggaccagt---tgcgcaagatagcg
A0A3Q0S1T8_BAX-01      --------caaaaccataagaggcttgcacagtgcctgcagcagattgga
                               **** * *  *   * * *  ****   ***   **** *  

A0A3Q0R008_BAX-01      gatgagttaaatcggaatgctgagcttcagggactgatcaaccaggttca
A0A3Q0S1T8_BAX-01      gatgagctggatggaaatgtagagctccaaaggatgatagatgactcttc
                       ****** *  ** * ****  ***** **  *  ****  *  *   *  

A0A3Q0R008_BAX-01      ggggaactgtgctcaggacatcttcatggcggtggcaagaaacatctttg
A0A3Q0S1T8_BAX-01      acttagtcccacaaaagacatttttctgaaagtggccattgagatcttct
                           *      *  * ***** **  **   ***** *   * *****  

A0A3Q0R008_BAX-01      ctgatggca---tcaactggggtcgaattgtggctctcttccatctggcc
A0A3Q0S1T8_BAX-01      cagatggaaaatttaactggggcagggtggttgcactgttctactttgca
                       * ***** *   * ********  *  * ** ** ** *** *  * ** 

A0A3Q0R008_BAX-01      tatagattaatatacaaggctcttaccaccaatcatttagagaacattcg
A0A3Q0S1T8_BAX-01      tgccgactcgtcatcaaagctcttgtaacccaaattcctgatattatcag
                       *   ** *  *   *** ******   *** *   *   ** *  **  *

A0A3Q0R008_BAX-01      aatggtcatcagctgggttcttcaagtcatcagagagcagctccacacct
A0A3Q0S1T8_BAX-01      aaccattatcgtttggaccatggactaccttcgggaacatgtgatcaact
                       **   * ***   ***    *  *   * *  * ** **  *   ** **

A0A3Q0R008_BAX-01      ggctcgtgcagcaagggggctgggagggggtg-attggtagtttttctcg
A0A3Q0S1T8_BAX-01      ggatcagggagcaaggtggctgggagggtattcgctcctactttggcaca
                       ** **  * ******* ***********  *    *  ** ***  * * 

A0A3Q0R008_BAX-01      -----atggaggacagtggccattgtagcatcagtagcattggtggtagc
A0A3Q0S1T8_BAX-01      cccacatggcagacggttggggttttcttggcgggagtcctcaccactgt
                            ****  *** ** *   ** *     * * **   *       * 

A0A3Q0R008_BAX-01      ctttgtttactaccggaaagtacgatga
A0A3Q0S1T8_BAX-01      tcttgt---cattcgcaagatgtga---
                         ****   *   ** **  *  **   

© 1998-2020Legal notice