Dataset for CDS BCL2L2 of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5CWY6_BCL2L2-      ------------------------------------catctttcatcctt
A0A2K5CWY6_BCL2L2-      atgccccttctggttctctgtccatatattcatgccagtctttcatcctt
                                                              ************

A0A2K5CWY6_BCL2L2-      gcctcttatagccgcccggatggcgaccccagcctcggccccagacacac
A0A2K5CWY6_BCL2L2-      gcctcttatagccgcccggatggcgaccccagcctcggccccagacacac
                        **************************************************

A0A2K5CWY6_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
A0A2K5CWY6_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
                        **************************************************

A0A2K5CWY6_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
A0A2K5CWY6_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
                        **************************************************

A0A2K5CWY6_BCL2L2-      agcaatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
A0A2K5CWY6_BCL2L2-      agcaatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
                        **************************************************

A0A2K5CWY6_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaa
A0A2K5CWY6_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaa
                        **************************************************

A0A2K5CWY6_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccctaactgggg
A0A2K5CWY6_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccctaactgggg
                        **************************************************

A0A2K5CWY6_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
A0A2K5CWY6_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
                        **************************************************

A0A2K5CWY6_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
A0A2K5CWY6_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
                        **************************************************

A0A2K5CWY6_BCL2L2-      gcctacctggagacgcggctggccgactggatccacagcagtgggggctg
A0A2K5CWY6_BCL2L2-      gcctacctggagacgcggctggccgactggatccacagcagtgggggctg
                        **************************************************

A0A2K5CWY6_BCL2L2-      ggcggagttcacagctctatacggggacggggccctggaggaggcgcggc
A0A2K5CWY6_BCL2L2-      ggcggagttcacagctctatacggggacggggccctggaggaggcgcggc
                        **************************************************

A0A2K5CWY6_BCL2L2-      gtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggcc
A0A2K5CWY6_BCL2L2-      gtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggcc
                        **************************************************

A0A2K5CWY6_BCL2L2-      gtggcactgggggccctggtaactgtaggggccttttttgctagcaagtg
A0A2K5CWY6_BCL2L2-      gtggcactgggggccctggtaactgtaggggccttttttgctagcaagtg
                        **************************************************

A0A2K5CWY6_BCL2L2-      a
A0A2K5CWY6_BCL2L2-      a
                        *

© 1998-2020Legal notice