Dataset for CDS BCL2L2 of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      ------------------------------------catctttcatcctt
A0A2K5CWY6_BCL2L2-      atgccccttctggttctctgtccatatattcatgccagtctttcatcctt
                                                                          

A0A2K5CWY6_BCL2L2-      -------------------atggcggcggcggcggcggcggcagcagcag
A0A2K5CWY6_BCL2L2-      -------------------atggcgaccccagcctcggccccagacaca-
A0A2K5CWY6_BCL2L2-      gcctcttatagccgcccggatggcgaccccagcctcggccccagacaca-
A0A2K5CWY6_BCL2L2-      gcctcttatagccgcccggatggcgaccccagcctcggccccagacaca-
                                           ****** *  * **  ****  ***   ** 

A0A2K5CWY6_BCL2L2-      cgggggctgcgggcggtc----ggggctccgggccggggcggcggcgcca
A0A2K5CWY6_BCL2L2-      cgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
A0A2K5CWY6_BCL2L2-      cgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
A0A2K5CWY6_BCL2L2-      cgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
                        ****  ***  *** * *      ** *    ** * *** *  * *  *

A0A2K5CWY6_BCL2L2-      tct-tgtg--------cccgggg-----------------ccggtg----
A0A2K5CWY6_BCL2L2-      tgtctgtggagctggccccggggagggcccagcagctgacccgctgcacc
A0A2K5CWY6_BCL2L2-      tgtctgtggagctggccccggggagggcccagcagctgacccgctgcacc
A0A2K5CWY6_BCL2L2-      tgtctgtggagctggccccggggagggcccagcagctgacccgctgcacc
                        * * ****        *******                 *** **    

A0A2K5CWY6_BCL2L2-      ---------gggaggccggggagg-----gggccccg-------------
A0A2K5CWY6_BCL2L2-      aagcaatgcgggcagctggagatgagttcgagacccgcttccggcgcacc
A0A2K5CWY6_BCL2L2-      aagcaatgcgggcagctggagatgagttcgagacccgcttccggcgcacc
A0A2K5CWY6_BCL2L2-      aagcaatgcgggcagctggagatgagttcgagacccgcttccggcgcacc
                                 ***  ** ** ** *     * * ****             

A0A2K5CWY6_BCL2L2-      -----------gggggc------gcaggggactacgggaacggcct----
A0A2K5CWY6_BCL2L2-      ttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaaca
A0A2K5CWY6_BCL2L2-      ttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaaca
A0A2K5CWY6_BCL2L2-      ttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaaca
                                   ** ***      *** * ***  * **  * ***     

A0A2K5CWY6_BCL2L2-      ------------ggagtctgaggaact--------ggagcctga---gga
A0A2K5CWY6_BCL2L2-      acgcttcacccaggtctccgatgaacttttccaagggggccctaactggg
A0A2K5CWY6_BCL2L2-      acgcttcacccaggtctccgatgaacttttccaagggggccctaactggg
A0A2K5CWY6_BCL2L2-      acgcttcacccaggtctccgatgaacttttccaagggggccctaactggg
                                    **  ** ** *****        ** ***  *   ** 

A0A2K5CWY6_BCL2L2-      gctgctgctggagccc----------------------------------
A0A2K5CWY6_BCL2L2-      gccgcc-ttgtagccttctttgtctttggggctgcactgtgtgctgagag
A0A2K5CWY6_BCL2L2-      gccgcc-ttgtagccttctttgtctttggggctgcactgtgtgctgagag
A0A2K5CWY6_BCL2L2-      gccgcc-ttgtagccttctttgtctttggggctgcactgtgtgctgagag
                        ** **   ** ****                                   

A0A2K5CWY6_BCL2L2-      ----------gagccggagcccgagcctgaagaggagccgggattggtcg
A0A2K5CWY6_BCL2L2-      tgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatgg
A0A2K5CWY6_BCL2L2-      tgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatgg
A0A2K5CWY6_BCL2L2-      tgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatgg
                                  ***  *** **   *   * * * * ** **  * * * *

A0A2K5CWY6_BCL2L2-      agggtgacccgg------------------gggacggcgccattgaggac
A0A2K5CWY6_BCL2L2-      tggcctacctggagacgcggctggccgactggatccacagcagtgggggc
A0A2K5CWY6_BCL2L2-      tggcctacctggagacgcggctggccgactggatccacagcagtgggggc
A0A2K5CWY6_BCL2L2-      tggcctacctggagacgcggctggccgactggatccacagcagtgggggc
                         **   *** **                  **  *  *  ** ** ** *

A0A2K5CWY6_BCL2L2-      ccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagc
A0A2K5CWY6_BCL2L2-      tgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagc
A0A2K5CWY6_BCL2L2-      tgggcg------gagttcacagctctatacgggg----------------
A0A2K5CWY6_BCL2L2-      tgggcg------gagttcacagctctatacgggg----------------
                          ** *      *   *** ***** *  * ***                

A0A2K5CWY6_BCL2L2-      tgagaagctaaaagaactacagaacgaggtagagaagcagatgaatatga
A0A2K5CWY6_BCL2L2-      tgagaagctaaaagaactacagaacgaggtagagaagcagatgaatatga
A0A2K5CWY6_BCL2L2-      -----------------------acgggg---------------------
A0A2K5CWY6_BCL2L2-      -----------------------acgggg---------------------
                                               *** **                     

A0A2K5CWY6_BCL2L2-      gtccacctccaggcaatgctggcccagtgatcatgtccattgaggagaag
A0A2K5CWY6_BCL2L2-      gtccacctccaggcaatgctggcccagtgatcatgtccattgaggagaag
A0A2K5CWY6_BCL2L2-      ------------------------------------ccctggaggaggcg
A0A2K5CWY6_BCL2L2-      ------------------------------------ccctggaggaggcg
                                                            ** * ******  *

A0A2K5CWY6_BCL2L2-      atggaggctgatgcccgttccatctatgttggcaatgtggactatggtgc
A0A2K5CWY6_BCL2L2-      atggaggctgatgcccgttccatctatgttggcaatgtggactatggtgc
A0A2K5CWY6_BCL2L2-      -cggcgtctg----------------------------------------
A0A2K5CWY6_BCL2L2-      -cggcgtctg----------------------------------------
                          ** * ***                                        

A0A2K5CWY6_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
A0A2K5CWY6_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
A0A2K5CWY6_BCL2L2-      --cgggaggggaactgg---------------------------------
A0A2K5CWY6_BCL2L2-      --cgggaggggaactgg---------------------------------
                          * * **  ** ****                                 

A0A2K5CWY6_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgca
A0A2K5CWY6_BCL2L2-      gtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgca
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5CWY6_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2K5CWY6_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccttggccttaga
A0A2K5CWY6_BCL2L2-      ---------------------gcatcagtgaggac---------------
A0A2K5CWY6_BCL2L2-      ---------------------gcatcagtgaggac---------------
                                             *  ***********               

A0A2K5CWY6_BCL2L2-      tgagtccctatttagaggaaggcaaatcaa--------------------
A0A2K5CWY6_BCL2L2-      tgagtccctatttagaggaaggcaaatcaaggttgactttaaggctttca
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K5CWY6_BCL2L2-      -------------------ggtgatcccgaaacgaaccaacagaccaggc
A0A2K5CWY6_BCL2L2-      tttattcatctctgactcaggtgatcccgaaacgaaccaacagaccaggc
A0A2K5CWY6_BCL2L2-      -------------------agtg---------------------------
A0A2K5CWY6_BCL2L2-      -------------------agtg---------------------------
                                            ***                           

A0A2K5CWY6_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcacggac
A0A2K5CWY6_BCL2L2-      atcagcacaacagaccggggttttccacgagcccgctaccgcgcacggac
A0A2K5CWY6_BCL2L2-      ----------ctgacagggg------------------------------
A0A2K5CWY6_BCL2L2-      ----------ctgacagggg------------------------------
                                  * *** ****                              

A0A2K5CWY6_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2K5CWY6_BCL2L2-      caccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A2K5CWY6_BCL2L2-      ---------------------------------ccgtggc----actggg
A0A2K5CWY6_BCL2L2-      ---------------------------------ccgtggc----actggg
                                                         * ****     ** *  

A0A2K5CWY6_BCL2L2-      ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
A0A2K5CWY6_BCL2L2-      ggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtat
A0A2K5CWY6_BCL2L2-      ggccctg-----gtaactgtaggggcc--------------------ttt
A0A2K5CWY6_BCL2L2-      ggccctg-----gtaactgtaggggcc--------------------ttt
                        ***** *     *   **  *******                    * *

A0A2K5CWY6_BCL2L2-      tccccttac---taa
A0A2K5CWY6_BCL2L2-      tccccttac---taa
A0A2K5CWY6_BCL2L2-      tttgctagcaagtga
A0A2K5CWY6_BCL2L2-      tttgctagcaagtga
                        *   **  *   * *

© 1998-2021Legal notice