Dataset for CDS BCL-2-like of organism Nothoprocta perdicaria

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6ZVQ3_BCL2A1-      atg----------------------------------------gaaactg
A0A8C6YT47_MCL1-01      atgggggtcacag-------------tggtgacaggcatccttggcagtg
A0A8C6ZF48_BCL2-01      atggctcatccggggagaagaggctacgataaccggga-----gatagtg
A0A8C7ECQ9_BCL2L1-      atg-----tccag-------------cagtaaccggga-----attagtg
                        ***                                           * **

A0A8C6ZVQ3_BCL2A1-      ctgagttttatt-------------------acgtgtattatttaactca
A0A8C6YT47_MCL1-01      ctcgaggg------------------gcagtggatgtatcg------ggg
A0A8C6ZF48_BCL2-01      ctcaagtacatccattacaaactctcgcagaggggatacgactgggcggc
A0A8C7ECQ9_BCL2L1-      attgactttgtttcctacaagctctcgcagaaggggtacagctgg--agt
                         *                                  **            

A0A8C6ZVQ3_BCL2A1-      cgattat---------------------------------------ctgc
A0A8C6YT47_MCL1-01      cgggggc------------agagtgagaccgacattg-ggggaccacagc
A0A8C6ZF48_BCL2-01      cagcggc-----------------------gaccgcgcgccggcctcccc
A0A8C7ECQ9_BCL2L1-      cagctgcaggaggaggatgagaacaggactgactttgcggtagaccccga
                        *                                             *   

A0A8C6ZVQ3_BCL2A1-      agtat-----------------------------------------gtgc
A0A8C6YT47_MCL1-01      agtgctatagggcccaacgccgccgggggcgggtgcaggcttggcggtgc
A0A8C6ZF48_BCL2-01      ggcgctctcccctcctgctgctgctgctgctgctgctgctcc--tgctgc
A0A8C7ECQ9_BCL2L1-      ggtg-----------gacggcgtcctcaacgggagcccgtcc--tggcac
                         *                                               *

A0A8C6ZVQ3_BCL2A1-      ttcaagaatcacatctt-------------------------------gg
A0A8C6YT47_MCL1-01      tataggggccatgcctataaggaccaacacggggggggggagggggcggg
A0A8C6ZF48_BCL2-01      tgctgggactccctctg--------atcacactgggccggtgt-ctcggc
A0A8C7ECQ9_BCL2L1-      cccccgggcagccacat--------agtaaacggagccgctgtgcacagg
                             *        *                                 * 

A0A8C6ZVQ3_BCL2A1-      acc---agcccaaaccagagttgctcacgtcctgcgaaacattgcg----
A0A8C6YT47_MCL1-01      atc--aggcccagctaagctcttctcgggccttctcagcggccccggccg
A0A8C6ZF48_BCL2-01      accccgagccc--cccggctcggctgctgctagtaacgagggcgaggggc
A0A8C7ECQ9_BCL2L1-      agc---agccc--cgaagtccg--------------cgagatcg------
                        * *    ****      *                                

A0A8C6ZVQ3_BCL2A1-      -----tcctcactg-caagatcaaacagagg------aggctctgcgacc
A0A8C6YT47_MCL1-01      gcccggcggcgcgggccttatggagaaggcgctcg--agacgctgcggag
A0A8C6ZF48_BCL2-01      tgcgcccggcgccgccc----------ggcgtccacctggccctgcgcca
A0A8C7ECQ9_BCL2L1-      -----tccacgccg-cc----------gacgtgaggcaggcgctgaaaga
                              *  * * * *           *  *       * * ***     

A0A8C6ZVQ3_BCL2A1-      catcttggataggat--------------------------------tga
A0A8C6YT47_MCL1-01      ggtcggcgacggcgtcatgcgcaagcacgagctcgccttccaaggaatgc
A0A8C6ZF48_BCL2-01      ggccggcgatgagttctcgcgccgctaccagagggacttcgcgcacatgt
A0A8C7ECQ9_BCL2L1-      ggcgggggacgagtttgagctgaggtaccggcgagcgttcagcgacctca
                               **     *                                *  

A0A8C6ZVQ3_BCL2A1-      tattgactctgtagatgttgccaagag------------aattttcaatg
A0A8C6YT47_MCL1-01      tgcggaagctggaaat-----ccagaaggaggaagacctgcagtcagtgt
A0A8C6ZF48_BCL2-01      ccggccagctgcacctgacgcccgtca--cggcgcgcggccgcttcgtgg
A0A8C7ECQ9_BCL2L1-      cctcgcagctccacatcacccccggca--cggcctaccagagcttcgagc
                                **  *  *     *                     *      

A0A8C6ZVQ3_BCL2A1-      gagtcatggaagaaa---attttgctgatggaaataccaactggggacga
A0A8C6YT47_MCL1-01      ctgaggtggctgtccatgttttcagtgatggagtaacaaactggggtaga
A0A8C6ZF48_BCL2-01      ccgtggtggaggagc---tcttccgagatggcgt---caactgggggagg
A0A8C7ECQ9_BCL2L1-      aggtggtgaacgaac---tgttccgcgacggcgt---caactggggccgc
                          *   **   *        **    ** **       ********  * 

A0A8C6ZVQ3_BCL2A1-      atcacgaccatattcacctttggaggacttctcaccaagaagcttcaaga
A0A8C6YT47_MCL1-01      gttgtgacactcatctcatttggtgcctttgttgcaaaa-cacctgaaga
A0A8C6ZF48_BCL2-01      atcgtggccttcttcgagttcggcggc------gtcatg-tgcgtggaga
A0A8C7ECQ9_BCL2L1-      atcgtggctttcttctccttcggcggg------gcgctg-tgcgtggaga
                         *   * *  *  **   ** ** *                 * *  ***

A0A8C6ZVQ3_BCL2A1-      gcac------ggag------ttcagctcactggagaggagaaggagcaga
A0A8C6YT47_MCL1-01      gcataaaccaggagaaatgcatcccttcgttagcagggatc--------a
A0A8C6ZF48_BCL2-01      gcgtcaaccgggag------atgtcgccgctcgtggacagc--------a
A0A8C7ECQ9_BCL2L1-      gcgttgacaaggag------atgcgggtattggtgggacgc--------a
                        **        ****       *        * *                *

A0A8C6ZVQ3_BCL2A1-      tttcttacttcatcacagagt---acatcataaataacaaagctgagtgg
A0A8C6YT47_MCL1-01      tcaca-----gatgctctcatctcatccaaacgag----------agtgg
A0A8C6ZF48_BCL2-01      tcgccgcctggatgaccgagt---acctgaaccggcacctgcagaactgg
A0A8C7ECQ9_BCL2L1-      ttgtagcttggatgaccacgt---acttgaccgaccatctagatccctgg
                        *          **       *   *    *                 ***

A0A8C6ZVQ3_BCL2A1-      atagatgcgaatggtggctgggaaaatggcttcctgtcgaagt-------
A0A8C6YT47_MCL1-01      cttctgagccaaggaggctggga-----gggttttgttgacttctttcaa
A0A8C6ZF48_BCL2-01      atccaggacaacggcggatggga-----tgccttcgtggagtt-------
A0A8C7ECQ9_BCL2L1-      atccaagagaacggcggatggga-----gcggttcgtggacct-------
                         *        * ** ** *****            ** **  *       

A0A8C6ZVQ3_BCL2A1-      ttgaaaggagatcactactatctctctccaaaattac----agccctttt
A0A8C6YT47_MCL1-01      gtagaggacctagaacgaagc----atcagaaatgtcctcg---------
A0A8C6ZF48_BCL2-01      gtacggcaacagta-tgcggcctttgttcgatttctcctggatctctctg
A0A8C7ECQ9_BCL2L1-      ctacgggaatgatgctgctgccgagatgaggaagggccaggagagcttca
                         *                        *         *             

A0A8C6ZVQ3_BCL2A1-      ga---tggcttttt-------tctccctgttcagggagt-----------
A0A8C6YT47_MCL1-01      -----tggcttttg---cggggtttgctggactgggagc-------aagc
A0A8C6ZF48_BCL2-01      aagacta--tcctaagcctggttctggt-----gggagcttgcatcactc
A0A8C7ECQ9_BCL2L1-      acaaatggctcctgaccggggccaccgtggccggggtgcttctg-----c
                             *   *  *              *     *** *            

A0A8C6ZVQ3_BCL2A1-      ------------------actactga
A0A8C6YT47_MCL1-01      ctggcgtaca--tgatccg---gtga
A0A8C6ZF48_BCL2-01      ttggcgcttatttcggacataagtag
A0A8C7ECQ9_BCL2L1-      tgggctccctgctgagccgcaagtga
                                               *  

© 1998-2022Legal notice