Dataset for CDS BOK of Organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F5XSW5_BOK-01      atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgc
A0A5F5XSW5_BOK-02      atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgc
                       **************************************************

A0A5F5XSW5_BOK-01      ctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggcgc
A0A5F5XSW5_BOK-02      ctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggcgc
                       **************************************************

A0A5F5XSW5_BOK-01      tcggccgggagttcgtgcatgcgcgactgctgcgcgccggcctcgcctgg
A0A5F5XSW5_BOK-02      tcggccgggagttcgtgcatgcgcgactgctgcgcgccggcctcgcctgg
                       **************************************************

A0A5F5XSW5_BOK-01      aacgcgcccgaacgcgccgctcccgcccccggaggccgcctggcggaggt
A0A5F5XSW5_BOK-02      aacgcgcccgaacgcgccgctcccgcccccggaggccgcctggcggaggt
                       **************************************************

A0A5F5XSW5_BOK-01      gtgcgcggtgctgctgcgcctgggagatgagctggagctgatccggccca
A0A5F5XSW5_BOK-02      gtgcgcggtgctgctgcgcctgggagatgagctggagctgatccggccca
                       **************************************************

A0A5F5XSW5_BOK-01      gcatctaccgcaacgtggctcgtcagctgaacatctccctgcagtctgag
A0A5F5XSW5_BOK-02      gcatctaccgcaacgtggctcgtcagctgaacatctccctgcagtctgag
                       **************************************************

A0A5F5XSW5_BOK-01      acagtggtgaccgacgccttcctggccgtggcagcacaaatcttctccgc
A0A5F5XSW5_BOK-02      acagtggtgaccgacgccttcctggccgtggcagcacaaatcttctccgc
                       **************************************************

A0A5F5XSW5_BOK-01      aggcatcacgtggggcaaggtggtgtccctgtactca--gtggctgcggg
A0A5F5XSW5_BOK-02      aggta--------ggcctg--ggtaccccctcccccagggcgcccacagg
                       *** *        ***  *  ***  ***    * **  * * *  * **

A0A5F5XSW5_BOK-01      gct------ggccgtag---------------actgtgtgcggcagg---
A0A5F5XSW5_BOK-02      gctggggtgggccggggggcagggccttcagcactggggcctgcaggaag
                       ***      *****  *               **** *  * *****   

A0A5F5XSW5_BOK-01      -------cccagccc----gcca-----tggtc-----------------
A0A5F5XSW5_BOK-02      cggcccccacagccctggagccacctggtggtcacgtgtactttcttgct
                              * ******    ****     *****                 

A0A5F5XSW5_BOK-01      ----------------------------cacgctatcgtcgactgcctc-
A0A5F5XSW5_BOK-02      gcacaaaagagcccagaaccttgactcgaacggtgacgtgcagtgcctcc
                                                    *** *  ***  * ****** 

A0A5F5XSW5_BOK-01      ---------------------------ggggagtttgtgc---------g
A0A5F5XSW5_BOK-02      cccggttgtgaggacggtgggcctgctgggcagctggtgccaggcctcta
                                                  *** ** * ****          

A0A5F5XSW5_BOK-01      caagaccctggc---gccctggctgcggaggc-gcggc----------gg
A0A5F5XSW5_BOK-02      cgaggctctgactgggcatcggctggggtggcagcgacctgaagtcttgt
                       * ** * *** *   **   ***** ** *** *** *          * 

A0A5F5XSW5_BOK-01      atggaccg-atgtcc-----------------------------------
A0A5F5XSW5_BOK-02      ctgggccgcgtgtcccagattgccagtcggtgctggccgttgacttagag
                        *** ***  *****                                   

A0A5F5XSW5_BOK-01      -------------tcaagtgtgtggtc-------------------agca
A0A5F5XSW5_BOK-02      ggggggcagcgtgtcctgcgtgtggcctgtgggcttctcacggcgtggta
                                    **  * ****** *                    * *

A0A5F5XSW5_BOK-01      ccgag-----------------cccggcttcc--gctcacactggctggt
A0A5F5XSW5_BOK-02      ccgggtccccaaggggagtgtccccagcatcccaggtgggactgccaggc
                       *** *                 *** ** ***  * *   **** * ** 

A0A5F5XSW5_BOK-01      -----ggccgca--ctctgcagcttcggccgcttcctg------------
A0A5F5XSW5_BOK-02      tctcgggatgcagcctcttcaggtacggtgtcactctgccggatcgtgtt
                            **  ***  **** *** * ***   *   ***            

A0A5F5XSW5_BOK-01      ----aaggccgcct------------------------------------
A0A5F5XSW5_BOK-02      ggtcaaaggcgccttgcagggcggtcccacgtggagggaagatccatgag
                           ** * *****                                    

A0A5F5XSW5_BOK-01      -----------------------tcttcgtgctgttgccagaga------
A0A5F5XSW5_BOK-02      ggcaggagccccggagcagaggctccctgggcagtctctggggaagagca
                                              **   * ** **  *  * **      

A0A5F5XSW5_BOK-01      ------------------gatga
A0A5F5XSW5_BOK-02      ccacacctgtctcagctggctga
                                         * ***

© 1998-2023Legal notice