Dataset for CDS BOK of Organism Athene cunicularia

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A663LT62_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Athene cunicularia GN=BOK (length=642 residues).
atggaagtactacgccgttcctcagtctttgctgcagaggtgatggaggtttttgacaggtctcccactgacaaggagct
tgtgtcccaagccaaggctctctgcagagactacataaattcgaggctaattcgagcaggtgtcagctggagcaaacctg
agcacaacacaccagtgcctggcggtaaactggctgaggtgtccaccatactgctgcgactgggggatgagctggaatac
attcgccccaacgtctaccggaacattgcccgccaattgaacatctcgctgcactcagagacggtggtgacggatgcctt
cctggcagtagctgcacagattttcactgcaggcataacatggggcaaggtggtgtctctctatgcagtggcagcggggc
tggcagtggactgtgtgcggcacgcgcagccagccatggttcacaccatcgtagactgcctgggagagtttgtccgcaag
accttggtggcatggctgaaaaggagaggaggctgggcagacatcacaaaatgcgtggtgaatactgaccccagcattcg
ctcccactggctcgtggccgctgtttgcagctttggtcacttcctcaaggctatcttcttcgtcctgctgcctgagagat
ga
© 1998-2023Legal notice