Dataset for CDS BCL2L10 of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2PEQ8_BCL2L10      atgcgagaaggggcggggcgccggcaggcccacaaaacaggccggggtcg
A0A8C2PEQ8_BCL2L10      atgcgagaaggggcggggcgccggcaggcccacaaaacaggccggggtcg
A0A8C2PEQ8_BCL2L10      atgcgagaaggggcggggcgccggcaggcccacaaaacaggccggggtcg
                        **************************************************

A0A8C2PEQ8_BCL2L10      gccccccggtagaggcggagccatggtggacccgtttagggagcgcacgg
A0A8C2PEQ8_BCL2L10      gccccccggtagaggcggagccatggtggacccgtttagggagcgcacgg
A0A8C2PEQ8_BCL2L10      gccccccggtagaggcggagccatggtggacccgtttagggagcgcacgg
                        **************************************************

A0A8C2PEQ8_BCL2L10      cccggctgctgatggactacctggagttctgcgcccgggagcccggcact
A0A8C2PEQ8_BCL2L10      cccggctgctgatggactacctggagttctgcgcccgggagcccggcact
A0A8C2PEQ8_BCL2L10      cccggctgctgatggactacctggagttctgcgcccgggagcccggcact
                        **************************************************

A0A8C2PEQ8_BCL2L10      ccagctcctgcgccgtccacgcctgaggctgctgtgctgcgccacgtggc
A0A8C2PEQ8_BCL2L10      ccagctcctgcgccgtccacgcctgaggctgctgtgctgcgccacgtggc
A0A8C2PEQ8_BCL2L10      ccagctcctgcgccgtccacgcctgaggctgctgtgctgcgccacgtggc
                        **************************************************

A0A8C2PEQ8_BCL2L10      cgcccgtgtcctggaagcaaatcgaaacgtcttgcccctataccgccgct
A0A8C2PEQ8_BCL2L10      cgcccgtgtcctggaagcaaatcgaaacgtcttgcccctataccgccgct
A0A8C2PEQ8_BCL2L10      cgcccgtgtcctggaagcaaatcgaaacgtcttgcccctataccgccgct
                        **************************************************

A0A8C2PEQ8_BCL2L10      accgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctgctc
A0A8C2PEQ8_BCL2L10      accgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctgctc
A0A8C2PEQ8_BCL2L10      accgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctgctc
                        **************************************************

A0A8C2PEQ8_BCL2L10      gacgaagaccctggccccagctggggccgcgtggcctcactcgtgacctt
A0A8C2PEQ8_BCL2L10      gacgaagaccctggccccagctggggccgcgtggcctcactcgtgacctt
A0A8C2PEQ8_BCL2L10      gacgaagaccctggccccagctggggccgcgtggcctcactcgtgacctt
                        **************************************************

A0A8C2PEQ8_BCL2L10      cgcggggtctctgctggagaggcagccgcagacgacccgacggcagaaga
A0A8C2PEQ8_BCL2L10      cgcggggtctctgctggagaggcagccgcagacgacccgacggcagaaga
A0A8C2PEQ8_BCL2L10      cgcggggtctctgctggagaggcagccgcagacgacccgacggcagaaga
                        **************************************************

A0A8C2PEQ8_BCL2L10      gagacgacggcagcgttagcagggactgtcggctcctcgtggcccttctc
A0A8C2PEQ8_BCL2L10      gagacgacggcagcgttagcagggactgtcggctcctcgtggcccttctc
A0A8C2PEQ8_BCL2L10      gagacgacggcagcgttagcagggactgtcggctcctcgtggcccttctc
                        **************************************************

A0A8C2PEQ8_BCL2L10      tgcgctcagttctgcgaaaagcaccgcgcctggctgatggcgaacggcgg
A0A8C2PEQ8_BCL2L10      tgcgctcagttctgcgaaaagcaccgcgcctggctgatggcgaacggcgg
A0A8C2PEQ8_BCL2L10      tgcgctcagttctgcgaaaagcaccgcgcctggctgatggcgaacggcgg
                        **************************************************

A0A8C2PEQ8_BCL2L10      ctgggatggattttgtctctccttcagccactcattgcaaccatcttggg
A0A8C2PEQ8_BCL2L10      ctgggatggattttgtctctccttcagccactcattgcaaccatcttggg
A0A8C2PEQ8_BCL2L10      ctgggatggattttgtctctccttcagccactcattgcaaccatcttggg
                        **************************************************

A0A8C2PEQ8_BCL2L10      aaagacatctggtctggtttttcctctcatactggacagcaataatcata
A0A8C2PEQ8_BCL2L10      aaagacatctggtctggtttttcctctcatactggacagcaataatcata
A0A8C2PEQ8_BCL2L10      aaagacatctggtctggtttttcctctcatactggacagcaataatcata
                        **************************************************

A0A8C2PEQ8_BCL2L10      atctacttctggataaaattatcaaatggatttattgtttctgagtcatc
A0A8C2PEQ8_BCL2L10      atctacttctggataaaattatcggctacccag-----------------
A0A8C2PEQ8_BCL2L10      atctacttctggataaaattatc---------------------------
                        ***********************                           

A0A8C2PEQ8_BCL2L10      cttggaggatttggaaaagggtattaaagtcttgacgtgccttgacctgt
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
                                                                          

A0A8C2PEQ8_BCL2L10      ggaaccaagtgacagagaaaagttgttaa
A0A8C2PEQ8_BCL2L10      ------aagtga-----------------
A0A8C2PEQ8_BCL2L10      --------gtga-----------------
                                ****                 

© 1998-2022Legal notice