Dataset for CDS BCL2L10 of organism Capra hircus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C2PEQ8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Capra hircus GN=BCL2L10 (length=639 residues).
atgcgagaaggggcggggcgccggcaggcccacaaaacaggccggggtcggccccccggtagaggcggagccatggtgga
cccgtttagggagcgcacggcccggctgctgatggactacctggagttctgcgcccgggagcccggcactccagctcctg
cgccgtccacgcctgaggctgctgtgctgcgccacgtggccgcccgtgtcctggaagcaaatcgaaacgtcttgccccta
taccgccgctaccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctgctcgacgaagaccctggccccag
ctggggccgcgtggcctcactcgtgaccttcgcggggtctctgctggagaggcagccgcagacgacccgacggcagaaga
gagacgacggcagcgttagcagggactgtcggctcctcgtggcccttctctgcgctcagttctgcgaaaagcaccgcgcc
tggctgatggcgaacggcggctgggatggattttgtctctccttcagccactcattgcaaccatcttgggaaagacatct
ggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatcggctacccagaagtga
>gnl|bcl2dbcds|A0A8C2PEQ8_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Capra hircus GN=BCL2L10 (length=729 residues).
atgcgagaaggggcggggcgccggcaggcccacaaaacaggccggggtcggccccccggtagaggcggagccatggtgga
cccgtttagggagcgcacggcccggctgctgatggactacctggagttctgcgcccgggagcccggcactccagctcctg
cgccgtccacgcctgaggctgctgtgctgcgccacgtggccgcccgtgtcctggaagcaaatcgaaacgtcttgccccta
taccgccgctaccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctgctcgacgaagaccctggccccag
ctggggccgcgtggcctcactcgtgaccttcgcggggtctctgctggagaggcagccgcagacgacccgacggcagaaga
gagacgacggcagcgttagcagggactgtcggctcctcgtggcccttctctgcgctcagttctgcgaaaagcaccgcgcc
tggctgatggcgaacggcggctgggatggattttgtctctccttcagccactcattgcaaccatcttgggaaagacatct
ggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatcaaatggatttattgttt
ctgagtcatccttggaggatttggaaaagggtattaaagtcttgacgtgccttgacctgtggaaccaagtgacagagaaa
agttgttaa
>gnl|bcl2dbcds|A0A8C2PEQ8_BCL2L10-03 BCL2-like 10 gene OS=[Eukaryota] Capra hircus GN=BCL2L10 (length=627 residues).
atgcgagaaggggcggggcgccggcaggcccacaaaacaggccggggtcggccccccggtagaggcggagccatggtgga
cccgtttagggagcgcacggcccggctgctgatggactacctggagttctgcgcccgggagcccggcactccagctcctg
cgccgtccacgcctgaggctgctgtgctgcgccacgtggccgcccgtgtcctggaagcaaatcgaaacgtcttgccccta
taccgccgctaccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctgctcgacgaagaccctggccccag
ctggggccgcgtggcctcactcgtgaccttcgcggggtctctgctggagaggcagccgcagacgacccgacggcagaaga
gagacgacggcagcgttagcagggactgtcggctcctcgtggcccttctctgcgctcagttctgcgaaaagcaccgcgcc
tggctgatggcgaacggcggctgggatggattttgtctctccttcagccactcattgcaaccatcttgggaaagacatct
ggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatcgtga
© 1998-2022Legal notice