Dataset for CDS Unclassified of organism Oncorhynchus tshawytscha

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C8C5D7_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha (length=678 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgccgaggaggaggaaggtgctgctaataatgggtcgatgatttctcctcggccgggtttggcacggcggtgcc
acggggccaataacgccggaccgggcagcgtccctcgtctttccaaatggctctcccaaccggacccgcatgcagctatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagcccgacttcgcagagatgtcacaccagctgta
tctcacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacgtcgcaggtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcaactggattcaggagaacgggggatgggtatgtctctatga
catacagagggactcggtggttctgttcgtaagccagtccatcaaccagaccgtcttcggcctggctgcactgggggccg
caagccttaccatcggagcttaccttacacagacgtga
>gnl|bcl2dbcds|A0A8C8F4M7_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha (length=693 residues).
atgatggcaaacgataatccttataacagtcgctttattgttgaaaaatacatacatcacaaactgttgaagaagggatt
tgtatgggaattttatccagaaaacgattccccaaataatggttttggggagccctctccccctaactcccccgaagttt
ttgcacggaggtcccaaccctacgccgaaggcgtggacactgactctccgctccaaaacaggatcccgcaaccggaccga
catgcccggctccatagggtgctgcgcgaggcgggggacgagattgaaataatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacgcccagtacggcacagagaaggtttactgctgttatagaggagctcttcagcgacggtgtaa
actggggtcggattgtggctttctttgaatttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacattgcccattggatgacagagtacctgaacggacccctgcagaactggatccaggagaatggtgactggga
cgcctttgtggagatctatgggcagcagaggatctctgccttccactcctggccctacctaaagacagtgttcggcctgg
ccgccctgggtgcagccggagtcaccattggagccttgttcatccagaagtga
>gnl|bcl2dbcds|A0A8C8F4M7_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha (length=654 residues).
atgatggcaaacgataatccttataacagtcgctttattgttgaaaaatacatacatcacaaactgttgaagaagggatt
tgtatgggaattttatccagaaaacgattccccaaataatggttttggggagccctctccccctaactcccccgaagttt
ttgcacggaggtcccaaccctacgccgaaggcgtggacactgactctccgctccaaaacaggatcccgcaaccggaccga
catgcccggctccatagggtgctgcgcgaggcgggggacgagattgaaataatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacgcccagtacggcacagagaaggtttactgctgttatagaggagctcttcagcgacggtgtaa
actggggtcggattgtggctttctttgaatttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacattgcccattggatgacagagtacctgaacggacccctgcagaactggatccaggagaatggtgactggct
gctgtacttaccctcaccacctcaggctatgagggcagaggagagtgaagaaatgaaccaggaagagtttgaaaagagaa
gagagccaagctga
>gnl|bcl2dbcds|A0A8C8FMH0_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha (length=525 residues).
atgtcttcctgtagaccatgtatgcgggctgtggaaagaaacccggctatagcagaggacacctccccgcctggtcctcc
tcccagcgactcggctgcagccatgcggcgccaggcccgggacatggaggccaagcaccgggccccttccatgcccggca
cacagcttcctgtgccaatgcgggccggacccctgcgcctgtctgaggagggtgatggaggagctggtgggagatggaca
gatgaactgggggaggtggtctctctgttcaccttcactggtgtgctggtcagagaactacagggagaggacacagaccg
gggctgcagggcactgggcggagaccaagcagactacctaggagaggagaagagtgactggatgctggagaacaaaggct
gggagggcttctgtaagttcttccacacagcaagagaggtgaaccaggactcgtccatgaagactgccctgtttgctgct
gctggcgtgggcatcgcagggttaaccttcctcctggtccgctaa
© 1998-2023Legal notice