Dataset for CDS MCL-1 of organism Dicentrarchus labrax

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8P4G790_MCL1-01      atgaatataattcagacaaatcgggccgcctacagcctaacgaacggaaa
A0A8P4G790_MCL1-02      atgaatataattcagacaaatcgggccgcctacagcctaacgaacggaaa
                        **************************************************

A0A8P4G790_MCL1-01      catgagcgtatttctcactcaaaatggaggcgtcgacggacacatgcact
A0A8P4G790_MCL1-02      catgagcgtatttctcactcaaaatggaggcgtcgacggacacatgcact
                        **************************************************

A0A8P4G790_MCL1-01      acggaccaggagattcatcccctcagatcgcaatgggctcttctctagcc
A0A8P4G790_MCL1-02      acggaccaggagattcatcccctcagatcgcaatgggctcttctctagcc
                        **************************************************

A0A8P4G790_MCL1-01      tctcacaacgggagtgtcggctccagcgacgccccgaaacggccaaagaa
A0A8P4G790_MCL1-02      tctcacaacgggagtgtcggctccagcgacgccccgaaacggccaaagaa
                        **************************************************

A0A8P4G790_MCL1-01      cctgggagtgagtccgactaatgggtatttaacaaaagccattcgcgggg
A0A8P4G790_MCL1-02      cctgggagtgagtccgactaatgggtatttaacaaaagccattcgcgggg
                        **************************************************

A0A8P4G790_MCL1-01      tcagcgacgacgtcgaggacggctctctgccgtgcaccccggagctcctc
A0A8P4G790_MCL1-02      tcagcgacgacgtcgaggacggctctctgccgtgcaccccggagctcctc
                        **************************************************

A0A8P4G790_MCL1-01      tcggacactgaaatcgacgtctccgggtgtccagcgggggacgaagtgtt
A0A8P4G790_MCL1-02      tcggacactgaaatcgacgtctccgggtgtccagcgggggacgaagtgtt
                        **************************************************

A0A8P4G790_MCL1-01      gaacagtgaaacgacgcaactcattgactgtttcctgagagactttactg
A0A8P4G790_MCL1-02      gaacagtgaaacgacgcaactcattgactgtttcctgagagactttactg
                        **************************************************

A0A8P4G790_MCL1-01      gactttctaaatctcggtggaacgaaagcaaagcactagcaacgatgaaa
A0A8P4G790_MCL1-02      gactttctaaatctcggtggaacgaaagcaaagcactagcaacgatgaaa
                        **************************************************

A0A8P4G790_MCL1-01      agagttgtggatggcgttttggagaaacacagatacgcgtacaatggtat
A0A8P4G790_MCL1-02      agagttgtggatggcgttttggagaaacacagatacgcgtacaatggtat
                        **************************************************

A0A8P4G790_MCL1-01      gatcagaaaactgtcattagatgaaagggaggacgatgcaagctttgtcg
A0A8P4G790_MCL1-02      gatcagaaaactgtcattagatgaaagggaggacgatgcaagctttgtcg
                        **************************************************

A0A8P4G790_MCL1-01      gggcggtagcaaagagcctctttgcagatggaaccaccaactggggtcgt
A0A8P4G790_MCL1-02      gggcggtagcaaagagcctctttgcagatggaaccaccaactggggtcgt
                        **************************************************

A0A8P4G790_MCL1-01      gttgccagcctggttgcctttggagcggtggtgtctcagtacctgacgga
A0A8P4G790_MCL1-02      gttgccagcctggttgcctttggagcggtggtgtctcagtacctgacgga
                        **************************************************

A0A8P4G790_MCL1-01      gaagggcaggggcaactgtgtggagctggtgggacaggagatctcctcgt
A0A8P4G790_MCL1-02      gaagggcaggggcaactgtgtggagctggtgggacaggagatctcctcgt
                        **************************************************

A0A8P4G790_MCL1-01      acctgctgacgcaccagcgggactggctggtcaagaacaactcttgggat
A0A8P4G790_MCL1-02      acctgctgacgcaccagcgggactggctggtcaagaacaactcttgggat
                        **************************************************

A0A8P4G790_MCL1-01      ggctttgtcgagttctttcgagtagcagacccggagtccacagtgaggaa
A0A8P4G790_MCL1-02      ggctttgtcgagttctttcgagtagcagacccggagtccacagtgaggaa
                        **************************************************

A0A8P4G790_MCL1-01      cacactcatggcctttgctggatttgccggtatcggggcgacactggccc
A0A8P4G790_MCL1-02      cacactcatggcctttgctggatttgccggtatcggggcgacactggccc
                        **************************************************

A0A8P4G790_MCL1-01      tgttgatcaga----------cggcctaggctgctgt----------ttc
A0A8P4G790_MCL1-02      tgttgatcagatcctccccgttgtctcgggttacaggacaaacaacactc
                        ***********           * *   ** * * *            **

A0A8P4G790_MCL1-01      ctcgaaatttgatgag--actgcagcagcgcctcc---------------
A0A8P4G790_MCL1-02      atcgaggtcttaggaggaaatggagtagagcctctccatggtgatgatcc
                         ****  * * * ***  * ** ** ** *****                

A0A8P4G790_MCL1-01      -------atcacactaagcgctcagctg-----------------catcc
A0A8P4G790_MCL1-02      acagcagacctccctgtgtcctctcctgtggctaatgatgttagccacca
                               * * * **  *  ***  ***                 ** * 

A0A8P4G790_MCL1-01      gccgagt------tgcacagttctttgcaaa------gctggtgcataac
A0A8P4G790_MCL1-02      ccctggttacccctgcacagttcattgtgaagaacaggctgctacacaat
                         **  **      ********** ***  **      **** * ** ** 

A0A8P4G790_MCL1-01      a-----------------------tctgaa------tgcacca-gcacaa
A0A8P4G790_MCL1-02      ggggaattgaggctgaggcaattttctagagcggtttgcaccatacacaa
                                                ***  *      *******  *****

A0A8P4G790_MCL1-01      gctatattgtgaaactggggttaaagagttcaaaattgtgtaccactcta
A0A8P4G790_MCL1-02      g-tgtattggg-------------agtgcagaaaacagactgcactgcag
                        * * ***** *             ** *   ****  *  * *    *  

A0A8P4G790_MCL1-01      tttcctgggttggaaggctacctagaaactggggactttaaacaaataca
A0A8P4G790_MCL1-02      tgtcttggggctgaata-tgcaaagcacccttggtctttga---------
                        * ** ****   ***   * *  ** * *   ** **** *         

A0A8P4G790_MCL1-01      ttga
A0A8P4G790_MCL1-02      ----
                            

© 1998-2023Legal notice