Dataset for CDS BCL2L2 of organism Spermophilus dauricus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9PGU3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Spermophilus dauricus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggccgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcagctcagctgcatgtgaccccgggttcagctcagcaacgcttcacc
caggtctctgacgaacttttccaagggggtcccaactggggtcgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
© 1998-2023Legal notice