Dataset for CDS BAX-like of Organism Jaculus jaculus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C5K2V5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Jaculus jaculus GN=BAK1 (length=636 residues).
atggcatccgggcaaggaccaggccctccgccagaggagtgtgaagacctttctccaccctccccttctgagcagcaggt
cgcccaggacacggaggaggtcttccgaagctacgtgttctacctgcaccagcaggagcaggaggcccagggggcagctg
cccccgttgatcctgagatggacaccttgcccctagagcccaacagcgtcctggggcaggtgggtcggcagctcgccctc
attggagacgacattaaccggcgttatgactccgagttccagagcttgttagaacagctgcagcccacggccgggaacgc
ctatgagctcttcaccaagatcgcctacagcctgtttaagagcggcatcagctggggtcgtgtggtggccctcttgggct
ttggctaccgcctggccctgtacgtctaccagcgtggtttgactggcttcttgggtcaggtgacctgctttttagctgac
gtcatgctgcgtcactacattgcccggtggatcgcgcaaagaggtggctgggtggcggctctgaatttgcatcacaaccc
catccggagcgtgctggcagttctggctgtggttcttttggggcagtttgtggtacaaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A8C5L2U1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Jaculus jaculus GN=BAX (length=579 residues).
atggacgggtccggggagaggctcgggggcggcgggcccaccagctccgagcagatcatgaagacgggggccgttttgct
tcagggtttcatccaggaccgggccgggaggatggctggggagtcacccgagctgaacctggagcaggcaccccaggatg
cgtccaccaagaagttaagcgagtgcctcaagcggatcggagatgagctggacagcaatatggagctgcaaaggatgatt
gcagacgtggacacaaattcaccccgagaggtcttcttccgagtggcagctgaaatgtttgctgatggcaacttcaactg
gggtcgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtacctgagctgatca
gaaccattatgggctggacgctggactttctccgggaacggctgctggtctggatccaagaccagggtggctgggatgga
ctcctctcctactttgggactcccacgtggcagacagtgaccatctttgtggctggagtcctcactgcctcactcactat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A8C5P4H1_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Jaculus jaculus GN=BOK (length=642 residues).
atggaggtgctgcggcgctcttcagtctttgctgcagagatcatggacgcttttgaccgctcgcccacggacaaggagct
ggtggctcaggccaaggcgttaggccgggagtacgtgcacgcgcggcttttgcgagccggcctcgcctggagcgctcccg
agcgcgccgcgccggtcccgggaggacgcctggcggaggtgtgcgctgtgctgctgcgcttgggggatgagttggagcag
attcggcccagcgtgtaccgcaatgtagcccgacagctgcacctctctctgcagtctgagcccgtggtgactgatgcatt
cctggctgtggcaggccacatcttctctgcaggtatcacatggggtaaggttgtgtccctttatgcagtggctgcggggc
tggctgtggactgtgtgcgacaggcccagcctgccatggttcatgccctggttgactgcctgggggaatttgtacgcaag
accctggccacctggctgcggcggcgtggtggatggactgatgtcctcaagtgtgtggtcaacacggaccctggcctccg
ttcccactggctcgttgtcacactctgtagttttggtcgcttcctgaaggctgccttctttgtgctgttaccggagagat
ga
© 1998-2023Legal notice