Dataset for CDS BOK of Organism Kryptolebias marmoratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3A2A0_BOK-01      atggacatgctgcgccgctcttccgtgtttgccgc---------cgaggt
A0A3Q3AGD2_BOK-01      atggacgtgctccggaggtcctctgcgtttgcctcggaggtcctggaggt
                       ****** **** **  * ** ** * ******* *          *****

A0A3Q3A2A0_BOK-01      gtttgaccgctcgcccaccgacaagctgctggtggcccaggccaaggctc
A0A3Q3AGD2_BOK-01      gttcgaccgctcgctgacggagaaggagctggtgtcccagtccaaagctc
                       *** **********  ** ** ***  ******* ***** **** ****

A0A3Q3A2A0_BOK-01      tgtgcagggactacatccactccaagctgcgccgagccgggatcggatgg
A0A3Q3AGD2_BOK-01      tgtgccgggactacatcctgtccaggctcaaccagaacgggctgggatgg
                       ***** ************  **** ***   **    **** * ******

A0A3Q3A2A0_BOK-01      agcaaacccga---gcactcggtgccg------aagggggacctggcggc
A0A3Q3AGD2_BOK-01      tccaaaaccgaagtgaacttctccccgtccaccaacgcagcgctcgctga
                         **** ****   * ***     ***      ** *  *  ** ** * 

A0A3Q3A2A0_BOK-01      ggtgtcctcggccctcacgtggctctgtgatgagttggaggaccttcaac
A0A3Q3AGD2_BOK-01      ggtgtctctggtgctcatttgtctcggcgacgagctggaggccatgcagc
                       ******   **  ****  ** *** * ** *** ****** * * ** *

A0A3Q3A2A0_BOK-01      ccaacttgtaccgtaatgtatctcgacagctgaacatcaacgcaggatca
A0A3Q3AGD2_BOK-01      ccggtctgtacaggaacgtggcgcggcagctcaacatctctgttgccatg
                       **    ***** * ** **  * ** ***** ******   *  *     

A0A3Q3A2A0_BOK-01      gagaacatggtgtccgacgccttcctggctgtcgccgctgacattttctc
A0A3Q3AGD2_BOK-01      gagaacatggtctcagatgccttcctcggcgtggcaacagagatcttctc
                       *********** ** ** ******** *  ** **  * ** ** *****

A0A3Q3A2A0_BOK-01      cacaggtgtgacgtgggggaaggtggtttccttgtacaccgtggcagggg
A0A3Q3AGD2_BOK-01      ggcaggtataacatggggtaaggtggtctccatgtacgccgtggcaggag
                         ***** * ** ***** ******** *** ***** ********** *

A0A3Q3A2A0_BOK-01      ccttggcggtggactgtgtgcgctgcggtcatccagaaattatccacgtc
A0A3Q3AGD2_BOK-01      ctctggcggtggactgcgtcagatacggccacccaacgacggctcacgtc
                       *  ************* **  * * *** ** ***   *     ******

A0A3Q3A2A0_BOK-01      atcacggactgcatggcaacatttgtcagcaagagtctgaccgcctggtt
A0A3Q3AGD2_BOK-01      ctcgtggacagcctgggacagttcgtgcgcaaatttctcgttccctggct
                        **  **** ** *** *   ** **  ****   ***     ***** *

A0A3Q3A2A0_BOK-01      aaaaaagagaggaggctggggggatctggtgaaatgcgtgttgaatactg
A0A3Q3AGD2_BOK-01      gaagaggcggggaggatggacggagatcacgaagtgcgtcgtgaagatgg
                        ** * * * ***** ***  ***  *   *** *****  **** *  *

A0A3Q3A2A0_BOK-01      atcacagcttccactcccactggctggtgtctactgtctgtgccttcgga
A0A3Q3AGD2_BOK-01      acctctccccgcagcgccactggttgtcctccgtcgtcgagtccctcaag
                       * * *  *   **   ******* **   **    ***    ** **   

A0A3Q3A2A0_BOK-01      ctctacctgaaggctgtggtgttgtacctcctcagggagaagtga
A0A3Q3AGD2_BOK-01      tatttcctcaccacggtgtacgtctacgtcatgaaggagcagtga
                          * *** *   * ***    * *** ** * * **** *****

© 1998-2023Legal notice