Dataset for CDS BAX of Organism Accipiter nisus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8B9NH28_BAX-01 BCL2-associated X gene OS=[Eukaryota] Accipiter nisus GN=BAX (length=534 residues).
atgcggacgggggcgatcctgctgcgggggtttatccgggaccgcgtggagcggtgcggggacgcgcaggcagtggccct
gagccaggctgagctgggggggccgcagcccagcagccctgacacgaagcacctgagcgagtgcttgcgccgcatcgggg
acgagctggacagcaacacggagctgcagaggatgattgaacaggtggggtgccatgcccccaaggagctcttcttccgc
gtggctgcagagatgtttgccgacggcaccttcaactggggccgtgttgttgccctcttctacttcgcctgcaagctggt
gctgaaggcgctttgcaccaaggtccctgagctggtccggaccatcctgggctggaccatggagtacatgcgggatcatg
tcctagcctggatccaggcccagggaggatgggaagggcttctctcctactttggcactccgacctggcagaccatcacc
atcttcgccgctggtgtcctcacggcctcgctcaccatctggaagatgtcatag
© 1998-2023Legal notice