Dataset for CDS BAX-like of Organism Dromaius novaehollandiae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C4K7A5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Dromaius novaehollandiae GN=BAK1 (length=654 residues).
atggcctcagggaacaacggtgacccaccaggcccccgggtacgctgggacggtgatgggcgcaggccgtcacaagaagt
caattcagaagaccaggtggttgagcagaccgaggaggtgtttcggagctatgccttccaccgctaccaacaggagagag
aagagagaggggaggaagtgcccatggacccagagattgcggagatccagcaggagccaagcagcacggggagcctggtc
gggagacgcttggccatcatcggtgacgacattaacaagcggtacgacgcggagtttcgctgcatgctaaaatccttgca
gcccaacaaggaaaacgcctacgagtacttcaccaggatagcccacagcttgttcgagagcggcattaactggggccggg
tgattgcactgctgggctttggctaccgcatggccatccacgtctatcagcacggcatgacaggtttcctccgctggatc
gcccgctgcgtcgcagagttcatgctccggaaccgcattgcccagtggatcgcccagcagggaggatgggtggctgcact
cgatctggacaatgtttacatgaagtatatgctggcggtggtggccctggtcatggtggggcatttagtggtacgacgct
tcttcaggccctga
© 1998-2023Legal notice