Dataset for CDS BCL-2-like of organism Oreochromis aureus

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A668RI12_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oreochromis aureus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagcctttgaacaggactgatgggggggcggcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggacccctccggcatccccgcagcggcagcagcagccgccatcaacgacggacctc
gacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttcacag
ccagctgcacatcacgccggccacggcctaccaaagctttgagaacgtgatggacgaggtgttccgggacggcgtcaact
ggggccgcatcgtagggctttttgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttggtg
ggcaggatcgtagagtggatgaccgtctacctagacaaccacattcagccctggatccagagccaaggaggatgggagcg
cttcgctgaaatcttcgggcaggatgcggcggccgaaagccggaggtctcaggagagtttcaagaagtggctgctggtgg
ggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A668RLC9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis aureus GN=MCL-1 (length=837 residues).
atgaccaactatttgatgtcgaaaaggaaccagtttaccttcatagactatcttcttcctcaaaatggagtcccggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcatttggacagtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacatgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggttctgggatgcattattgtga
>gnl|bcl2dbcds|A0A668SNL1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis aureus GN=MCL-1 (length=723 residues).
atgttctccttaaattgctgtctgtctgagtggtgtccaaacaacgatgtgggctttatagataattgggaaaccctctg
taggaaacctggtcttgttaggagagacggcatccatcccactttggatggagcagctctcatttctagaaatctggaag
acggttcgttgccgagcaccccggagtttcatttggacagtgaatccgacgaggagctggagagagaaacgaaactcatt
attcacagttttttgggagactttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacgatgaaaag
agttgttgcggacgtattagaaaagcacagatatgcttacaacggaatgattaataaattgtcattggatgaaagagaag
aagatatgtcatttgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgtcagctttgtggccttc
ggagcagtggtgtctcagcacctgaaggaaaagggcagggacaactgcgtggtgctagtgagtcaagagatttctgcata
cttgctgtctgaacagcgagactggattatcaaaaacaatgcatgggatggctttgtggcgttcgttcgagtagcagacc
ctgagtcgatagtcaggaacacactcatggcctttgctggatttgcttgtattggagcaacactggcactgttgatcagg
tga
>gnl|bcl2dbcds|A0A668SSC1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oreochromis aureus GN=BCL2L10 (length=696 residues).
atgtcgagaggcggagtcacacattctctatcagctgaagggaagactcaactgtaccgacgctctccttccgccgtctg
tatgtgcagagagcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctgcttttggccg
aggactacctgtccttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagccgctgccatgaggcgt
ctgggctgggacatcgaaagacagcaccaagctcgcttcgacaacctcgctcagaccttcctggtgcagtgtgggccgga
ccactgcctcagcctcagaaaggtgatgaaggagctggttggagatggacacttgaactgggggagggttgtttctcttt
ttgcctttactggagtgctggccagaaagatcctggagcagaagccggggctggaccctgggcaacagcaggaactggga
caggagcccatgagctgcagaaggctggcagagaccatagctgattacctgggagaagagaagaaagactggctgttgga
taatgatggatgggaaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactcatccatgaagaaagcgc
tgtttgctgccgccggtgtcggccttgctgggcttaccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A668TEB6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=1017 residues).
atgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagcc
tctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctaca
agcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgcc
atcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaaca
ggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtgg
aggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctactc
cccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtgg
catacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctgaa
acctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagctctgt
cggtccagatggttacatgctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagg
atgcatttgtggagctgtacgacagacagagggactccgtcttcagctgctcctggccctccatcaagacagttttcggc
ttggctgcgctcggagcggccagtctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A668TEB6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=1080 residues).
atgtcctctgaagaagggttcagctcagcgataacagattggctttttatcaatacctggtggctccttcttccgttcat
catgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagc
ctctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctac
aagcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgc
catcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaac
aggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtg
gaggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccat
gaaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctact
ccccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtg
gcatacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctga
aacctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagctctg
tcggtccagatggttacatgctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcag
attgtcaccatgggattgtttcggaccatcgcacttttttacctggggagctttgacagcatcgtgcgccgctgtatgat
tcaaagggagcagtcaaaagcggccaataagagggagtaa
>gnl|bcl2dbcds|A0A668TEB6_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=894 residues).
atgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagcc
tctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctaca
agcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgcc
atcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaaca
ggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtgg
aggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctactc
cccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtgg
catacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctgaa
acctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcaattgtcaccatgggattgtttcggac
catcgcacttttttacctggggagctttgacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaaagcggcca
ataagagggagtaa
>gnl|bcl2dbcds|A0A668TEB6_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=561 residues).
atgtcctctgaagaagggttcagctcagcgataacagattggctttttatcaatacctggtggctccttcttccgttcat
catgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagc
ctctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctac
aagcaaggagcgttcatcactttggtggcacgagacgaggtggtgctctgcatctcagttgatgtttccagtgattacag
tcaagtggaaaacgtgataaaacaggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcag
tttctgggaagtttgaggaagtggaggtagatcgttttaaaattgtcaccatgggattgtttcggaccatcgcacttttt
tacctggggagctttgacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaaagcggccaataagagggagta
a
>gnl|bcl2dbcds|A0A668TEB6_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=687 residues).
atggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcggggatacgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggttcaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctccgccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggagtgaactggggccgga
ttattgctttcttcgagtttgggggcacggtgtgcgtggaatgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagctgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagtctcaccatcggagcataccttacacaaaagtga
© 1998-2020Legal notice