Dataset for CDS BCL-2-like of organism Oreochromis aureus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A668RI12_BCL2L1-      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
A0A668SSC1_BCL2L10      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A668TEB6_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-04      atgtcctctgaagaagggttcagctcagcgataacagattggctttttat
A0A668TEB6_BCL2-02      atgtcctctgaagaagggttcagctcagcgataacagattggctttttat
A0A668TEB6_BCL2-03      --------------------------------------------------
                                                                          

A0A668RI12_BCL2L1-      -------------------------------atgtctcaaaacagaga--
A0A668RLC9_MCL1-01      -------------------------------atg----------------
A0A668SNL1_MCL1-01      --------------------------------------------------
A0A668SSC1_BCL2L10      -------------------------------atgtcgagag-gcggagtc
A0A668TEB6_BCL2-05      -------------------------------atggcgaacgagtataatc
A0A668TEB6_BCL2-01      -------------------------------atg----ctgcttgttgtc
A0A668TEB6_BCL2-04      caatacctggtggctccttcttccgttcatcatg----ctgcttgttgtc
A0A668TEB6_BCL2-02      caatacctggtggctccttcttccgttcatcatg----ctgcttgttgtc
A0A668TEB6_BCL2-03      -------------------------------atg----ctgcttgttgtc
                                                                          

A0A668RI12_BCL2L1-      ---------actggtgcttttctacataaggtata--------aactctc
A0A668RLC9_MCL1-01      ---------accaactatttgatgtcgaaaaggaaccagtttaccttcat
A0A668SNL1_MCL1-01      ---------------------atgt------------------tctcctt
A0A668SSC1_BCL2L10      ac-acattctctatcagctgaagggaagactcaactgtaccgacgctctc
A0A668TEB6_BCL2-05      gc-------------aatattgtggaaaag-tatatctgccataaactct
A0A668TEB6_BCL2-01      gctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccct
A0A668TEB6_BCL2-04      gctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccct
A0A668TEB6_BCL2-02      gctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccct
A0A668TEB6_BCL2-03      gctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccct
                                                                          

A0A668RI12_BCL2L1-      ccagagaaactatcctctcaaccacatagtactcaacgagcctttgaaca
A0A668RLC9_MCL1-01      ag------actatcttct---------------------tcctcaaaatg
A0A668SNL1_MCL1-01      aa------attgctgtct---------------------gtct--gagtg
A0A668SSC1_BCL2L10      ct------tccgccgtct---------------------gtatgtgcaga
A0A668TEB6_BCL2-05      --------ccaagcgggg---------------------atacgtgtggg
A0A668TEB6_BCL2-01      cattagtcccaagcctct---------------------aaaattgaacg
A0A668TEB6_BCL2-04      cattagtcccaagcctct---------------------aaaattgaacg
A0A668TEB6_BCL2-02      cattagtcccaagcctct---------------------aaaattgaacg
A0A668TEB6_BCL2-03      cattagtcccaagcctct---------------------aaaattgaacg
                                                                          

A0A668RI12_BCL2L1-      ggac----------tgatgggggggcggc-ggggttggatgaggaacagc
A0A668RLC9_MCL1-01      gagt----------cccggagggaccaat----gcactatggat--cggg
A0A668SNL1_MCL1-01      gtgt----------cc---aaacaacgatgtgggctttatagataattgg
A0A668SSC1_BCL2L10      gagcagtctgatatcgctgggaggaaaat-gaaattctgtgggctgtgga
A0A668TEB6_BCL2-05      gatt-------tcgcgttgt----ccaag-aaga----------------
A0A668TEB6_BCL2-01      gggc-------ccacgtcgtggtgacagg-aggatccagtggg--attgg
A0A668TEB6_BCL2-04      gggc-------ccacgtcgtggtgacagg-aggatccagtggg--attgg
A0A668TEB6_BCL2-02      gggc-------ccacgtcgtggtgacagg-aggatccagtggg--attgg
A0A668TEB6_BCL2-03      gggc-------ccacgtcgtggtgacagg-aggatccagtggg--attgg
                        *                                                 

A0A668RI12_BCL2L1-      gaatagacacaca--------cgccaatgggacttttaatggcacgagtc
A0A668RLC9_MCL1-01      gaa---atcctctccgcagaatgccacaggctcctctaaagactctagca
A0A668SNL1_MCL1-01      gaa---accctct--gtaggaaacc---tggtcttgttagg-----agag
A0A668SSC1_BCL2L10      aag---agaccct------------------gcttttggccg--------
A0A668TEB6_BCL2-05      -ag---atgc--t------------------gctaataacggat-cgata
A0A668TEB6_BCL2-01      gaa---atgcatt------------------gctattgagtgctacaagc
A0A668TEB6_BCL2-04      gaa---atgcatt------------------gctattgagtgctacaagc
A0A668TEB6_BCL2-02      gaa---atgcatt------------------gctattgagtgctacaagc
A0A668TEB6_BCL2-03      gaa---atgcatt------------------gctattgagtgctacaagc
                         *    *  *                      *   *             

A0A668RI12_BCL2L1-      ccgggacc----cctccggcatccccgcagcggcagcagcagccgccatc
A0A668RLC9_MCL1-01      acgggattgtgtctaatggtacccc-caaacggccgaacaacctc----g
A0A668SNL1_MCL1-01      acggcatc-----------catccc-actttggatggagcagctc-----
A0A668SSC1_BCL2L10      -aggacta-----------cctgtc--cttttgctgcacgagtccacatc
A0A668TEB6_BCL2-05      actgaccc-----------tccaccgactttggt-tcac-cggtgccgag
A0A668TEB6_BCL2-01      aaggagcg-----------ttcatc-actttggtggcacgagacgaggag
A0A668TEB6_BCL2-04      aaggagcg-----------ttcatc-actttggtggcacgagacg-----
A0A668TEB6_BCL2-02      aaggagcg-----------ttcatc-actttggtggcacgagacgaggag
A0A668TEB6_BCL2-03      aaggagcg-----------ttcatc-actttggtggcacgagacgaggag
                           *                    *       *    *            

A0A668RI12_BCL2L1-      aa-----------------------------cgacggacctcgacgcagt
A0A668RLC9_MCL1-01      aggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgggag
A0A668SNL1_MCL1-01      ---tcatttcta----------------gaaatct--------------g
A0A668SSC1_BCL2L10      aagcc--------------------------cctccacctcc--cagcga
A0A668TEB6_BCL2-05      aagccagcaccgggcctgacggcgagagcaacacccacctct--------
A0A668TEB6_BCL2-01      aagttgcttcaggcaaagaaggaagtggagaaatttgccatcaatgacaa
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      aagttgcttcaggcaaagaaggaagtggagaaatttgccatcaatgacaa
A0A668TEB6_BCL2-03      aagttgcttcaggcaaagaaggaagtggagaaatttgccatcaatgacaa
                                                                          

A0A668RI12_BCL2L1-      gaaggaggcgctccggg-----------------acacggccaatgagtt
A0A668RLC9_MCL1-01      gaagacggttcgttgccgagcaccccggagtttcatttggacagtgaatc
A0A668SNL1_MCL1-01      gaagacggttcgttgccgagcaccccggagtttcatttggacagtgaatc
A0A668SSC1_BCL2L10      atcagccgctg-ccatgaggcgtctg--ggctg-ggacatcgaaaga---
A0A668TEB6_BCL2-05      gcagacggctc-ccacagtccgaccc--acacgcaggcatccacagagtc
A0A668TEB6_BCL2-01      gcaggtggtgc-tc----tgcatctc--agttg-atgtttccagtgatta
A0A668TEB6_BCL2-04      --aggtggtgc-tc----tgcatctc--agttg-atgtttccagtgatta
A0A668TEB6_BCL2-02      gcaggtggtgc-tc----tgcatctc--agttg-atgtttccagtgatta
A0A668TEB6_BCL2-03      gcaggtggtgc-tc----tgcatctc--agttg-atgtttccagtgatta
                               *                                  *  **   

A0A668RI12_BCL2L1-      cgagctgcgatacgctcgtgc----cttcagcgacctt------------
A0A668RLC9_MCL1-01      cg----acgaggagctggagagagaaacgaaactccttatt---------
A0A668SNL1_MCL1-01      cg----acgaggagctggagagagaaacgaaactcattatt---------
A0A668SSC1_BCL2L10      ca----gcaccaagctcg-------cttcgacaacctcgct---------
A0A668TEB6_BCL2-05      ct----gcgcgaggctggagatgaacttgaaagactgtacc-------ag
A0A668TEB6_BCL2-01      c----------agtcaagtggaaaacgtgataaaacaggctcaagaaaag
A0A668TEB6_BCL2-04      c----------agtcaagtggaaaacgtgataaaacaggctcaagaaaag
A0A668TEB6_BCL2-02      c----------agtcaagtggaaaacgtgataaaacaggctcaagaaaag
A0A668TEB6_BCL2-03      c----------agtcaagtggaaaacgtgataaaacaggctcaagaaaag
                        *             *  *                                

A0A668RI12_BCL2L1-      -caca-----------------gccagctgcacatcacgccggccacggc
A0A668RLC9_MCL1-01      -cacagttttttg---------ggtgattttactggacttt---ctcagc
A0A668SNL1_MCL1-01      -cacagttttttg---------ggagactttactggacttt---ctcagc
A0A668SSC1_BCL2L10      -cagaccttcctggtgcagtgtgg-------gccggaccactgcctcagc
A0A668TEB6_BCL2-05      ccggacttcacggagatgtcgcggcagctgcatctcacctccgccacggc
A0A668TEB6_BCL2-01      ctaggtcctgttgatatg-cttgtgaactgcgctggaactt-----cagt
A0A668TEB6_BCL2-04      ctaggtcctgttgatatg-cttgtgaactgcgctggaactt-----cagt
A0A668TEB6_BCL2-02      ctaggtcctgttgatatg-cttgtgaactgcgctggaactt-----cagt
A0A668TEB6_BCL2-03      ctaggtcctgttgatatg-cttgtgaactgcgctggaactt-----cagt
                                              *             *         * * 

A0A668RI12_BCL2L1-      ctaccaaa--------------------------------gct--ttgag
A0A668RLC9_MCL1-01      ctcaacgaaaggaaaccaaagcactaaaaacgatgaaaagagttgttgcg
A0A668SNL1_MCL1-01      ctcaacgaaaggaaaccaaagcactaaaaacgatgaaaagagttgttgcg
A0A668SSC1_BCL2L10      ctcagaaa--------------------------------ggtgatgaag
A0A668TEB6_BCL2-05      gcagagga--------------------------------ggt--tcgcc
A0A668TEB6_BCL2-01      ttctggga--------------------------------agt--ttgag
A0A668TEB6_BCL2-04      ttctggga--------------------------------agt--ttgag
A0A668TEB6_BCL2-02      ttctggga--------------------------------agt--ttgag
A0A668TEB6_BCL2-03      ttctggga--------------------------------agt--ttgag
                               *                                  *  *    

A0A668RI12_BCL2L1-      aacgtgatgg------acgaggtgttccgggac-------ggcgtcaact
A0A668RLC9_MCL1-01      gacgtattagaaaagcacagatacgcttacaacggaatgattaataaact
A0A668SNL1_MCL1-01      gacgtattagaaaagcacagatatgcttacaacggaatgattaataaatt
A0A668SSC1_BCL2L10      gagctggttggag---atggacactt-------------------gaact
A0A668TEB6_BCL2-05      gaggtgat---ag---acgaactgttccgggac-------ggagtgaact
A0A668TEB6_BCL2-01      gaagtgg----ag---gtagatcgttttaaaaaattgatggaagtgaact
A0A668TEB6_BCL2-04      gaagtgg----ag---gtagatcgttttaaa-------------------
A0A668TEB6_BCL2-02      gaagtgg----ag---gtagatcgttttaaaaaattgatggaagtgaact
A0A668TEB6_BCL2-03      gaagtgg----ag---gtagatcgttttaaaaaattgatggaagtgaact
                         *  *                                             

A0A668RI12_BCL2L1-      g-------------------------------------------------
A0A668RLC9_MCL1-01      g-------tcattggatgaaagacacgaggatatgtcatttgtcggtgct
A0A668SNL1_MCL1-01      g-------tcattggatgaaagagaagaagatatgtcatt---------t
A0A668SSC1_BCL2L10      g-------------------------------------------------
A0A668TEB6_BCL2-05      g-------------------------------------------------
A0A668TEB6_BCL2-01      acctgggcagcgtttacccaacacgagccgtcataaccaccatgaaggag
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      acctgggcagcgtttacccaacacgagccgtcataaccaccatgaaggag
A0A668TEB6_BCL2-03      acctgggcagcgtttacccaacacgagccgtcataaccaccatgaaggag
                                                                          

A0A668RI12_BCL2L1-      --------------------------------------gggccgcatc--
A0A668RLC9_MCL1-01      gtagcgaagagcctctttgcagaccacatgaccaactggggtcgtatt--
A0A668SNL1_MCL1-01      gtagcgaagagcctctttggagaccacacgaccaactggggtcgtatt--
A0A668SSC1_BCL2L10      --------------------------------------ggggagggtt--
A0A668TEB6_BCL2-05      --------------------------------------gggccggatt--
A0A668TEB6_BCL2-01      cgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattgg
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      cgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattgg
A0A668TEB6_BCL2-03      cgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattgg
                                                                          

A0A668RI12_BCL2L1-      --------gtagggctttttgcgttcggcggggcactgtgtgtcgagtgc
A0A668RLC9_MCL1-01      --------gtcagctttgtggccttcggagcagtggtgtctc---agcac
A0A668SNL1_MCL1-01      --------gtcagctttgtggccttcggagcagtggtgtctc---agcac
A0A668SSC1_BCL2L10      --------gtttctctttttgcctttactggagtgctggccagaaagatc
A0A668TEB6_BCL2-05      -------------attgctttcttc---------------------gagt
A0A668TEB6_BCL2-01      tctgtttggttacactgcctactccccatctaagtttgccctgcgaggcc
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      tctgtttggttacactgcctactccccatctaagtttgccctgcgaggcc
A0A668TEB6_BCL2-03      tctgtttggttacactgcctactccccatctaagtttgccctgcgaggcc
                                                                          

A0A668RI12_BCL2L1-      gtcgagaaggagatgagccccttggtg------ggcaggatcgtagagtg
A0A668RLC9_MCL1-01      ctgaaggaaaagg-------------------------------------
A0A668SNL1_MCL1-01      ctgaaggaaaagg-------------------------------------
A0A668SSC1_BCL2L10      ctggagcagaagccggggctgga---------------------------
A0A668TEB6_BCL2-05      ttgggg-gcacggtgtgcgtggaa---------tgcgcttccaacgaggg
A0A668TEB6_BCL2-01      ttgcag-agtcgctgcagatggagataaagccctacaatatctacgtgac
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      ttgcag-agtcgctgcagatggagataaagccctacaatatctacgtgac
A0A668TEB6_BCL2-03      ttgcag-agtcgctgcagatggagataaagccctacaatatctacgtgac
                                                                          

A0A668RI12_BCL2L1-      gatgaccgtctacctagacaaccacat-tcagccctggatccaga-----
A0A668RLC9_MCL1-01      -----------gcagagacaactgcgtggcgctagtgagccaaga-----
A0A668SNL1_MCL1-01      -----------gcagggacaactgcgtggtgctagtgagtcaaga-----
A0A668SSC1_BCL2L10      -----------ccctgggcaacagcag----gaactgggacagga-----
A0A668TEB6_BCL2-05      gatgtcatcccaggtggacaacatcgc----agactggatgacgg-----
A0A668TEB6_BCL2-01      tgtggcatacccccctgacactgacactccaggactggctgaagagaaca
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      tgtggcatacccccctgacactgacactccaggactggctgaagagaaca
A0A668TEB6_BCL2-03      tgtggcatacccccctgacactgacactccaggactggctgaagagaaca
                                                                          

A0A668RI12_BCL2L1-      ------gccaaggaggatgggagcgcttcgctgaaatcttcg--------
A0A668RLC9_MCL1-01      -------------------------ggtttctgcatacctgctgtctgaa
A0A668SNL1_MCL1-01      -------------------------gatttctgcatacttgctgtctgaa
A0A668SSC1_BCL2L10      -------gcccatgagctgcagaaggctggcagagacc---atagctgat
A0A668TEB6_BCL2-05      -------------agtatttaaatggacctcttaa---------------
A0A668TEB6_BCL2-01      agacaaaacctctggagaccaaattaatctctgaaacctctggagtttgt
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      agacaaaacctctggagaccaaattaatctctgaaacctctggagtttgt
A0A668TEB6_BCL2-03      agacaaaacctctggagaccaaattaatctctgaaacctctggagtttgt
                                                                          

A0A668RI12_BCL2L1-      -ggcaggatgcggcggccgaaagcc-------------------------
A0A668RLC9_MCL1-01      cagcgagactggattgtcaaa------------aacaatgc------atg
A0A668SNL1_MCL1-01      cagcgagactggattatcaaa------------aacaatgc------atg
A0A668SSC1_BCL2L10      tacctgggagaagagaagaaagactggctgttggataatga---tggatg
A0A668TEB6_BCL2-05      cagctggat-------acaa-------------gataacgg---gggatg
A0A668TEB6_BCL2-01      caaccagaccaagtggccaa-------------aatcattgtcagggatg
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      caaccagaccaagtggccaa-------------aatcattgtcagggatg
A0A668TEB6_BCL2-03      caaccagaccaagtggccaa-------------aatcattgtcagggatg
                                                                          

A0A668RI12_BCL2L1-      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
A0A668SSC1_BCL2L10      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A668TEB6_BCL2-01      cagtgcaggggaacttcaacagctctgtcggtccagatggttacatgcta
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      cagtgcaggggaacttcaacagctctgtcggtccagatggttacatgcta
A0A668TEB6_BCL2-03      ca------------------------------------------------
                                                                          

A0A668RI12_BCL2L1-      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
A0A668SSC1_BCL2L10      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A668TEB6_BCL2-01      tcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtct
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      tcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtct
A0A668TEB6_BCL2-03      --------------------------------------------------
                                                                          

A0A668RI12_BCL2L1-      ------ggaggtctcaggagagtttcaagaagtg----------------
A0A668RLC9_MCL1-01      ------ggatggctttgtggagttctttcgagtagca-------------
A0A668SNL1_MCL1-01      ------ggatggctttgtggcgttcgttcgagtagca-------------
A0A668SSC1_BCL2L10      -----ggaaggcttctgtaagttctcccgcagtgccagagaagt------
A0A668TEB6_BCL2-05      ------ggatgcatttgtggagctgtacgacagacagagggactccgtct
A0A668TEB6_BCL2-01      ccagcaggatgcatttgtggagctgtacgacagacagagggactccgtct
A0A668TEB6_BCL2-04      -------attgtcaccatgggattgttt--cggaccatcgcact---ttt
A0A668TEB6_BCL2-02      ccagcagattgtcaccatgggattgttt--cggaccatcgcact---ttt
A0A668TEB6_BCL2-03      -------attgtcaccatgggattgttt--cggaccatcgcact---ttt
                                  *                                       

A0A668RI12_BCL2L1-      ------gctgctgg-----tggggatgacggtggtgacgggcgttgtggc
A0A668RLC9_MCL1-01      ------gaccctgagtccacggtcaggaacacactcatggcctttgctg-
A0A668SNL1_MCL1-01      ------gaccctgagtcgatagtcaggaacacactcatggcctttgctg-
A0A668SSC1_BCL2L10      ------gagccaggactcat--ccatgaagaaagcgctgtttgctgccgc
A0A668TEB6_BCL2-05      tcagctgctcctggccc--t--ccatcaagacagttttcggcttggctgc
A0A668TEB6_BCL2-01      tcagctgctcctggccc--t--ccatcaagacagttttcggcttggctgc
A0A668TEB6_BCL2-04      ttacctg----gggagc--t--tt-----gacagcatcgtgcgccgctgt
A0A668TEB6_BCL2-02      ttacctg----gggagc--t--tt-----gacagcatcgtgcgccgctgt
A0A668TEB6_BCL2-03      ttacctg----gggagc--t--tt-----gacagcatcgtgcgccgctgt
                              *     *                                *  * 

A0A668RI12_BCL2L1-      ------------tggtgctcttatcgcgcagaaacgcct-----------
A0A668RLC9_MCL1-01      --------gatttgctggtattggggcaacactggccctgttgatcaggt
A0A668SNL1_MCL1-01      --------gatttgcttgtattggagcaacactggcactgttgatcag--
A0A668SSC1_BCL2L10      cggtgtcggccttgctgggcttacctt---------cctcttggtgcg--
A0A668TEB6_BCL2-05      ---gctcggagcggccagtctcaccatcggagcataccttacacaaaa--
A0A668TEB6_BCL2-01      ---gctcggagcggccagtctcaccatcggagcataccttacacaaaa--
A0A668TEB6_BCL2-04      atgattcaaagggagcagtcaaa-------agcggccaataagaggga--
A0A668TEB6_BCL2-02      atgattcaaagggagcagtcaaa-------agcggccaataagaggga--
A0A668TEB6_BCL2-03      atgattcaaagggagcagtcaaa-------agcggccaataagaggga--
                                                                          

A0A668RI12_BCL2L1-      ----------------gtga
A0A668RLC9_MCL1-01      tctgggatgcattattgtga
A0A668SNL1_MCL1-01      ----------------gtga
A0A668SSC1_BCL2L10      ----------------ctag
A0A668TEB6_BCL2-05      ----------------gtga
A0A668TEB6_BCL2-01      ----------------gtga
A0A668TEB6_BCL2-04      ----------------gtaa
A0A668TEB6_BCL2-02      ----------------gtaa
A0A668TEB6_BCL2-03      ----------------gtaa
                                         *  

© 1998-2020Legal notice