Dataset for CDS BCL-2-like of organism Oreochromis aureus

[Download (right click)] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A668TEB6_BCL2-03         --------------------------------------------------
A0A668TEB6_BCL2-02         atgtcctctgaagaagggttcagctcagcgataacagattggctttttat
A0A668TEB6_BCL2-01         --------------------------------------------------
A0A668RLC9_MCL1-01         --------------------------------------------------
A0A668SNL1_MCL1-01         --------------------------------------------------
A0A668SSC1_BCL2L10-01      --------------------------------------------------
A0A668RI12_BCL2L1-01       --------------------------------------------------
A0A668TEB6_BCL2-05         --------------------------------------------------
A0A668TEB6_BCL2-04         atgtcctctgaagaagggttcagctcagcgataacagattggctttttat
                                                                             

A0A668TEB6_BCL2-03         -------------------------------atgctgcttgt-tgtcgc-
A0A668TEB6_BCL2-02         caatacctggtggctccttcttccgttcatcatgctgcttgt-tgtcgc-
A0A668TEB6_BCL2-01         -------------------------------atgctgcttgt-tgtcgc-
A0A668RLC9_MCL1-01         -------------------------------atgaccaacta--tttga-
A0A668SNL1_MCL1-01         -------------------------------atgttctccttaaattgc-
A0A668SSC1_BCL2L10-01      -------------------------------atgtcgaga--------gg
A0A668RI12_BCL2L1-01       -------------------------------atgtctcaa--------aa
A0A668TEB6_BCL2-05         -------------------------------atggcgaacga--gtataa
A0A668TEB6_BCL2-04         caatacctggtggctccttcttccgttcatcatgctgcttgt-tgtcgc-
                                                          ***                

A0A668TEB6_BCL2-03         tgccttcatcgttgcttttgtgttgctgttatatatgatatc---gcccc
A0A668TEB6_BCL2-02         tgccttcatcgttgcttttgtgttgctgttatatatgatatc---gcccc
A0A668TEB6_BCL2-01         tgccttcatcgttgcttttgtgttgctgttatatatgatatc---gcccc
A0A668RLC9_MCL1-01         ------------------tgtcgaaaaggaaccagtttacct--tcatag
A0A668SNL1_MCL1-01         ------------------tg------------------------------
A0A668SSC1_BCL2L10-01      cggagtcacacattctctatcagctgaagggaagactcaactgtaccgac
A0A668RI12_BCL2L1-01       cagaga-actggtgcttttctacataaggtataaactctccc--agagaa
A0A668TEB6_BCL2-05         tcgcaa-tattgtggaaaagtatatctgccataaactctcca--agcggg
A0A668TEB6_BCL2-04         tgccttcatcgttgcttttgtgttgctgttatatatgatatc---gcccc
                                                                             

A0A668TEB6_BCL2-03         tcattagtcccaagcctctaaaattgaac-ggggcccacgtcgtggtgac
A0A668TEB6_BCL2-02         tcattagtcccaagcctctaaaattgaac-ggggcccacgtcgtggtgac
A0A668TEB6_BCL2-01         tcattagtcccaagcctctaaaattgaac-ggggcccacgtcgtggtgac
A0A668RLC9_MCL1-01         actatcttcttcctcaaaatggagtcccg-gag-g---------------
A0A668SNL1_MCL1-01         ---------tctgtctgagtggtgtccaaacaa-c---------------
A0A668SSC1_BCL2L10-01      gctctccttccgccgtctgtatgtgcaga-gag-cagtctgatatcgctg
A0A668RI12_BCL2L1-01       actatcctctcaaccacatagtactcaac-gag-cctttgaacaggactg
A0A668TEB6_BCL2-05         gatacgt-------------------------------------------
A0A668TEB6_BCL2-04         tcattagtcccaagcctctaaaattgaac-ggggcccacgtcgtggtgac
                                                                             

A0A668TEB6_BCL2-03         aggaggatc-------cagtggg--attgggaaat----------gcatt
A0A668TEB6_BCL2-02         aggaggatc-------cagtggg--attgggaaat----------gcatt
A0A668TEB6_BCL2-01         aggaggatc-------cagtggg--attgggaaat----------gcatt
A0A668RLC9_MCL1-01         ----gacca-------atgcact---atggatcgg----------ggaaa
A0A668SNL1_MCL1-01         ----gatgt-------gggcttt---atagataat----------tggga
A0A668SSC1_BCL2L10-01      ggaggaaaatgaaattctgtgggctgtggaaagag----------accct
A0A668RI12_BCL2L1-01       atggggggg-------cggcggg--gttggatgag----------gaaca
A0A668TEB6_BCL2-05         gtggggatt-------tcgcgtt--gtccaagaagaagatgctgctaata
A0A668TEB6_BCL2-04         aggaggatc-------cagtggg--attgggaaat----------gcatt
                               *             *                               

A0A668TEB6_BCL2-03         gctattgagtgctacaagcaaggagcg--ttcatcactttggtg----gc
A0A668TEB6_BCL2-02         gctattgagtgctacaagcaaggagcg--ttcatcactttggtg----gc
A0A668TEB6_BCL2-01         gctattgagtgctacaagcaaggagcg--ttcatcactttggtg----gc
A0A668RLC9_MCL1-01         tcctctc-------cgc--aga-atgccacaggctcctctaaag----ac
A0A668SNL1_MCL1-01         aaccctc-------tgt--agg-aaacct---ggtcttgttaggagagac
A0A668SSC1_BCL2L10-01      gctt----------ttg--gccgaggactacctgtccttttgct----gc
A0A668RI12_BCL2L1-01       gcgaata-------gac--acacacgccaatgggacttttaatg----gc
A0A668TEB6_BCL2-05         acggatc-------gat-aactgaccctccaccgactttggtt------c
A0A668TEB6_BCL2-04         gctattgagtgctacaagcaaggagcg--ttcatcactttggtg----gc
                                                  *             *           *

A0A668TEB6_BCL2-03         acgagacgaggagaag---ttgcttcag------------------gcaa
A0A668TEB6_BCL2-02         acgagacgaggagaag---ttgcttcag------------------gcaa
A0A668TEB6_BCL2-01         acgagacgaggagaag---ttgcttcag------------------gcaa
A0A668RLC9_MCL1-01         tctagcaacgggattgtgtctaatggtacccccaaacggccgaacaacct
A0A668SNL1_MCL1-01         ggcatccatcccacttt---------------------------------
A0A668SSC1_BCL2L10-01      acgagtccacatcaag---cccctcca--------------------cct
A0A668RI12_BCL2L1-01       acgagtcccgggaccc---ctccggcat-------------------ccc
A0A668TEB6_BCL2-05         accggtgccgagaagc---cagcaccgg------------------gcct
A0A668TEB6_BCL2-04         acgagacgag----------------------------------------
                                                                             

A0A668TEB6_BCL2-03         agaagg------------------aagtggagaaatttgccat-caatga
A0A668TEB6_BCL2-02         agaagg------------------aagtggagaaatttgccat-caatga
A0A668TEB6_BCL2-01         agaagg------------------aagtggagaaatttgccat-caatga
A0A668RLC9_MCL1-01         cgaggtaacctcaacaaacgggtataaaacaaaa-gctatccgggaccgg
A0A668SNL1_MCL1-01         ---------------------ggatggagcagct-ctcatttctagaaat
A0A668SSC1_BCL2L10-01      cccagc------------------g-aatcagcc-gctgccat-------
A0A668RI12_BCL2L1-01       cgcagc------------------ggcagcagca-gccgccat-------
A0A668TEB6_BCL2-05         gacggc------------------gagagcaaca-cccacctctgc----
A0A668TEB6_BCL2-04         --------------------------------------------------
                                                                             

A0A668TEB6_BCL2-03         caagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtc
A0A668TEB6_BCL2-02         caagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtc
A0A668TEB6_BCL2-01         caagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtc
A0A668RLC9_MCL1-01         gaggaagacggttcgttgccgagcaccccggagtttcatt-tggacagtg
A0A668SNL1_MCL1-01         ctggaagacggttcgttgccgagcaccccggagtttcatt-tggacagtg
A0A668SSC1_BCL2L10-01      ---------------g---a------------------------------
A0A668RI12_BCL2L1-01       ---------------c---aacgacggacctcgacgcagt-gaagga---
A0A668TEB6_BCL2-05         -----agacggctccc---acagtccgacccacacgcagg-catccacag
A0A668TEB6_BCL2-04         -------gtggtgctctgcatctcagttgatgtttccagtgattacagtc
                                                                             

A0A668TEB6_BCL2-03         aagtggaaaacgtgataaaacaggct-caagaaaagctaggtcctgttga
A0A668TEB6_BCL2-02         aagtggaaaacgtgataaaacaggct-caagaaaagctaggtcctgttga
A0A668TEB6_BCL2-01         aagtggaaaacgtgataaaacaggct-caagaaaagctaggtcctgttga
A0A668RLC9_MCL1-01         aatccgacgaggagc------tggag-agagaaacgaaactccttattca
A0A668SNL1_MCL1-01         aatccgacgaggagc------tggag-agagaaacgaaactcattattca
A0A668SSC1_BCL2L10-01      ---------ggcgtc------tgggctgggacatcgaaagacagca----
A0A668RI12_BCL2L1-01       ggcgctccgggacac------ggcca-atgagttcgagctgcgata----
A0A668TEB6_BCL2-05         agtcctgcgcgaggc------tggag-atgaacttgaaagactgta----
A0A668TEB6_BCL2-04         aagtggaaaacgtgataaaacaggct-caagaaaagctaggtcctgttga
                                                 *            *              

A0A668TEB6_BCL2-03         tatgc---ttgtgaactgcgctggaacttc--agtttctgggaagtttga
A0A668TEB6_BCL2-02         tatgc---ttgtgaactgcgctggaacttc--agtttctgggaagtttga
A0A668TEB6_BCL2-01         tatgc---ttgtgaactgcgctggaacttc--agtttctgggaagtttga
A0A668RLC9_MCL1-01         cagttttttgggtgattttactggactttctcagcctcaacgaaaggaaa
A0A668SNL1_MCL1-01         cagttttttgggagactttactggactttctcagcctcaacgaaaggaaa
A0A668SSC1_BCL2L10-01      --------------------------------------------------
A0A668RI12_BCL2L1-01       --------------------------------------------------
A0A668TEB6_BCL2-05         --------------------------------------------------
A0A668TEB6_BCL2-04         tatgc---ttgtgaactgcgctggaacttc--agtttctgggaagtttga
                                                                             

A0A668TEB6_BCL2-03         ggaagtggaggtagatcgttttaaaaaattgatggaagtgaactacctgg
A0A668TEB6_BCL2-02         ggaagtggaggtagatcgttttaaaaaattgatggaagtgaactacctgg
A0A668TEB6_BCL2-01         ggaagtggaggtagatcgttttaaaaaattgatggaagtgaactacctgg
A0A668RLC9_MCL1-01         -ccaaagcactaaaaacgatgaaaagagttgttgcggacgtattagaaaa
A0A668SNL1_MCL1-01         -ccaaagcactaaaaacgatgaaaagagttgttgcggacgtattagaaaa
A0A668SSC1_BCL2L10-01      --------------------------------------------------
A0A668RI12_BCL2L1-01       --------------------------------------------------
A0A668TEB6_BCL2-05         --------------------------------------------------
A0A668TEB6_BCL2-04         ggaagtggaggtagatcgttttaaa-------------------------
                                                                             

A0A668TEB6_BCL2-03         gcagcgtttacccaacacgagccgtcata-----------------acca
A0A668TEB6_BCL2-02         gcagcgtttacccaacacgagccgtcata-----------------acca
A0A668TEB6_BCL2-01         gcagcgtttacccaacacgagccgtcata-----------------acca
A0A668RLC9_MCL1-01         gcacagatacgcttacaacggaatgattaataaactgtcattggatgaaa
A0A668SNL1_MCL1-01         gcacagatatgcttacaacggaatgattaataaattgtcattggatgaaa
A0A668SSC1_BCL2L10-01      ---ccaagctcgcttcgacaacctcgctcagaccttcctggtgcagtgtg
A0A668RI12_BCL2L1-01       ---cgctcgtgccttcagcgaccttcacagccagctgcacatcacgccgg
A0A668TEB6_BCL2-05         ---ccagccggacttcacggagatgtcgcggcagctgcatctcacctccg
A0A668TEB6_BCL2-04         --------------------------------------------------
                                                                             

A0A668TEB6_BCL2-03         ccatga---aggagcgaagaatgggccgcatcatgttcgtttcctcccag
A0A668TEB6_BCL2-02         ccatga---aggagcgaagaatgggccgcatcatgttcgtttcctcccag
A0A668TEB6_BCL2-01         ccatga---aggagcgaagaatgggccgcatcatgttcgtttcctcccag
A0A668RLC9_MCL1-01         gacacgaggatatgtcatttgtcggtgctgtagcgaaga-----------
A0A668SNL1_MCL1-01         gagaagaagatatgtcatttg---------tagcgaaga-----------
A0A668SSC1_BCL2L10-01      ggccggaccactgcctcagcctcagaaaggtgatgaagg-----------
A0A668RI12_BCL2L1-01       ccacgg---cctaccaaagctttgagaacgtgatggacg-----------
A0A668TEB6_BCL2-05         ccacgg---cgcagaggaggttcgccgaggtgatagacg-----------
A0A668TEB6_BCL2-04         --------------------------------------------------
                                                                             

A0A668TEB6_BCL2-03         gcgggccagattggtctgtttggtta---cactgcctactccccatctaa
A0A668TEB6_BCL2-02         gcgggccagattggtctgtttggtta---cactgcctactccccatctaa
A0A668TEB6_BCL2-01         gcgggccagattggtctgtttggtta---cactgcctactccccatctaa
A0A668RLC9_MCL1-01         -------------gcctctttgcagaccacatgaccaactggg-gtcgta
A0A668SNL1_MCL1-01         -------------gcctctttggagaccacacgaccaactggg-gtcgta
A0A668SSC1_BCL2L10-01      -------------agctggttggagatggacacttgaactggg-ggaggg
A0A668RI12_BCL2L1-01       -------------aggtgttccgggacggc---gtcaactggg-gccgca
A0A668TEB6_BCL2-05         -------------aactgttccgggacgga---gtgaactggg-gccgga
A0A668TEB6_BCL2-04         --------------------------------------------------
                                                                             

A0A668TEB6_BCL2-03         g---------tttgccctgcgaggccttgcagagtcgctgcagatggaga
A0A668TEB6_BCL2-02         g---------tttgccctgcgaggccttgcagagtcgctgcagatggaga
A0A668TEB6_BCL2-01         g---------tttgccctgcgaggccttgcagagtcgctgcagatggaga
A0A668RLC9_MCL1-01         ttgtcagctttgtggccttcggagca--gtggtgtctcagcacctgaagg
A0A668SNL1_MCL1-01         ttgtcagctttgtggccttcggagca--gtggtgtctcagcacctgaagg
A0A668SSC1_BCL2L10-01      ttgtttctctttttgcctttactgga--gtgctggccagaaagatcctgg
A0A668RI12_BCL2L1-01       tcgtagggctttttgcgttcggcggg--gcactgtgtgtcgagtgcgtcg
A0A668TEB6_BCL2-05         ttattgctttcttcgagtttgggggc--acggtgtgcgtggaatgcgctt
A0A668TEB6_BCL2-04         --------------------------------------------------
                                                                             

A0A668TEB6_BCL2-03         ---taaagccc-------------------------------------ta
A0A668TEB6_BCL2-02         ---taaagccc-------------------------------------ta
A0A668TEB6_BCL2-01         ---taaagccc-------------------------------------ta
A0A668RLC9_MCL1-01         ---aaaagggc-------------------------------------ag
A0A668SNL1_MCL1-01         ---aaaagggc-------------------------------------ag
A0A668SSC1_BCL2L10-01      ---agcagaagccggggctggaccctgggcaacagcaggaactgggacag
A0A668RI12_BCL2L1-01       ---agaaggag-------------------------------------at
A0A668TEB6_BCL2-05         ccaacgagggg-------------------------------------at
A0A668TEB6_BCL2-04         --------------------------------------------------
                                                                             

A0A668TEB6_BCL2-03         caatatctacg-tg-actgtggcatacccccctgacactgacactccagg
A0A668TEB6_BCL2-02         caatatctacg-tg-actgtggcatacccccctgacactgacactccagg
A0A668TEB6_BCL2-01         caatatctacg-tg-actgtggcatacccccctgacactgacactccagg
A0A668RLC9_MCL1-01         agacaactgcg-tg-gcg--------------------------------
A0A668SNL1_MCL1-01         ggacaactgcg-tg-gtg--------------------------------
A0A668SSC1_BCL2L10-01      gagcccatgagctgcaga--------------------------------
A0A668RI12_BCL2L1-01       gagccccttgg-tg-ggc--------------------------------
A0A668TEB6_BCL2-05         gtcatcccagg-tg-gac--------------------------------
A0A668TEB6_BCL2-04         --------------------------------------------------
                                                                             

A0A668TEB6_BCL2-03         actggctgaagagaacaagacaaaacctctggagaccaaattaatctctg
A0A668TEB6_BCL2-02         actggctgaagagaacaagacaaaacctctggagaccaaattaatctctg
A0A668TEB6_BCL2-01         actggctgaagagaacaagacaaaacctctggagaccaaattaatctctg
A0A668RLC9_MCL1-01         ----------------------------ctagtgagccaagaggtttctg
A0A668SNL1_MCL1-01         ----------------------------ctagtgagtcaagagatttctg
A0A668SSC1_BCL2L10-01      ----------------------------aggctggcagagaccatagctg
A0A668RI12_BCL2L1-01       ----------------------------aggatcgtagagtggatgaccg
A0A668TEB6_BCL2-05         ----------------------------aacatcgcagactggatgacgg
A0A668TEB6_BCL2-04         --------------------------------------------------
                                                                             

A0A668TEB6_BCL2-03         aaacctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagg
A0A668TEB6_BCL2-02         aaacctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagg
A0A668TEB6_BCL2-01         aaacctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagg
A0A668RLC9_MCL1-01         catacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgg
A0A668SNL1_MCL1-01         catacttgctgtctgaacagcgagactggattatcaaaaacaatgcatgg
A0A668SSC1_BCL2L10-01      attacctgggagaagagaagaaagactggctgttggataatgatggatgg
A0A668RI12_BCL2L1-01       tctacctagacaaccacattcagccctggatccagagccaaggaggatgg
A0A668TEB6_BCL2-05         agtatttaaatggacctcttaacagctggatacaagataacgggggatgg
A0A668TEB6_BCL2-04         --------------------------------------------------
                                                                             

A0A668TEB6_BCL2-03         gatgcaatt-----------------------------------------
A0A668TEB6_BCL2-02         gatgcagtgcaggggaacttcaacagctctgtcggtccagatggttacat
A0A668TEB6_BCL2-01         gatgcagtgcaggggaacttcaacagctctgtcggtccagatggttacat
A0A668RLC9_MCL1-01         gatggctttgtggagttct-------------------------------
A0A668SNL1_MCL1-01         gatggctttgtggcgttcg-------------------------------
A0A668SSC1_BCL2L10-01      gaaggcttctgtaagttct-------------------------------
A0A668RI12_BCL2L1-01       gagcgcttcgctgaaatct-------------------------------
A0A668TEB6_BCL2-05         gatgcatttgtggagctgt-------------------------------
A0A668TEB6_BCL2-04         --------------------------------------------------
                                                                             

A0A668TEB6_BCL2-03         --------------------------------------------------
A0A668TEB6_BCL2-02         gctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagg
A0A668TEB6_BCL2-01         gctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagg
A0A668RLC9_MCL1-01         --------------------------------------------------
A0A668SNL1_MCL1-01         --------------------------------------------------
A0A668SSC1_BCL2L10-01      --------------------------------------------------
A0A668RI12_BCL2L1-01       --------------------------------------------------
A0A668TEB6_BCL2-05         --------------------------------------------------
A0A668TEB6_BCL2-04         --------------------------------------------------
                                                                             

A0A668TEB6_BCL2-03         --------------gtcaccatgggattgttt---cggaccat----cgc
A0A668TEB6_BCL2-02         gtctccagcagattgtcaccatgggattgttt---cggaccat----cgc
A0A668TEB6_BCL2-01         gtctccagcaggatgcatttgtggagctgtacga-cagacaga----ggg
A0A668RLC9_MCL1-01         ------------------------------ttcgagtagcagaccctgag
A0A668SNL1_MCL1-01         ------------------------------ttcgagtagcagaccctgag
A0A668SSC1_BCL2L10-01      ------------------------------cccg-cagtgcca----gag
A0A668RI12_BCL2L1-01       ------------------------------tcgg-gcaggatg----cgg
A0A668TEB6_BCL2-05         ------------------------------acga-cagacaga----ggg
A0A668TEB6_BCL2-04         -----------attgtcaccatgggattgttt---cggaccat----cgc
                                                                             

A0A668TEB6_BCL2-03         acttt---------tttacctggggagctttgacagcatcg-tgc-gccg
A0A668TEB6_BCL2-02         acttt---------tttacctggggagctttgacagcatcg-tgc-gccg
A0A668TEB6_BCL2-01         actccgtcttcagctgctcctggccctccatcaagacagtt-ttc-ggct
A0A668RLC9_MCL1-01         tcca-----cggtc------aggaacacactcatggccttt-gct-ggat
A0A668SNL1_MCL1-01         tcga-----tagtc------aggaacacactcatggccttt-gct-ggat
A0A668SSC1_BCL2L10-01      aagt-----gagccaggactcatccatgaagaaagcgctgtttgctgccg
A0A668RI12_BCL2L1-01       cggccgaaagccggaggtctcaggagagtttcaagaagtggctgctggtg
A0A668TEB6_BCL2-05         actccgtcttcagctgctcctggccctccatcaagacagtt-ttc-ggct
A0A668TEB6_BCL2-04         acttt---------tttacctggggagctttgacagcatcg-tgc-gccg
                                                           *             *   

A0A668TEB6_BCL2-03         ctgtatg-attcaaagggagcagtcaa-------aagcggc-c----aat
A0A668TEB6_BCL2-02         ctgtatg-attcaaagggagcagtcaa-------aagcggc-c----aat
A0A668TEB6_BCL2-01         tggctgc-gctcggagcggccagtctcaccatcggagcata-c----ctt
A0A668RLC9_MCL1-01         ttgctgg-tattggggcaac-actgg-ccctgttgatcaggttctgggat
A0A668SNL1_MCL1-01         ttgcttg-tattggagcaac-actgg-cactgttgatcagg---------
A0A668SSC1_BCL2L10-01      ccg---------gtgtcggcct--------tgctgggctta-ccttcctc
A0A668RI12_BCL2L1-01       gggatgacggtggtgacgggcgttgt-ggctggtgctctta-tcgcgcag
A0A668TEB6_BCL2-05         tggctgc-gctcggagcggccagtctcaccatcggagcata-cc----tt
A0A668TEB6_BCL2-04         ctgtatg-attcaaagggagcagtcaa-------aagcggc-c----aat
                             *                                  *            

A0A668TEB6_BCL2-03         aagagggagtaa
A0A668TEB6_BCL2-02         aagagggagtaa
A0A668TEB6_BCL2-01         acacaaaagtga
A0A668RLC9_MCL1-01         gcattattgtga
A0A668SNL1_MCL1-01         ---------tga
A0A668SSC1_BCL2L10-01      ttggtgcgctag
A0A668RI12_BCL2L1-01       aaacgcctgtga
A0A668TEB6_BCL2-05         acacaaaagtga
A0A668TEB6_BCL2-04         aagagggagtaa
                                    *  

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice