Dataset for CDS BCL2L1 of organism Scophthalmus maximus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2U9BIG9_BCL2L1-      atgtcggacagtaacagagagctggtcgagttcttcatcggctataagct
A0A2U9BY16_BCL2L1-      atgtct--cag-aacaaagaactggtggttttctacatacagtataaact
                        *****   *** **** *** ***** *  **** ***    ***** **

A0A2U9BIG9_BCL2L1-      gtcccagaggaactacccgacctctctac----tgaggccggaggatgct
A0A2U9BY16_BCL2L1-      ctcccagaggaaatat----cctctcaaccatatgggacttaatgagcct
                         *********** **     ****** **    ** * *   * **  **

A0A2U9BIG9_BCL2L1-      ggtggaaggactgagggagacaaggccaact-----------cagctgcc
A0A2U9BY16_BCL2L1-      ccgaacaggactgatcggggggaggcaggtttgggggaggaacagcagac
                              ********  * *   ****    *           **** * *

A0A2U9BIG9_BCL2L1-      agcaatggcttgttggtcgacgg--cggcaacaggtgcggtcagctgggg
A0A2U9BY16_BCL2L1-      agcgccgcat-----gccaacggaactctaaacggcgtga--atcccggg
                        ***   *  *     * * ****  *   **  ** * *   * *  ***

A0A2U9BIG9_BCL2L1-      actgacccgttgcccccg----------gacggt--------------gg
A0A2U9BY16_BCL2L1-      acccccccagagtccccgctgcggctgcaacggttgccttcatcgccgag
                        **   ***   * *****           *****               *

A0A2U9BIG9_BCL2L1-      cgtgggggctgtgaaggaggcgctcagggactccgctcatgagtttgaac
A0A2U9BY16_BCL2L1-      cctggatgcagtaaaagaggcccttcgggactcggccaacgagtttgagc
                        * ***  ** ** ** ***** **  ******* **  * ******** *

A0A2U9BIG9_BCL2L1-      agctcttcaaccaagcgttcagtgacctctccctgcagctcgacatcacc
A0A2U9BY16_BCL2L1-      tgcggtacgcgcgcgccttcagcgatctgcacaaccagctgcacatcacg
                         **  * *   *  ** ***** ** **   *   *****  ******* 

A0A2U9BIG9_BCL2L1-      cctgacacggcctaccaaagctttaagagtgtgatggacgaggtgttcaa
A0A2U9BY16_BCL2L1-      ccggccacggcctaccaaagcttcgagagtgtgatgaacgaggtgttccg
                        ** * ******************  *********** ***********  

A0A2U9BIG9_BCL2L1-      ggacggagtcaactggggacgtatagtgggcctgttcgcttttggcggcg
A0A2U9BY16_BCL2L1-      ggacggcgtcaactggggccgcatcatagggctttttgcatttggcgggg
                        ****** *********** ** **  * ** ** ** ** ******** *

A0A2U9BIG9_BCL2L1-      tgctgtgtgtggaatgcgtcgagaagaataggggcgagctggtcgcccgt
A0A2U9BY16_BCL2L1-      cgctgagtgtggagtgtgtggagaaggagatgagttcgctggtgggcagg
                         **** ******* ** ** ****** * * * *   ****** * * * 

A0A2U9BIG9_BCL2L1-      atcgctgactggatgaccatgtacctggatgagcacatcagcccctggat
A0A2U9BY16_BCL2L1-      atcgttgagtggatgacggtgtacctagacaacaacatccagccctggat
                        **** *** ********  ******* **  *  *****   ********

A0A2U9BIG9_BCL2L1-      ccagagccaaggaggctggggctgctttgcggagatttttgggcaaggcg
A0A2U9BY16_BCL2L1-      ccaaagtcaaggaggatgggagcactttgctgaaatcttcgggcaggacg
                        *** ** ******** ****    ****** ** ** ** ***** * **

A0A2U9BIG9_BCL2L1-      ccggcgcagaagcaaggagatatcgggagagcgtgaggcgatggctgcta
A0A2U9BY16_BCL2L1-      cggcggcagggagtcgaaggtctcaggagagtttcaagaagtggctgctg
                        * *  ****      * ** * ** ******  * * *   ******** 

A0A2U9BIG9_BCL2L1-      gttggagtggggatgctgacaggagtgctgattgctatgttcatcgctaa
A0A2U9BY16_BCL2L1-      gcagggatgaccctggtgaccggggtcgtggtgggctcactgattgccca
                        *  **  **    ** **** ** **  ** * *      * ** **  *

A0A2U9BIG9_BCL2L1-      gaaaca---gtga
A0A2U9BY16_BCL2L1-      gaagcgcctgtga
                        *** *    ****

© 1998-2022Legal notice