Dataset for CDS BCL2L1 of organism Scophthalmus maximus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2U9BIG9_BCL2L1-      atgtcggacagtaacagagagctggtcgagttcttcatcggc--------
A0A2U9BY16_BCL2L1-      atgtct--cag-aacaaagaactggtggttttctacatacag--------
A0A2U9BY16_BCL2L1-      atgtct--cag-aacaaagaactggtggttttctacatacag--------
A0A2U9BY16_BCL2L1-      atgtct--cag-aacaaagaactggtggttttctacatacag--------
A0A2U9BY16_BCL2L1-      atgtct--cag-aacaaagaactggtggttttctacatacag--------
A0A2U9BY16_BCL2L1-      --gacg--cca-gacaacgattttgtggagaacaccattcaaggcctgag
                          * *   *    ***  **  * ** *    *  ***            

A0A2U9BIG9_BCL2L1-      ------tataagctgtcccagagg-----------------aactacccg
A0A2U9BY16_BCL2L1-      ------tataaactctcccagagg-----------------aaatat---
A0A2U9BY16_BCL2L1-      ------tataaactctcccagagg-----------------aaatat---
A0A2U9BY16_BCL2L1-      ------tataaactctcccagagg-----------------aaatat---
A0A2U9BY16_BCL2L1-      ------tataaactctcccagagg-----------------aaatat---
A0A2U9BY16_BCL2L1-      tggattcgtcagcttttctgtaggtttggctttcacccccaaagtct---
                                * * ** * *   ***                 ** *     

A0A2U9BIG9_BCL2L1-      acctctctac----tgaggccggaggatgctggtggaag-----------
A0A2U9BY16_BCL2L1-      -cctctcaaccatatgggacttaatgagcctccgaacag-----------
A0A2U9BY16_BCL2L1-      -cctctcaaccatatgggacttaatgagcctccgaacag-----------
A0A2U9BY16_BCL2L1-      -cctctcaaccatatgggacttaatgagcctccgaacag-----------
A0A2U9BY16_BCL2L1-      -cctctcaaccatatgggacttaatgagcctccgaacag-----------
A0A2U9BY16_BCL2L1-      -cctctggatatcagctgacc--atggttgtctgaacagaggaaagcagg
                         *****  *        * *   * *    *      **           

A0A2U9BIG9_BCL2L1-      -------------------------------------gactgagggagac
A0A2U9BY16_BCL2L1-      -------------------------------------gactgatcggggg
A0A2U9BY16_BCL2L1-      -------------------------------------gactgatcggggg
A0A2U9BY16_BCL2L1-      -------------------------------------gactgatcggggg
A0A2U9BY16_BCL2L1-      -------------------------------------gactgatcggggg
A0A2U9BY16_BCL2L1-      gagacagcctggcacagcgagcattcactctaacacagactgatcggggg
                                                             ******  * *  

A0A2U9BIG9_BCL2L1-      aaggccaact-----------cagctgccagcaatggcttgttggtcgac
A0A2U9BY16_BCL2L1-      gaggcaggtttgggggaggaacagcagacagcgccgcat-----gccaac
A0A2U9BY16_BCL2L1-      gaggcaggtttgggggaggaacagcagacagcgccgcat-----gccaac
A0A2U9BY16_BCL2L1-      gaggcaggtttgggggaggaacagcagacagcgccgcat-----gccaac
A0A2U9BY16_BCL2L1-      gaggcaggtttgggggaggaacagcagacagcgccgcat-----gccaac
A0A2U9BY16_BCL2L1-      gaggcaggtttgggggaggaacagcagacagcgccgcat-----gccaac
                         ****    *           **** * ****   *  *     * * **

A0A2U9BIG9_BCL2L1-      gg--cggcaacaggtgcggtcagctggggactgacccgttgcccccg---
A0A2U9BY16_BCL2L1-      ggaactctaaacggcgtga--atcccgggacccccccagagtccccactg
A0A2U9BY16_BCL2L1-      ggaactctaaacggcgtga--atcccgggacccccccagagtccccactg
A0A2U9BY16_BCL2L1-      ggaactctaaacggcgtga--atcccgggacccccccagagtccccactg
A0A2U9BY16_BCL2L1-      ggaactctaaacggcgtga--atcccgggacccccccagagtccccactg
A0A2U9BY16_BCL2L1-      ggaactctaaacggcgtga--atcccgggacccccccagagtccccactg
                        **  *   **  ** * *   * *  *****   ***   * ****    

A0A2U9BIG9_BCL2L1-      -------gacggt--------------ggcgtgggggctgtgaaggaggc
A0A2U9BY16_BCL2L1-      cggctgcaacggttgccttcatcgccgagcctggatgcagtaaaagaggc
A0A2U9BY16_BCL2L1-      cggctgcaacggttgccttcatcgccgagcctggatgcagtaaaagaggc
A0A2U9BY16_BCL2L1-      cggctgcaacggttgccttcatcgccgagcctggatgcagtaaaagaggc
A0A2U9BY16_BCL2L1-      cggctgcaacggttgccttcatcgccgagcctggatgcagtaaaagaggc
A0A2U9BY16_BCL2L1-      cggctgcaacggttgccttcatcgccgagcctggatgcagtaaaagaggc
                                *****               ** ***  ** ** ** *****

A0A2U9BIG9_BCL2L1-      gctcagggactccgctcatgagtttgaacagctcttcaaccaagcgttca
A0A2U9BY16_BCL2L1-      ccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgccttca
A0A2U9BY16_BCL2L1-      ccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgccttca
A0A2U9BY16_BCL2L1-      ccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgccttca
A0A2U9BY16_BCL2L1-      ccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgccttca
A0A2U9BY16_BCL2L1-      ccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgccttca
                         **  ******* **  * ******** * **  * *   *  ** ****

A0A2U9BIG9_BCL2L1-      gtgacctctccctgcagctcgacatcacccctgacacggcctaccaaagc
A0A2U9BY16_BCL2L1-      gcgatctgcacaaccagctgcacatcacgccggccacggcctaccaaagc
A0A2U9BY16_BCL2L1-      gcgatctgcacaaccagctgcacatcacgccggccacggcctaccaaagc
A0A2U9BY16_BCL2L1-      gcgatctgcacaaccagctgcacatcacgccggccacggcctaccaaagc
A0A2U9BY16_BCL2L1-      gcgatctgcacaaccagctgcacatcacgccggccacggcctaccaaagc
A0A2U9BY16_BCL2L1-      gcgatctgcacaaccagctgcacatcacgccggccacggcctaccaaagc
                        * ** **   *   *****  ******* ** * ****************

A0A2U9BIG9_BCL2L1-      tttaagagtgtgatggacgaggtgttcaaggacggagtcaactggggacg
A0A2U9BY16_BCL2L1-      ttcgagagtgtgatgaacgaggtgttccgggacggcgtcaactggggccg
A0A2U9BY16_BCL2L1-      ttcgagagtgtgatgaacgaggtgttccgggacggcgtcaactggggccg
A0A2U9BY16_BCL2L1-      ttcgagagtgtgatgaacgaggtgttccgggacggcgtcaactggggccg
A0A2U9BY16_BCL2L1-      ttcgagagtgtgatgaacgaggtgttccgggacggcgtcaactggggccg
A0A2U9BY16_BCL2L1-      ttcgagagtgtgatgaacgaggtgttccgggacggcgtcaactggggccg
                        **  *********** ***********  ****** *********** **

A0A2U9BIG9_BCL2L1-      tatagtgggcctgttcgcttttggcggcgtgctgtgtgtggaatgcgtcg
A0A2U9BY16_BCL2L1-      catcatagggctttttgcatttggcggggcgctgagtgtggagtgtgtgg
A0A2U9BY16_BCL2L1-      catcatagggctttttgcatttggcggggcgctgagtgtggagtgtgtgg
A0A2U9BY16_BCL2L1-      catcatagggctttttgcatttggcggggcgctgagtgtggagtgtgtgg
A0A2U9BY16_BCL2L1-      catcatagggctttttgcatttggcggggcgctgagtgtggagtgtgtgg
A0A2U9BY16_BCL2L1-      catcatagggctttttgcatttggcggggcgctgagtgtggagtgtgtgg
                         **  * ** ** ** ** ******** * **** ******* ** ** *

A0A2U9BIG9_BCL2L1-      agaagaataggggcgagctggtcgcccgtatcgctgactggatgaccatg
A0A2U9BY16_BCL2L1-      agaaggagatgagttcgctggtgggcaggatcgttgagtggatgacggtg
A0A2U9BY16_BCL2L1-      agaaggagatgagttcgctggtgggcaggatcgttgagtggatgacggtg
A0A2U9BY16_BCL2L1-      agaaggagatgagttcgctggtgggcaggatcgttgagtggatgacggtg
A0A2U9BY16_BCL2L1-      agaaggagatgagttcgctggtgggcaggatcgttgagtggatgacggtg
A0A2U9BY16_BCL2L1-      agaaggagatgagttcgctggtgggcaggatcgttgagtggatgacggtg
                        ***** * * * *   ****** * * * **** *** ********  **

A0A2U9BIG9_BCL2L1-      tacctggatgagcacatcagcccctggatccagagccaaggaggctggg-
A0A2U9BY16_BCL2L1-      tacctagacaacaacatccagccctggatccaaagtcaaggaggatggac
A0A2U9BY16_BCL2L1-      tacctagacaacaacatccagccctggatccaaagtcaaggaggatggg-
A0A2U9BY16_BCL2L1-      tacctagacaacaacatccagccctggatccaaagtcaaggaggatggg-
A0A2U9BY16_BCL2L1-      tacctagacaacaacatccagccctggatccaaagtcaaggaggatggg-
A0A2U9BY16_BCL2L1-      tacctagacaacaacatccagccctggatccaaagtcaaggaggatggg-
                        ***** **  *  *****   *********** ** ******** ***  

A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      tttttgccaccagaccaccaggccagtcaagcccagaaagatgaagatgc
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
                                                                          

A0A2U9BIG9_BCL2L1-      ---------------gctgctttgcgga---------gatttttgggcaa
A0A2U9BY16_BCL2L1-      cccccaggacggtcttccactctgctgacggctcctgcatctctgggaag
A0A2U9BY16_BCL2L1-      -----ag----------cactttgctga---------aatcttcgggcag
A0A2U9BY16_BCL2L1-      -----ag----------cactttgctga---------aatcttcgggcag
A0A2U9BY16_BCL2L1-      -----ag----------cactttgctga---------aatcttcgggcag
A0A2U9BY16_BCL2L1-      -----ag----------cactttgctga---------aatcttcgggcag
                                           ** *** **          ** *  *** * 

A0A2U9BIG9_BCL2L1-      g---------------------gcgccggcgcagaagcaaggagatatcg
A0A2U9BY16_BCL2L1-      gtctggcagaacttgagtcggtacactgcagcag---gtcaaag-----a
A0A2U9BY16_BCL2L1-      g---------------------acgcggcggcagggagtcgaaggtctca
A0A2U9BY16_BCL2L1-      g---------------------acgcggcggcagggagtcgaaggtctca
A0A2U9BY16_BCL2L1-      g---------------------acgcggcggcagggagtcgaaggtctca
A0A2U9BY16_BCL2L1-      g---------------------acgcggcggcagggagtcgaaggtctca
                        *                      * * *  ****        **      

A0A2U9BIG9_BCL2L1-      ggagagcgtgaggcg-atggctgctagttggagtgggga-----------
A0A2U9BY16_BCL2L1-      ggagaaaaacaggaaggtgtacagtgtcatggatgcaacaggctcaccca
A0A2U9BY16_BCL2L1-      ggagagtttcaagaa-gtggctgctggcagggatg--------------a
A0A2U9BY16_BCL2L1-      ggagagtttcaagaa-gtggctgctggcagggatg--------------a
A0A2U9BY16_BCL2L1-      ggagagtttcaagaa-gtggctgctggcagggatg--------------a
A0A2U9BY16_BCL2L1-      ggagagtttcaagaa-gtggctgctggcagggatg--------------a
                        *****     * *    **     *     *  **               

A0A2U9BIG9_BCL2L1-      --------------tgctgacaggagtgctgattgctatgtt-------c
A0A2U9BY16_BCL2L1-      cccccctcctctctctgtggtctgtgttgtggcaggatccctttccctaa
A0A2U9BY16_BCL2L1-      ccc-----------tggtgaccggggtcgtggtgggctcact-------g
A0A2U9BY16_BCL2L1-      ccc-----------tggtgaccggggtcgtggtgggctcact-------g
A0A2U9BY16_BCL2L1-      ccc-----------tggtgaccggggtcgtggtgggctcact-------g
A0A2U9BY16_BCL2L1-      ccc-----------tggtgaccggggtcgtggtgggctcact-------g
                                         **    * **  **   *      *        

A0A2U9BIG9_BCL2L1-      atcgctaagaaacag--------tga
A0A2U9BY16_BCL2L1-      ttttctccactgcacgtggtatttaa
A0A2U9BY16_BCL2L1-      attgcccagaagcgcctg-----tga
A0A2U9BY16_BCL2L1-      attgcccagaagcgcctg-----tga
A0A2U9BY16_BCL2L1-      attgcccagaagcgcctg-----tga
A0A2U9BY16_BCL2L1-      attgcccagaagcgcctg-----tga
                         *  *       *          * *

© 1998-2020Legal notice