Dataset for CDS BCL-2-like of organism all

[Download (right click)] [Alignment] [Repertoires]

1576 sequence(s)

>gnl|bcl2dbcds|A0A3Q1EQB9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=MCL-1 (length=840 residues).
atgaatatgattcctacgaagaggacgacgctgatgaactgcttaatctttccgcaaaatggagtcgtggagggaccgat
gcactatggatccggagattcctccccgcagatttccgtggcctcctctatagatcctcaaaacgggaatcttggctcca
gtgataccccaaaacggccgaagaacctgggagtgaacgggtatgcgccaaaaagccttcgacaagacagcgacagtatg
gaggacggctctttaccgtgcaccccagagctccagtcggacagtgaaaccgacgtctccagttgtccaacaggggacga
gttgctggagaatgacacgaggcaactcattcgccgtttcttaagagactttactggactttcaaagccccggtggaatg
aaagcaaagcattatcaacaatgaaaagagtggtggatgacgttttggacaaacacagatactcatacaatggtatgatc
aacaaactgtcgctggatgacataggggatgatgtgtcgtttgtcagtgcagtagctaagagcctgtttgcagacaggac
aaccaactggggtcgtattacgagcctggtggccttcggggcggtggtttgtcagtacttaaaggagaggggcagggaga
actgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaacaactca
tgggacggttttgtggagttttttcgagtagcagaccctgagttgacggtcagaaacacactcatggcctttgctggatt
tgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3Q1EQB9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=MCL-1 (length=1152 residues).
atgaatatgattcctacgaagaggacgacgctgatgaactgcttaatctttccgcaaaatggagtcgtggagggaccgat
gcactatggatccggagattcctccccgcagatttccgtggcctcctctatagatcctcaaaacgggaatcttggctcca
gtgataccccaaaacggccgaagaacctgggagtgaacgggtatgcgccaaaaagccttcgacaagacagcgacagtatg
gaggacggctctttaccgtgcaccccagagctccagtcggacagtgaaaccgacgtctccagttgtccaacaggggacga
gttgctggagaatgacacgaggcaactcattcgccgtttcttaagagactttactggactttcaaagccccggtggaatg
aaagcaaagcattatcaacaatgaaaagagtggtggatgacgttttggacaaacacagatactcatacaatggtatgatc
aacaaactgtcgctggatgacataggggatgatgtgtcgtttgtcagtgcagtagctaagagcctgtttgcagacaggac
aaccaactggggtcgtattacgagcctggtggccttcggggcggtggtttgtcagtacttaaaggagaggggcagggaga
actgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaacaactca
tgggacggttttgtggagttttttcgagtagcagaccctgagttgacggtcagaaacacactcatggcctttgctggatt
tgctggtattggggcaacactggccctgctgatcagactggaaagtaaatttggggaaacccagaggaccgggagaggag
ccggaggcaaacgatggatccaggggggccggaggaaaccacaggagaggaaccggaggagacacgatgcctgcagggac
cgaggcagggggcaagggaaccgacagaactggagggttccaaggagggggaaccaggagggacacggagccggcagggg
tccaagacggaagcaaggagacagactgggcaggagtggtccggacagcgggatcctccaggagaggagaacagagaaaa
agacgttagtctcagaaatacttgtcacgtaa
>gnl|bcl2dbcds|A0A3Q1EVP6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L1 (length=627 residues).
atgtcgtgcagtaacagagagctggtggagttctttataagctacaagctgtctcaaaggaactatccgatgtctctgct
gaggccagaggatgctggaggaaggactgatggggacaaggccagctcagcctccagtaacggcttgctggtgaacaaca
gagacggcatagaggctgtaaaatccacccttaaggatgcggcagatgaatttgaacttctcttcacgcaaactttcagt
gacctgtcttcgcagattgacatcacccctgaaacggcctaccacagctttaagagtgtgatggatgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagagaagaatatga
gtgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtccctggatccagagccaagga
gactgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacggaggtctcgggatactctgaagcgatg
gctgctagccggaggggtgctgctaatgggagtgctggctggtgtactcattgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q1FLK7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaatattgtagaaaagtacatctgccataaactctccaaacggggctacgtgtgggggtt
tgatgatgtccgggatgaagatgctgctaataacgggtcagtagttgaccctccgccgactttggtccgtcggtgccatg
aagccagcaccgggcccgacaacgagagcgacccccacctctgcagacggctcccccagtccgacccgcacgctgccatc
cacagagtcctgcgggaggctggggatgaacttgaaagactgtaccagccggacttcacggagatgtccaggcagctcta
tctcaccaccaccacggcgcagaggagattcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggggggacggtgtgcgtcgagtgcgcggccaaagaggagatgacatcgcaggtggacaac
atcgcggagtggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgccttcgt
ggagctgtatgacagacagagggactcagtcttcagttgctcctggccctccatcaagacggttttcggtctggcagcac
tcggggcggcgagcctcaccatcggagcgtaccttacacaaaagtga
>gnl|bcl2dbcds|A0A3Q1FR00_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactgtcccagagaaactatcccctcaaccacatggt
gctgaacgaggctcccaacaggactgatgggggggaggcccggctgggagaggaccagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcagtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtcatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgcgtcgagtgcgtggaaaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagggccagggaggatgggagcgttttgctga
gatcttcggtcaggacgcggcggccgagagcaggaggtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtggggtcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1FR00_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L1 (length=1107 residues).
atgttccgacggcacgtgaaggcgtcatattacgtaatagggaggcagggccgagcggacgtaggaggatacgtgcgagc
acacacactcgtgaacacaaagtggatgtgtgacattcttgtggagcttgacagctttttgtgcgcaccgagcgacagac
ggactggagacagcgtcacggagcggaggacagcttcccgggaatcccgtgcttttgtttcggttcttgctgggcctgag
ctggtttgtcagccttgtgtaggtttggttttcacccccgagcgtcctgtggatatcagcggaccatggtggtctgagca
gagggcagcaggaaggcagcctggcacagtgtgtgttcactctaacgcagcgagacggaccagagccacgaggacggaaa
acacattggcacgcaacatgtctcagaacagagaactggtggttttctacataaagtataaactgtcccagagaaactat
cccctcaaccacatggtgctgaacgaggctcccaacaggactgatgggggggaggcccggctgggagaggaccagcggac
agagacacacgccaacgggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacgg
cgaccatggacgcagtgaaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgac
ctgcacagccagctgcacatcacgcccgccaccgcctaccagagcttcgagaacgtcatggacgaggtgttccgggacgg
cgtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgcgtcgagtgcgtggaaaaggagatgagcc
ccctggtgggcaggatcgtagagtggatgaccgtctacctggacaaccacattcaggactggatccagggccagggagga
tgggagcgttttgctgagatcttcggtcaggacgcggcggccgagagcaggaggtctcaggagagcttcaagaagtggct
gctggtggggatgacggtggtgacgggggtggtggtggggtcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1GM98_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L10 (length=585 residues).
atgtcctgtgggctatggaaagagactgtggtcctggcagaggactacctgtccctgtgctgtgcaggcccacatcaagc
ccctccacctcccagcgagtcagccgctgccatgaggcgtctggcccaagacatggagaagcagcaccaggctcgcttcc
actccctcactcaggccttcctgaggcagtgcgggccggacttctgctccagcctcaggatggtgatggaggagctggtg
gaagatggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctggccagacagctgctggagca
gaaggacacaaagccggggctggaccccgggaagcgacaggaactgggacagaggcctgtaaactgcagaggactggcag
agaccatagctgattacttgggagaggagaagaaagactggctgttggagaatgatggatgggaaggcttctgtaagttc
tccctcagtgccagaaaggcgagtcaggacttgtccatgaagacagcgctgtttgctgctgccggtgtcggcctcgctgg
actcaccttcctcctggtgcgctaa
>gnl|bcl2dbcds|A0A8B9M984_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Accipiter nisus GN=MCL-1 (length=1431 residues).
atgttcgccgtgaagcggaacgccgtcatcggcttcaacctctactgcggcggcggcccggccctggcgcccgcctcgcc
gggaggggggccggccccgccgccgccgcccgccgccgccgctgaggtacccgggaccctgattggctccgtggcggcct
gggccgccgccggtcgccccgagcacccccgcgcgctggttggctgcggcgcggccccccgcgcggcgctgccccccgcg
gcgcggccgggcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggccgagcgcggcccggcggggga
ctcgctgcccggcacgccgcccgggccgccggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgct
acctgcgggaggcggcgggcgaggccgagcccgccgtgaagaagctttttccggggctgctgggcgggcccggccggccc
gggggatcgggcgatgccgtgatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgcagaaacacga
gctggccttccagggaatgcttcggaaactggaaatccagaaagaggaagatctgcagtcggtgtgtgaagtggctgccc
acgtgttcagtgatggagtaacaaactggggtcgagtggtgacactcatctcgttcggtgcctttgttgcgaaacacctg
aaaagcataaaccaggagaggtgcatcagctcgctggcagggatcatcacagatgcacttgtctcatctaagcgcgagtg
gctaatgagccagggaggctgggagggctttgttgacttctttcgagtcgaggacctagaaggcagcatcagaaatgtac
tgatggcgtttgcaggtgtggctggactaggagcgagcttggcctacatgatccggaatgtcaccaactgctggatccct
agcctgggatggcagggaacagagttctgctcctcctgggatggctcatgtccaaggccagcattgcttctttctatgcc
agggacactgcaggagacctggcaggcacatcccaggagtgctcattccttcttcctttcctcctctcagctcaagccct
tgtccttgctggtgagtctctgcttgcagagttatggtgacagtccttggggtcctgaacagttcttgctgaacaaggca
acaggccttggtgtcccctcaagcagcagcaagtcatgttgcgactctgctgtccttccatgtgctgcctggctcaaaag
gtgtccggcagcactgggcaccaggtgcaagccctgccacccctctgaaagattagacagtctccccaaatcccaccagt
gccctagaaaccccagtgagcactggggttctgccctcttccccccttccagagtccatgctcagggttgg
>gnl|bcl2dbcds|A0A8B9M984_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Accipiter nisus GN=MCL-1 (length=990 residues).
atgttcgccgtgaagcggaacgccgtcatcggcttcaacctctactgcggcggcggcccggccctggcgcccgcctcgcc
gggaggggggccggccccgccgccgccgcccgccgccgccgctgaggtacccgggaccctgattggctccgtggcggcct
gggccgccgccggtcgccccgagcacccccgcgcgctggttggctgcggcgcggccccccgcgcggcgctgccccccgcg
gcgcggccgggcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggccgagcgcggcccggcggggga
ctcgctgcccggcacgccgcccgggccgccggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgct
acctgcgggaggcggcgggcgaggccgagcccgccgtgaagaagctttttccggggctgctgggcgggcccggccggccc
gggggatcgggcgatgccgtgatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgcagaaacacga
gctggccttccagggaatgcttcggaaactggaaatccagaaagaggaagatctgcagtcggtgtgtgaagtggctgccc
acgtgttcagtgatggagtaacaaactggggtcgagtggtgacactcatctcgttcggtgcctttgttgcgaaacacctg
aaaagcataaaccaggagaggtgcatcagctcgctggcagggatcatcacagatgcacttgtctcatctaagcgcgagtg
gctaatgagccagggaggctgggagggctttgttgacttctttcgagtcgaggacctagaaggcagcatcagaaatgtac
tgatggcgtttgcaggtgtggctggactaggagcgagcttggcctacatgatccgattgcaggtaccaatgaggatttat
tgctttgggaagagaaagtggaagaattga
>gnl|bcl2dbcds|A0A8B9N2I0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Accipiter nisus GN=BCL2L1 (length=693 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaatgggagcccctcct
ggcacccgcctgccagccacgtagtgaacggagccgccatgcaccggagcagccttgaagtccatgaaatcgttcaaaca
gctgatgtaaggcaggcgttgagagaggcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccctggcacggcgtatcagagttttgagcaggtagtgaatgaactcttccgtgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctatgggaacgatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9RWH9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Accipiter nisus GN=BCL-2 (length=744 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccgccgaggacagggcacccctgcctccgggtctctctcctcctgctgctgctgctgctgcggttg
ctgctgctgctgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagcccccc
ggctcggccgctgctagccacgcgcccccggccgaggggctgccccccgcgccccaggtcgtccacctcgccctgcgcca
ggcgggcgacgagttctcccgccgctaccagagggacttcgcccaaatgtccggccagctgcacctgacgcccttcacgg
ccaggggccgcttcgtggcggtggtggaggagctcttccgagacggcgtcaactggggcaggatcgtggccttcttcgag
ttcggcggcgtgatgtgcgtggagagcgtcaaccgggagatgtctcccctcgtagacagcatcgccgcctggatgaccga
gtacctgaaccggcacctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagta
tgaggcctttgttcgatttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactctt
ggcgcttatcttggacataagtag
>gnl|bcl2dbcds|A0A8B9RZD1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Accipiter nisus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttggctcaagattatctgcaatatgtgcttcaggaatcacatcttgg
accagcccaaaccagggttgctcatgtcttgcgaaacattgcatcttcgctgcaagatcaaaccgaggaggctctcagac
cattcttggacaggattgatattacttctgtagctgtggccaagagaattttcaatggtgtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacctttgggggtcttctcactaagaagcttcaagagcatgg
agttcagctcactggagaagagaaggagcagatttcttatttcatcacagagtacataataaacaacaaagccgaatgga
tagatgcgaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactatctttctccaaaatcaca
gccatgttcatagctgttttttccttgctcagagagtactactga
>gnl|bcl2dbcds|A0A7N5JVN3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L10 (length=582 residues).
atggcggacgcgttgagggagcgcacggcgcggctgctgaccgactacctggagtactgcgcccgggagcccggcacccc
tgcgcgggcgccgtccacgcccgaggccgcggtgctgcgttcggtggccgcccaggtacagcagcgtcacgagcgcttct
tgtccgattaccgcggctacggcggcaaccgcgtggagctggtggctcaggtggagcgggagatactcgcccacccccag
cccctaagctggggccgtgtggtggcgctcttgaccttcgcgggcacactgctggagagatcgccgtcggggacctactc
gaacctggggccggaccaggaactggagctgggggagtgggaggccggcgtccgccaggactgccggcacctggtggact
tcctctgcaatcggctcacgggacagcatcgcgcctggctggaggcgcacgacggctgggatggcttttgtctcttcttc
acacccatgctgccgtcgtcttggaaaagactgctggcccaggctcttctgtcctgcttcacagcggtgatcttaatcta
cttctggaaaaggttattgtga
>gnl|bcl2dbcds|G1L3L7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
cgccgcctcatcgggagggcggcttttggcttcggggaaggaggccacggcccggagggagatagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgctagtcccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgccgcgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaacctt
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcggtggcccttgtacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaggctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|G1L3L7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
cgccgcctcatcgggagggcggcttttggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagcc
ggaaggcgttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaggctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G1LIC9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=705 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgctcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctcgccgccaccgcccccggccgcccccgccgccgccgccgccgcgggccctgcg
ctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactt
cgcggagatgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttca
gggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggag
atgtcgcccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaa
cggaggctgggatgcctttgtggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtctctgaagg
ccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|G1LIJ8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2A1 (length=657 residues).
atgcacacagaaattccaccggcctccacgcctcccatgagtcacggtcccagccccgcaggcactcgcctatttggcct
cggctgctggcggcggagcagacggccggctggccagcggggcgggtggaagatgacagactgcgagttcgggtacaccc
tgacgctggcccaggactacgtgaagcacgtcctgcagatcccgcagccgggctcggcccccagcagggcgtcccaggtg
ctgcgggacgtggcctcctccgtgcagggggaggtggaaaagaacttgaaaccatgcctggacagttttgatgtggtgtc
cgtcgactccgccagaaccatattcaatcaggtcatggaaaaggaatttgaagacggcatcattaactggggaaggattg
tgaccatatttgcgtttgaagggattctcaccaagaaactcctccgggagcgaatttccccagatgtggacgcttctagg
atttcttacttcgtggcggagttcatcacgacaaacatgagagagtggataaggcagaacggaggctgggaagacggctt
tgtaaagaagttcgaacccaagtctggctggctgacttttctggaagttacggggaagatctgtgaaatgttctctctcc
tgaagcaatactgctga
>gnl|bcl2dbcds|G1LKF5_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L2 (length=996 residues).
atggcgaccccagcttcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaaaggtta
tgtgtgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacacgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgcctggtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaagagatggaaccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtctattgaagagaagatggaggctgatgcccgttccatctatgttggcaacgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaatcgtgttaccatactctgtgacaaatttagtggccatcctaaa
gggtttgcatatatagagttctcagataaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcaccacagaccggggtttcccacgagcccgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtttctgtag
>gnl|bcl2dbcds|G1LKF5_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L2 (length=1002 residues).
atggcgaccccagcttcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaaaggtta
tgtgtgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacacgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgcctggtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaagagatggaaccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtctattgaagagaagatggaggctgatgcccgttccatctatgttggcaacgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaatcgtgttaccatactctgtgacaaatttagtggccatcctaaa
gggtttgcatatatagagttctcagataaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcaccacagaccggggtttcccacgagcccgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8B9FJB5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Amazona collaria GN=BCL2A1 (length=525 residues).
atggaaactgctgacttctactacgtttattatttagctcaagattatctgcaatatgtgcttcaggagtcacatcttgg
accagcccaaaccagagttgctcatgtcttgcgaaacattgcatcttcactgcaagatcaaactgaggaggctctcagac
cattcctggacagaattgacattacctctgtagctgttgccaagagaattttcaatggtgtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacatttggaggtcttctcactaagaagcttcaagagcatgg
agttcagctcactggagaggaaaaggagcagatttcgtatttcatcacagagtacatcataaacaataaagccgaatgga
tagatgcaaacggtggctgggaaaatggcttcctaacgaagtttgaaagaagatcacgactgtctttctccaaaattaca
gccatgttcatagctgtttttaccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8B9FKI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amazona collaria GN=BCL2L1 (length=1302 residues).
atgtgccccgtgcgcccggccctggcggcgcggactcgccggtttgcggccgagcgaggggcttcgggggtggggggggc
tgtgcccggtgcagggggtgcgagggtgaccccgcggttaccgtcacaccgggcccctctcggggctgccgtaacccttg
gcaacgccgcttgcccgcttccgccggccgccgttgggcaacgccggcggaggggggcggggggagccgagctctttaac
gggcggggcgggggcggggctgcctccgcctccgctgcgcttcgggactggcggagcgcggccgggccggtccgcagcca
ccgcagcgccagagccgcctcccgcagcccggcccggcccggcccggcccgcagccgcctgcccgcacccggtgaggccc
gggggctccctggggtccaggtcagatgctcccatcggcggtgcagaagaagagcagggtcgggagctgctgagtgccga
tctgtgcgtgctccggaccatggactcattgagggcgtcccaggtgtgaaaatgtccagcagcaaccgggcgttagtgat
tgactttgtgtcctacaagctctcgcagaagggccacagctggagccagctggaggaggaggatgagagcaggactgact
ttgcagctgaggaggtagagatggacggcgtcctcaatgggagcccctcctggcacccgcccgccagccacgtagtgaac
ggagctgccatgcaccggagcagcctccaggtccacaacacagtccaagcggccgacgtgaggcaggcactgagagaggc
gggggatgagttcgagctgaggtaccggcgggcgttcagcgacctcacgtcccagctccacatcacccccggcaccgcgt
accagagctttgagcaggtggtgaacgaactcttccgcgatggagtgaactgggggcgcatcgtggctttcttctccttc
ggaggagccttgtgtgtggagagcgtcgacaaggagatgcgggtattggtgggacgcattgtgtcttggatgaccaccta
cttgaccgaccacctagatccctggatccaggagaatggcggatgggagcgctttgtggacctctatgggaacgatgctg
ctgccgaggcgctgaggccaaggcagcacttcagccaccagctcccacactggggggccccgggcagcgggggcagaagg
tgccccccccccaggctcctccaggtcacttggaagagaataaacagacttatttttgcatgtgtgagtgcgtgcgtgtg
tgtagatgtgtcactaatataa
>gnl|bcl2dbcds|A0A8B9GMI8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amazona collaria GN=MCL-1 (length=801 residues).
atgttcgcgctcaagcggaaagcggtcatcggcctcaacctctactgcgggggcagcccggccccgccgccgccctcccc
ggcggcctgggccgcggggtgctccgaggcgctgctgggctgcggcccggtcccgctgcggagccccgaggaggagctgg
acggctgcgagccggagcccgagcgcggccccgcggcggccccgctgcccggcggcgcccccgacgccctgcgccaggcc
tcgctggagctcatcggccgctacctgcgggaggcggcgggcgaggcccagcccgcgcccaagaagctgttcccggggct
gctgtgcgggcccgggcggccccgaggggcggcggattcggggctggagaaggcgctggagacgctgcggaggctcgggg
acagcgtcctgcggaagcacgagctcgcgttccagggaatgctccggaagctggaaatccagaaggaggaggacctgcag
gcggtgcacgaggtggctgcgcgcttgttcagcgacggggtgaccaactggggccgggtggtgacgctcatctccttcgg
ggccttcgtcgccaagcacctgaagagcatccggcaggagcagtgcatcggctccctggcagggatcatcacggacgcgc
tcctctcctccagtcgcgagtggctgctgagccagggaggttgggagggctttgtggacttctttcacgtggaagacctg
gaaggcagcatcaggaatgtgctgatggcgtttgcaggcgtggctggactgggagcgagcttggcgtacatgatccggtg
a
>gnl|bcl2dbcds|A0A3Q0R633_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=MCL-1 (length=684 residues).
tctcttccttttacatccccagactccaatggtaccccaaaacggccgaacaacctgggggtggtatcaacaaacggata
tgcaccaaaaaatatcacggacgacgtggaagacggttcgttgccgagcaccccggagtttcattcggatagtgaatccg
acgaggcgctggagagggaaacgaaaagcctcattactagtttctttagagactttactggactttctcaacgacgatgg
aaagaaagcgaagcactaaaaacaatgaaaagagttgtggcggacgtattagaaaagcaccgatacgcatacaacggaat
ggtcaacaaattgtcattggatgaaagaggggaggacgtgacatttgtgagcgcggtagccaagagcctgtttgcagaca
aaaccaccaactggggtcgtattgccagtctgatggcctttggggcagtggtgtgtcagcgcttgaaggaaaaaggcagg
gacaattgtgtggagctggtgagccaggagatttccacatacctgctgtctgaccaacgagactggctggttaaaaacaa
tgcatgggatggatttgtggagttttttcgtgtagcagaccccgagtcaacagtgaggaacacactcatggcctttgctg
gatttgctggtattggggcaacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3Q0R633_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=MCL-1 (length=429 residues).
atgcctgagagaaatggtagtgctatatcaactcagttgggattacatcctaggatttctggaatggtcaacaaattgtc
attggatgaaagaggggaggacgtgacatttgtgagcgcggtagccaagagcctgtttgcagacaaaaccaccaactggg
gtcgtattgccagtctgatggcctttggggcagtggtgtgtcagcgcttgaaggaaaaaggcagggacaattgtgtggag
ctggtgagccaggagatttccacatacctgctgtctgaccaacgagactggctggttaaaaacaatgcatgggatggatt
tgtggagttttttcgtgtagcagaccccgagtcaacagtgaggaacacactcatggcctttgctggatttgctggtattg
gggcaacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3Q0R633_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=MCL-1 (length=810 residues).
atgaacacgtgtactatgaggaattgtcgaatgggctcgtataaaaatgtcatggacctttttcttcctcaaaatggagt
cgtggacggaacaatgcactatggatcggggaattcctctccgcaagatgccacaggtacacctaaagactccaatggta
ccccaaaacggccgaacaacctgggggtggtatcaacaaacggatatgcaccaaaaaatatcacggacgacgtggaagac
ggttcgttgccgagcaccccggagtttcattcggatagtgaatccgacgaggcgctggagagggaaacgaaaagcctcat
tactagtttctttagagactttactggactttctcaacgacgatggaaagaaagcgaagcactaaaaacaatgaaaagag
ttgtggcggacgtattagaaaagcaccgatacgcatacaacggaatggtcaacaaattgtcattggatgaaagaggggag
gacgtgacatttgtgagcgcggtagccaagagcctgtttgcagacaaaaccaccaactggggtcgtattgccagtctgat
ggcctttggggcagtggtgtgtcagcgcttgaaggaaaaaggcagggacaattgtgtggagctggtgagccaggagattt
ccacatacctgctgtctgaccaacgagactggctggttaaaaacaatgcatgggatggatttgtggagttttttcgtgta
gcagaccccgagtcaacagtgaggaacacactcatggcctttgctggatttgctggtattggggcaacactggccctgtt
gatcaggtga
>gnl|bcl2dbcds|A0A3Q0RTF8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtgcttttctacataacgtataaactatcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcagggttggatgaggaacagcgaatagatacacacgccaatg
ggacttttaatggcacaagtcccggtaccccgccagcgtccccgcagcggcagcaacagccgccatcaacaacgaacctc
gacgcagtgaaggaggcgctccgggacacagccaacgagttcgagctgcgatacgctcgtgccttcaacgatctgcacag
ccagctgcacatcacgccggccacggcctaccaaagcttcgagaatgtgatggacgaggtgttccgggatggcgtcaact
ggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgtgtcgagaaggagatgagccccctggtg
ggcaggatcgtagagtggatgacagtctacctagacaaccacattcagccctggatccagagccaaggaggatgggagcg
ctttgctgaaatctttgggcaggacgcggcggctgaaagccggaggtctcaggagagcttcaagaagtggctgcttgtgg
gcatgacggtggtgaccggcgtcgtggcaggtgcactcatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q0S5Z7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Amphilophus citrinellus GN=BCL-2 (length=687 residues).
atggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaaacggggatacgcgtggggatt
tgacggtgtccaggatgaagatgctgctaataacgggtcaataaatgaccctccaccgactttggtccgccggtgccgag
aacccagcaacgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcagacatc
cacagagtcctgcgagaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctccgccacggcgcagaggagattcgccgaggtgatagacgaactgttccgggacggagtgaactggggccgga
ttattgctttcttcgagtttgggggcacggtgtgcgtggagtgcgcttccaacgaggggatgacatcgcaggtggacaac
atcgcagagtggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtatggcagacagagggagtccgtcttcagttgctcctggccctccatcaagacagttttcggcttggctgcac
tcggagcggccagcctcaccatcggagcatatcttacacaaaagtga
>gnl|bcl2dbcds|A0A3Q0S9R1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Amphilophus citrinellus GN=BCL2L10 (length=576 residues).
atggtccctgggctgtggaaagaaaccctgggtttggctgaggactacctgtctctgtgctgcacaagtccacatcaagt
ccctccacctcccagcgagtcagccgctgccatgagacgtctgggccaggatattgagcggcagcaccaggctcgctttg
acaaccttgctcagaccttcctgaggcattgcgggccggatcactgctctagcctcaggaaggtgatggaggagctggtg
ggagacggacacttgaactgggggagggttgtttccctttttgcttttactggggtgctagccagaaagaggctggagca
gaagccagggctggaccctgggcaacagcaggaactgggacaggagcccataagctgcagggagctggcagagaccatag
ctgattacctgggggaagagaagaaagactggctcttggacaatgatggatgggagggtttctgtaagtactcccgcagt
gccagagaggtgagccaggactcttccatgaagaccgcgctgtttgctgctgctggcgtcggcctggccgggcttacttt
ccttttggtgcgctag
>gnl|bcl2dbcds|A0A6G7K5D7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion clarkii GN=BCL2L1 (length=627 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagctacaagctgtctcaaaggaactatccgacgtctctgct
gaggccagaggatgctggaggaaggactgatggggacaaggccaactcagcttccagtaacggcttgctggtgaacagca
gaggcggcatagaggctgtaaaatccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggcttttagt
gacctgtcttcacagcttgacatcacccctgaaacggcctaccacagctttaagagtgtgatggacgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagagaagaatatga
gcgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtctgtggatccaaagccaagga
ggatgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacgaaggtctcgggatactctgaagagatg
gctgctagtcggaggggtgctgctaatgggagttctggctggtgtgctcattgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q1B8C3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaatattgtagaaaagtatatctgccataaactctccaaacggggctacgtgtgggggtt
tgatgatgtccgggatgaagatgctgctaataacgggtcagtagtggaccctccgccgactttggtccgtcggtgccatg
aagccagcaccgggcccgacaacgagagcgacccccacctctgcagacggctcccccagtccgacccgcacgctgccatc
cacagagtcctgcgggaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtccaggcagctgta
tctcacctccaccacggcgcagaggagattcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggggggacggtgtgcgtcgagtgcgcggccaaagaggagatgacatcgcaggtggacaac
atcgcggagtggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactcagtcttcagttgctcctggccctccatcaagacggtcttcggtctggcagcac
tcggggcagcgagcctcaccatcggagcgtaccttacacaaaagtga
>gnl|bcl2dbcds|A0A3Q1BKL8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=MCL-1 (length=846 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccaatgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtcaaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagctaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3Q1BKL8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=MCL-1 (length=915 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccaatgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtcaaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagctaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcagtggtcttgctgctgtaggactaacacagagcactgaaa
actcttgcaaggatgcacacataagttgttgcaga
>gnl|bcl2dbcds|A0A3Q1BQA0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=627 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagcgacaagctgtctcaaaggaactatccgacgtctctgct
gaggccagaggatgctggaggaaggactgatggggacaaggccaactcagcttccagtaatggcttgctggtgaacagca
gaggtggcatagaggctgtaaaatccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggcttttagt
gatctgtcttcacagcttgacatcacccctgaaacggcctaccacagctttaagagtgtgatggacgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagagaagaatatga
gtgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtccgtggatccaaagccaagga
ggatgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacgaaggtctcgggatactctgaagagatg
gctgctagtcggaggggtgctgctaatgggagttctggctggtgtgctcattgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q1D2L0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L10 (length=585 residues).
atgtcctgtgggctatggaaagagaccttggtcctggcagaggactacctgtccctgtgctgtgcaagcccacatcaagc
ccctccacctcccagcgagtcagcggctgccatgaggcgtctggcccaggacatggagaagcagcaccaggctcgcttcc
actccctcactcagaccttcctgaggcagtgcgggccggacctctgctccagcctcaggaaggtgatggaggagctggtg
ggagatggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctggccagacagctgctggagca
gaaggacacaaagctggggctggaccccgggaagcagcaggaactgggacaggggcccgtaaactgcagagaactggcag
agaccatagctgattacctgggagaggagaagaaagactggctgttggagaatgatggatgggaaggcttctgtaaattc
tccctcagtgccagagaggtgagtcaggacttgtccatgaagacagcgctgtttgctgctgcgggtgtcggccttgctgg
gctcaccttcctcctggtgcgctaa
>gnl|bcl2dbcds|A0A3Q1DHJ3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggctgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1DHJ3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggctgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1DHJ3_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggctgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P8RL82_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L10 (length=585 residues).
atgtcctgtgggctatggaaagagaccttggtcctggcagaggactacctgtccctgtgctgtgcaagcccacatcaagc
ccctccacctcccagcgagtcagcggctgccatgaggcgtctggcccaggacatggagaagcagcaccaggctcgcttcc
actccctcactcagaccttcctgaggcagtgcgggccggacctctgctccagcctcaggaaggtgatggaggagctggtg
ggagatggacacttgaactgggggagggttgtttctcttttcacctttactggggtgctggccagacagctgctggagca
gaaggacacaaagccggggctggaccccgggaagcagcaggaactgggacaggggcccgtaaactgcagagaactggcag
agaccatagctgattacctgggagaggagaagaaagactggctgttggagaatgatggatgggaaggcttctgtaaattc
tccctcagtgccagagaggtgagtcaggacttgtccatgaagacagcgctgtttgctgctgcgggtgtcggcctcgctgg
gcttaccttcctcctggtgcgctaa
>gnl|bcl2dbcds|A0A3P8RQX7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion percula GN=MCL-1 (length=846 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccagtgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtccaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagccaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3P8RQX7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion percula GN=MCL-1 (length=846 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccagtgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtccaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagccaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3P8S9L3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Amphiprion percula GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaatattgtagaaaagtatatctgccataaactctccaaacggggctacgtgtgggggtt
tgatgatgtccgggatgaagatgctgctaataacgggtcagtagtggaccctccgccgactttggtccgtcggtgccatg
aagccagcaccgggcccgacaacgagagcgacccccacctctgcagacggctcccccagtccgacccgcacgctgccatc
cacagagtcctgcgggaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtccaggcagctgta
tctcacctccaccacggcgcagaggagattcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggggggacggtgtgcgtcgagtgcgcggccaaagaggagatgacatcgcaggtggacaac
atcgcggagtggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactcagtcttcagttgctcctggccctccatcaagacggtcttcggtctggcagcac
tcggggcagcgagcctcaccatcggagcgtaccttacacaaaagtga
>gnl|bcl2dbcds|A0A3P8TL99_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgtgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggatgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggccgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P8TL99_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgtgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggatgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggccgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P8U812_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L1 (length=627 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagctacaagctgtctcaaaggaactatccgacgtctctgct
gaggccagaggatgctgaaggaaggactgatggggacaaggccaactcagcttccagtaacggcttgctggtgaacagca
gaggtggcatagaggctgtaaaatccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggcttttagt
gatctgtcttcacagcttgacatcacccctgaaacagcctaccacagctttaagagtgtgatggacgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagataagaatatga
gtgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtccgtggatccaaagccaagga
ggatgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacgaaggtctcgggatactctgaagagatg
gctgctagtcggaggggtgctgctaatgggagttctggctggtgtgctcattgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q1GX28_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anabas testudineus GN=MCL-1 (length=852 residues).
atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgagctgcttgatgcttcctcaaaatggagtcgt
agagtacagctcgggagtcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaatgctgctctga
aacgacccaagaacctggacgtgagctcatcgaatggctatgcaacaaaaaacattggggctaacagcgacgacatcgaa
gacggatctttgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagttgtccagcaggggacgaggt
gctggagaacgacacgaggcagctcctaagccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa
ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagatacgcgtacaatggtatgatcaac
aaactctcactggatgacaaagtggacgatgtgagttttatcacggcagtagcccagagccttttctcagatggaaccac
aaactggggtcgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaaggaaaaacacagggagaact
gtgtggatctggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggctggtcaggaacaactcatgg
gatggttttgttgaattctttcgagtggcagaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc
tggtattggggcatcactggccctgttgatcagctcctgtagtgtgatgtga
>gnl|bcl2dbcds|A0A3Q1GX28_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anabas testudineus GN=MCL-1 (length=867 residues).
atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgagctgcttgatgcttcctcaaaatggagtcgt
agagtacagctcgggagtcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaatgctgctctga
aacgacccaagaacctggacgtgagctcatcgaatggctatgcaacaaaaaacattggggctaacagcgacgacatcgaa
gacggatctttgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagttgtccagcaggggacgaggt
gctggagaacgacacgaggcagctcctaagccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa
ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagatacgcgtacaatggtatgatcaac
aaactctcactggatgacaaagtggacgatgtgagttttatcacggcagtagcccagagccttttctcagatggaaccac
aaactggggtcgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaaggaaaaacacagggagaact
gtgtggatctggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggctggtcaggaacaactcatgg
gatggttttgttgaattctttcgagtggcagaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc
tggtattggggcatcactggccctgttgatcagtgctgtccgacttcagcctcttcacctgcattaa
>gnl|bcl2dbcds|A0A3Q1GZ93_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataacatataaactatcccagagaaactatcctctcaaccacttggg
actcaatgagactcccaacaggactgatgggggggaagatgggttgagtgaggaacagcggatagcaacgcacgccaacg
ggacttttaatggtagaagtcccgggacccccccagcgtccccgctgcggcaacaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgatacgctcgagccttcagcgatctgcacaa
ccagctgcatatcacgcctgccacagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacggtgtcaact
ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgtggagaaggagatgagtcagctggtg
ggaaggatcgtagagtggatgacagtctacctggacaaccacattcagccctggatccaaagccaaggaggatgggagcg
ctttgctgagctcttcggccacgacgcagcagcagagggcaggcggtctcaggagagtttcaagaagtggctgctggcag
gcatgaccctggtgactggggtcgtggtggggtcactcatagcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1IAB0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L10 (length=732 residues).
atgttccaactctcatggggactttttcttctggaggcggagtcagcggataaatgtgcggacgctgaggggaaactgcg
agtgcaccgaggatctccttccgccgtccgtatgtgcagagagcagactgatatcgctgggaggaaaatgtcgtgtgggc
tgtggaaagacaccctggctctggcagaggactacctgtccctgtgctgcaccagcccttggccagcccctccacctccc
agcgagtcagccgctgccatgagacgtctggcccaggacatggagaagcagcatcaggttcgcttccactccctagctca
gactttcctgaagcagtgcgggccggacccctgctccagcctcaggaaggtgatggaggagctggtgggagatggacaca
tgaactgggggagggttgtttcccttttcaccttcactggggtgctggccagacagatgctggagcagaaggacaagaag
ccggggctggaccttgggaaggggcaggaactaggacaggagcctggacaatgtaggggactggcagagaccatagctga
ttacctgggagaagagaagaaagactggctgctggagaatgatggatgggaggggttctgtaagttctcctgcagtgcca
gagaagtgagccaggactcctccatgaagagagcgctgtttgctgctgctggtgtgggtcttgcgggactcaccttcctc
ctggtgcgctag
>gnl|bcl2dbcds|A0A3Q1JZ46_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=660 residues).
atggaagaaatgtcgaacagtaacagagagctggtggagttcttcataatgtacaaactgtctcaaagaaaccacccagc
ctctcttctgaggccagatgataccggtggagtgggagacagacccaactcagcagctgctaacggcctgccggtcagca
ggagtggcgagctggggaactcgtcacctccgtgtaagagcatggaggccgtaaaaacagctcttagggactctgctgac
gagtttgaactgctcttcacacaagcgtttagtgacctttcctcgcagcttgatgtcacgcccgacacggcctatcaaag
ctttaagagtgtgatggacgagttgttcaaggatggagtcaactggggacgtatagtggggctgtttgccttcggtggcg
tgctgtgtgtggaatgtgtggagaagaatatgagtgagctggtatcccgaatcgcagactggatgaccatgtacctggat
gagcacatcagtccttggatccagagccagggaggatgggactgctttgctgagatatttgggcaagatgccgctgctga
ggcgaggagatctcgggaggctctgagaagatggctgctagttggagtggtgctgctcacgggagtgctgttaggtgtgc
tcattgctaagaaacggtga
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaatattgtagaaaagtatatctgccataaactctccaaacggggctacgcgtgggggtt
tcatgatgcccaagacgaagatgctgctaataatgggtctgcagttccccctccaccgactttggtccggcggtgccgtg
aagccagcaccgggcctgacagcgacagcatcccgcaacactgcagacggctccctccgtccgacccgcacgctgcgctc
cacagggtcctgcgtgaggctggagatgaacttgaaagactatatcagccggacttcacggagatgtcccgacagctgta
tctcacctccaccacggcgcagcggagattcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggcggcaccgtgtgcgtggagtgcgcgtccaaggaggagatgacaccgcaggtgaacaac
atcgcagagtggatgacggagtatttaaatggacctcttcacagctggatacaagataacgggggatgggatgccttcgt
ggacctgtatgacagacagagggagtctgtgttcagttgctcctggtcctccatcaagacggtcttcggcctcgctgctc
tcggggcagccagcctcaccattggagcttaccttgcacagaaatga
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=1017 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtgg
aggtggattgttttaaaaaactgatggaagtgaactacctgggcagcgtttacccaacacgggccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgtttgtgtcctcccaagcaggacaggttggcctgtttggatacactgcctactc
cccatccaagtttgccctgcgtggtttagcagagtcactgcagatggagataaagccctacaatatatatgtgacagtgg
cctacccccccgacactgacactccaggtttggctgaggaaaataagacaaagcctctggagaccaaattaatctctgaa
acatctggagtctgtcaaccagaccaagtggccaaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagt
gggacctgatggttacatgctctctgccctcacctgtggaatgtcacccgttacctccattacagagggtctccagcagg
atgccttcgtggacctgtatgacagacagagggagtctgtgttcagttgctcctggtcctccatcaagacggtcttcggc
ctcgctgctctcggggcagccagcctcaccattggagcttaccttgcacagaaatga
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=1302 residues).
atgcagactgctttgtcacggggagaaagggttcaacacggtactttaatccgactgttgcacatctttgactctctgcc
aaaccagcgaacaactcctcctccgacgtccgtgtttcgccaccccctttcagggccatcgccagcctcgtatctcggtt
atcgaacccctgaagctggcctgctagttagcagacgagctaacgattgtcagatttcacccatgtcctctgaagaaggg
ttgagctcaacgatcacagattggcttttcatcaactcctggtggctccttctgccattcattatgcttcttgtaattgc
tgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacctctgaaactgaacgggg
cccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctacagacaaggagcattcatc
actttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgccatcaatgacaaacaggt
ggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaacaggctcaagagaagctgg
gacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtggaggtggattgttttaaa
aaactgatggaagtgaactacctgggcagcgtttacccaacacgggccgtcataaccaccatgaaggagcgaagaatggg
ccgcatcatgtttgtgtcctcccaagcaggacaggttggcctgtttggatacactgcctactccccatccaagtttgccc
tgcgtggtttagcagagtcactgcagatggagataaagccctacaatatatatgtgacagtggcctacccccccgacact
gacactccaggtttggctgaggaaaataagacaaagcctctggagaccaaattaatctctgaaacatctggagtctgtca
accagaccaagtggccaaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagtgggacctgatggttaca
tgctctctgccctcacctgtggaatgtcacccgttacctccattacagagggtctccagcagataattaccatgggatta
tttcgaaccattgccctgttctacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaa
agcagctgacaagagagagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=954 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
gcactttactccagattccactattgcaaaatgttggccttattttcaccagaaactgatggaagtgaactacctgggca
gcgtttacccaacacgggccgtcataaccaccatgaaggagcgaagaatgggccgcatcatgtttgtgtcctcccaagca
ggacaggttggcctgtttggatacactgcctactccccatccaagtttgccctgcgtggtttagcagagtcactgcagat
ggagataaagccctacaatatatatgtgacagtggcctacccccccgacactgacactccaggtttggctgaggaaaata
agacaaagcctctggagaccaaattaatctctgaaacatctggagtctgtcaaccagaccaagtggccaaaatcattgtg
cgagatgcagtgcaggggaacttcaatagctcagtgggacctgatggttacatgctctctgccctcacctgtggaatgtc
acccgttacctccattacagagggtctccagcagataattaccatgggattatttcgaaccattgccctgttctacttgg
ggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctgacaagagagagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=894 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtgg
aggtggattgttttaaaaaactgatggaagtgaactacctgggcagcgtttacccaacacgggccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgtttgtgtcctcccaagcaggacaggttggcctgtttggatacactgcctactc
cccatccaagtttgccctgcgtggtttagcagagtcactgcagatggagataaagccctacaatatatatgtgacagtgg
cctacccccccgacactgacactccaggtttggctgaggaaaataagacaaagcctctggagaccaaattaatctctgaa
acatctggagtctgtcaaccagaccaagtggccaaaatcattgtgcgagatgcaataattaccatgggattatttcgaac
cattgccctgttctacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctg
acaagagagagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=807 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtgg
aggtggattgttttaaaataaagccctacaatatatatgtgacagtggcctacccccccgacactgacactccaggtttg
gctgaggaaaataagacaaagcctctggagaccaaattaatctctgaaacatctggagtctgtcaaccagaccaagtggc
caaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagtgggacctgatggttacatgctctctgccctca
cctgtggaatgtcacccgttacctccattacagagggtctccagcagataattaccatgggattatttcgaaccattgcc
ctgttctacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctgacaagag
agagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-07 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=561 residues).
atgtcctctgaagaagggttgagctcaacgatcacagattggcttttcatcaactcctggtggctccttctgccattcat
tatgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctac
agacaaggagcattcatcactttagtggcacgaaatgaggtggtgctttgcatatcagtggatgtttccagtgattatag
tcaggtggaaagtgtgataaaacaggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaa
tgtctggaaagtttgaggaggtggaggtggattgttttaaaataattaccatgggattatttcgaaccattgccctgttc
tacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctgacaagagagagta
a
>gnl|bcl2dbcds|A0A493SSZ7_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=BCL2A1 (length=519 residues).
atggaaactgctgagttctattacgtttattatttagctcaagattatctgcaatatgtgcttcaggaatcacatcttgg
accagcgcaaaccagagttgctcatgtcttgcgaaacattgcatcttcgctgcaagatcaaacagaggaggctctcagac
ccttcctggacaggattgatatcagttctgtagatgttgccaagagaattttcaatggtgtcatggatgaaaaatttgct
gatggaaatactaattggggaagaattacgaccatatttacttttgggggtcttctcactaagaagcttcaagaacatgg
agttcagctcactggagagaagaaggagcagatctcttatttcatcacagagtacatcataaacaataaagccgaatgga
tagatgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gacttattcgtggctgttttttccttgttcagagagtag
>gnl|bcl2dbcds|A0A493T1X3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=BCL-2 (length=720 residues).
atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgctgctgctg
ggactccctcccgccaccgccccgccgggctgctgtccccgcaccccgagccccccggctcggctgctgctagcgaggcg
cccccgggcgaggggctgcgccccgcgccccccgtggtccacctcgccctgcgccaggccggggacgagttctcccgtcg
ctaccagcgggacttcgcccagatgtccggccagctgcacctgacgcccttcacggccagaggccgcttcgtggccgtgg
tggaggagctcttccgagacggggtgaactggggccggatcgtggccttcttcgagttcggcggcgtcatgtgcgtggag
agcgtcaaccgggagatgtctcccctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtttggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A493TIA6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=BCL2L1 (length=717 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagccggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagctcgttcaatcagccgccgtc
cggcaggctctgcgcgaagccggggacgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctacctgagcgaccacctcgacccctggatccaggagaacggcggatgggtaagggggtgctc
cttctgcactcctctgggggatctgggctggatctggccccttagtgctctgcagataaccccccccccccgcccccccc
ccccccgcacccccccccgccccctccccctccctccctctctccctccctccctccctccaggcctgggcttttaa
>gnl|bcl2dbcds|A0A493U0E8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=MCL-1 (length=978 residues).
ggagggtgggggacggagtcctggagaaacacgagctggccttccaagggaccggcgagatctgaccatttggggtcagt
tttgtggaaatcggaggcgagctctcagggaccagcaagaattgaccattttgggtcagttccatggaattcagaggcga
gtccccggggagtggtgggaactgcccattttgggtcagttttgtggaactcggaagcgagcccctggggatggggcgga
accgaccattttggggctgttttcccagaacccagcagcgggattttttccagaccagcacgtaccaaccctttgggatc
agctccacggggacgggggggagatttgaccattttgggctggtttcacccaactcagaagcgagctcccgagccagctg
ggcggcgagacgccgcccctcccgcagcaggatgttgcacttttaaaaaatgcaaaaggtttcgagccggcccccacccc
ttccctcatcaccctgctgggcgagatttttggggtttcaccacccccggccaaatttttggggtgctggcaaggaaacc
acactcgggggagcaggggggggtcaccgttgaggatttgggacgttcccttggaatgcttcggaagctggaaatcaaga
aggaggaggacctgcaggccgtgggtgaggtggcggcccacctcttcagcgacggggtgaccaactgggggcgcgtcgtc
accctcatctccttcggcgccttcgtcgcccggcacctgaaaagcgtaaagcaggagaaaagcatcggctccctggccag
gatcatcaccgacgccctcgtctcgtccaaacgcgagtggctcgtgagccagggaggctgggagggtttcgtcgactttt
tccgagtggaagacctggaaggcagcatcaggaacgtgctgatggcgttcgcaggagtggctggactgggagcgagcttg
gcctacatgatccggtga
>gnl|bcl2dbcds|A0A8B9SFH3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL-2 (length=720 residues).
atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgctgctgctg
ggactccctcccgccaccgccccgccgggctgctgtccccgcaccccgagccccccggctcggctgctgctagcgaggcg
cccccgggcgaggggctgcgccccgcgccccccgtggtccacctcgccctgcgccaggccggggatgaattctcccgtcg
ctaccagcgggacttcgcccagatgtccggccagctgcacctgacgcccttcacggccagaggccgcttcgtggccgtgg
tggaggagctcttccgagacggggtgaactggggccggatcgtggccttcttcgagttcggcggcgtcatgtgcgtggag
agtgtcaaccgggagatgtctcccctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtttggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8B9SM69_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL2L1 (length=684 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagccggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagctcgttcaatcggccgccgtc
cggcaggctctgcgcgaagccggggacgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctacctgagcgaccacctcgacccctggatccaggagaacggcggatgggagcggtttgtgga
cctctacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggctcctgaccggggccacgg
tggccggagtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9SWV2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anas platyrhynchos GN=MCL-1 (length=549 residues).
atgttcgccctgccgcgcaacgccctcatcggcttcaacctctactgcggcggcggcaccgggcccggagggggcggcgg
aggcggagggggcccggcctcaccgggggggaccccgaaagcgctggaaacgttgaggagggtgggggacggagtcctgg
agaaacacgagctggccttccaaggaatgcttcggaagctggaaatcaagaaggaggaggacctgcaggccgtgggtgag
gtggcggcccacctcttcagcgacggggtgaccaactgggggcgcgtcgtcaccctcatctccttcggcgccttcgtcgc
ccggcacctgaaaagcgtaaagcaggagaaaagcatcggctccctggccaggatcatcaccgacgccctcgtctcgtcca
aacgcgagtggctcgtgagccagggaggctgggagggtttcgtcgactttttccgagtggaagacctggaaggcagcatc
aggaacgtgctgatggcgttcgcaggagtggctggactgggagcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A8B9UYC3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL-2 (length=1044 residues).
atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgctgctgctg
ggactccctcccgccaccgccccgccgggctgctgtccccgcaccctgagccccccggctcggctgctgctagcgaggcg
cccccgggcgaggggctgcgccccgcgccccccgtggtccacctcgccctgcgccaggccggggacgagttctcccgtcg
ctaccagcgggacttcgcccagatgtccggccagctgcacctgacgcccttcacggccagaggccgcttcgtggccgtgg
tggaggagctcttccgagacggggtgaactggggccgcatcgtggccttcttcgagttcggcggcgtcatgtgcgtggag
agcgtcaaccgggagatgtctcccctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggtacgtgccccgtgctttgctttcctgctccgatggcccgtggctggggtggctc
tggggctcacgggtgtccacgtgtgctcacctcggtgcgagcctcgggatgtgaggtttgcctgctgcatctttgcaccg
gtgtgggccttctgctggctcctctgctgtcgggtgtcacctcatggtggggctgcagtgaaacaatgttggtttttaag
tgggggggagcagctgcagctccctcctcaggtgctgaaaggccaagcaaggtgccctctccatcggagggctccgcttt
cccatccccttcacccaccggtggcatcagccctggccaaggcttgttccagcacagcatgggaaggggttacagagtct
ggggatgggtacagggggtggcaggtcctggatgtggacatccctgcatgttggggtgacgcgtgtgtggggacacggtg
ctag
>gnl|bcl2dbcds|A0A8B9UZT1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL2A1 (length=519 residues).
atggaaactgctgagttctattacgtttattatttagctcaagattatctgcaatatgtgcttcaggaatcacatcttgg
accagcgcaaaccagagttgctcatgtcttgcgaaacattgcatcttcgctgcaagatcaaacagaggaggctctcagac
ccttcctggacaggattgatatcagttctgtagatgttgccaagagaattttcaatggtgtcatggatgaaaaatttgct
gatggaaatactaattggggaagaattacgaccatatttacttttgggggtcttctcactaagaagcttcaagaacatgg
agttcagctcactggagagaagaaggagcagatctcttatttcatcacagagtacatcataaacaacaaagccgaatgga
tagatgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gacttattcgtggctgttttttccttgttcagagagtag
>gnl|bcl2dbcds|A0A8B9V5I0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL2L1 (length=684 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagccggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagctcgttcaatcggccgccgtc
cggcaggctctgcgcgaagccggggacgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctacctgagcgaccacctcgacccctggatccaggagaacggcggatgggagcggtttgtgga
cctctacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggctcctgaccggggccacgg
tggctggagtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9VGG9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anas zonorhyncha GN=MCL-1 (length=822 residues).
ggagggtgggggacggagtcctggagaaacacgagctggccttccaagggaccggcgagatctgaccatttggggtcagt
tttgtggaaatcggaggcgagctctcagggaccagcaagaattgaccattttgggtcagttccatggaattcagaggcga
gtccccggggagtggtgggaactgcccattttgggtcagttttgtggaactcggaagcgagcccctggggatggggcgga
accgaccattttggggctgttttcccagaacccagcagcgggatttctttcagaccagcacgtaccaaccctttgggatc
agctccgtggggacgggggggagatttgaccattttgggctggtttcacccaactcagaagcgagctcctgagccagctg
gcggcgagacgccgcccctcccgcagcaggatgttgcacttttaaaaaatgcaaaaggaatgcttcggaagctggaaatc
aagaaggaggaggacctgcaggccgtgggtgaggtggctgcccacctcttcagcgacggggtgaccaactgggggcgcgt
cgtcaccctcatctccttcggcgccttcgtcgcccggcacctgaaaagcgtcaagcaggagaaaagcatcggctccctgg
ccaggatcatcaccgacgccctcgtctcgtccaaacgcgagtggctcgtgagccagggaggctgggagggtttcgtcgac
tttttccgagtggaagacctggaaggcagcatcaggaacgtgctgatggcgttcgcaggagtggcgggactgggagcgag
cttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A803T0A4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anolis carolinensis GN=MCL-1 (length=1068 residues).
atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaacacgccggcctcacctggagc
cggcggaggcgtcggagaaagtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcctcaggtcttt
tctcagagaggccgcgccctctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgcccggcctccctgccgctgcc
tgaaggggagctcgacggctgcgaggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccctcgccggaca
aagagatggcggaggaggaaggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccgggcccaagttctccttccaagg
cttgctggggcgcttcgggagcagccccaacgaggcggaggtggcgcgcgcgctggagacgctgcgccgggtgggcgaga
gcctccgggagaagcacctgctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtgactctcatctcttttggtgc
ctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaacactttaatagaaattatcactgatgtgctgg
tgacggacaagagagaatggctattgaaacataatgcctggcaacgtgctcggctcggcagcgccactctgcggatccac
ctcgaagcagtcactctcgttttcctcaattttcaagtccaggctgttttcgtccgccatggcttccttggatctgagag
aggaaagcagcagcacaactgtgtctga
>gnl|bcl2dbcds|A0A803T0A4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anolis carolinensis GN=MCL-1 (length=1068 residues).
atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaacacgccggcctcacctggagc
cggcggaggcgtcggagaaagtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcctcaggtcttt
tctcagagaggccgcgccctctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgcccggcctccctgccgctgcc
tgaaggggagctcgacggctgcgaggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccctcgccggaca
aagagatggcggaggaggaaggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccgggcccaagttctccttccaagg
cttgctggggcgcttcgggagcagccccaacgaggcggaggtggcgcgcgcgctggagacgctgcgccgggtgggcgaga
gcctccgggagaagcacctgctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtgactctcatctcttttggtgc
ctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaacactttaatagaaattatcactgatgtgctgg
tgacggacaagagagaatggctattgaaacataatgcctggcaacgtgctcggctcggcagcgccactctgcggatccac
ctcgaagcagtcactctcgttttcctcaattttcaagtccaggctgttttcgtccgccatggcttccttggatctgagag
aggaaagcagcagcacacctgtccgtga
>gnl|bcl2dbcds|A0A803T0A4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anolis carolinensis GN=MCL-1 (length=1038 residues).
atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaacacgccggcctcacctggagc
cggcggaggcgtcggagaaagtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcctcaggtcttt
tctcagagaggccgcgccctctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgcccggcctccctgccgctgcc
tgaaggggagctcgacggctgcgaggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccctcgccggaca
aagagatggcggaggaggaaggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccgggcccaagttctccttccaagg
cttgctggggcgcttcgggagcagccccaacgaggcggaggtggcgcgcgcgctggagacgctgcgccgggtgggcgaga
gcctccgggagaagcacctgctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtgactctcatctcttttggtgc
ctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaacactttaatagaaattatcactgatgtgctgg
tgacggacaagagagaatggctattgaaacataatgcctgggagggatttgttcagttcttccatgtagaggacatagaa
ggtggcatcaggaatgttctggtggcttttgccagtgtggctggaataggggcaggcttggcctacatgatccggtga
>gnl|bcl2dbcds|H9GHK7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anolis carolinensis GN=BCL2L1 (length=690 residues).
atgtcgagcagtaaccgagcgctcgtggtggacttcctttcctacaagctgtcgcagcggggccacagctggcatgagat
tgagatggagagcggggaggaagcgatggagccagcaaacgagacggggaacaccctcaatgggagcccttcttggcatc
ccagccccagccatgtcatcaatggggcctcagaacaccccgaactccttgaagaggaggaggaagaaaacccgagggtg
gatgtcagccagacacttagggaggctggcgatgagtttgaactaaggtaccggcgggcttttagtgacctgacctccca
gctccacatcaccttgggcacggcataccagagcttcgagcaggtggtgaatgaactcttccacgatggggtaaactggg
ggcggatagtggcattcttctcctttgggggagccctgtgcgtggagagcgttgacaaagagatgcaagggttggtggtg
aggattgccagctggatgaccacgtacctgactgaacacctggacccctggatccaagaaaacggtggctgggagcgatt
tgtggacgtctacgggaacgatgcggccgccaaaagcaggaagggccaggaacgcttcaacaagtggctctggacagggg
ccaccgtggccggtgtggtgctcctgggctccctcctgagccgcaagtag
>gnl|bcl2dbcds|H9GPE7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anolis carolinensis GN=BCL-2 (length=738 residues).
atggctcatcctgggataagaggttacgacaacagggaaatcgtgctgaggtacatccattacaagctgtcgcagaaagg
atatgactgggttgccagtggagacagaggaaaccttgctgctgctgctgctgctgctgctgctactcctagtgctccaa
ctgtgtcagcatctctttccccagagcttctcaattctgatcctgtgagtaccaatgcccccagggaagaacctgacccg
gtgccacaggttgtccatacaacattacgccaagccggagatgagttctcccgacgctatcggagggactttgctcaaat
gtctggccagctgcatttgacccccagcactgccagaagtcgttttgtggccgtggtggaagagctcttccaggacggtg
tgaactgggggaggattgtggcgttctttgaatttggtggcatgctgtgcgtggagagtgtcagccgggagatgtccccc
cttgtggacaatattgctacgtggatgactgagtatctgaaccagtacctgcgcaactggatccaggagaacggaggctg
ggtatgtggctcattgtctttgtctttttctgtttcaaggtcatacatcactgaaacatccattccggtgtcacaaatgg
cttgtgtgaccagtggttcccagtgcggtgtcacttgtaaagttgttccaagggcattttgcttattccgaacaaaaggt
gacaaccagttattatag
>gnl|bcl2dbcds|A0A8B9BNC2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anser brachyrhynchus GN=MCL-1 (length=996 residues).
atgaaaataaggggggggaaaaaaaaaagaggcaagataggggaaaaatgcaaagcccccgtgcggggtggggacggggg
gggcacagctccgccaccgcgacttcccccagcgcggggggaggaagcgaccgtgacgacagagggtgagaagcagcaag
agcagctccgggacgcgactgcggcgtggagcggggtcacgtacccctgtgggggtgcccaggggctttttttttggggg
gggggctccgatggggttgctttgaggcaggaggggctgaggcagctgagctgcgtgccggagggggcgggtgaaaaccc
gggggggcttcaggttggccgagcaacgtttgcccgttgttcatccccttcctttgtggggggggggtctgaagcacccc
cgtacccccccatagggtgctgggggccattagggacccgcggacccatccccttgtgccgagccgcgccagcaccacaa
catttctcagctgagcagcccggggggcttcctcctcctctgtccccaccggcgggtggtgacggggggaagagctggaa
tttatttacttatttatttttgcctggggttttgctccgtgcgcctgtctctgagccagcgtctcttgcaggaatgcttc
gcaagctagaaatcaagaaggaggaagacctgcagtcggtgggcgaggtggcggcccacgtcttcagcgacggagtgacg
aactgggggcgagtcgtcacactcatctccttcggtgcctttgtcgccaagcacctgaagagcataaagcaggagaagtg
catcggctccttggccaggatcatcacagacgcgctcgtctcgtccaagcgcgagtggctgctgagccagggaggctggg
agggcttcgtcgacttcttccgagtggaagacctagaaggcagcatcaggaacgtgctgatggcgttcgcgggggtggca
ggactgggagcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A8B9C4H4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anser brachyrhynchus GN=BCL-2 (length=720 residues).
atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgctgctgctg
ggactccctcccgccaccgccctgccgggctgctgtccccgcaccccgagccccccggctcggctgctgctagcgaggcg
cccccgggcgaggggctgcgccccgcgccccccgtggtccaccttgccctgcgccaggccggggacgagttctcccgccg
ctaccagcgggacttcgcccagatgtccggccagctgcacctgacgcctttcacggccagaggccgcttcgtggccgtgg
tggaggagctcttccgagacggggtgaactggggccggatcgtggccttcttcgagttcggcggcgtgatgtgcgtcgag
agcgtcaaccgggagatgtctcccctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtttggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8B9CUX0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anser brachyrhynchus GN=BCL2L1 (length=693 residues).
atgtccggcagcaaccgggacctggtgattgactttgtttcctacaagctgtcgcagaagggctacagctggagccagct
ggaggaggaggaggatgagaacaggactgacttcgcggcggaggccgacacggacggggtgctcaacgggagcccgtcct
ggcacccgcccgccagccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgaaatcgttcggtcg
gccgccgtgaggcaggcgctgcgagaagccggggacgagttcgagctgcggtaccgccgggccttcagcgacctcacctc
ccagctccacatcacccccggcacggcgtaccagagcttcgagcaggtggtgaacgaactcttccgcgacggagtgaact
gggggcgcgtcgtggctttcttctccttcggaggggcgctgtgcgtggagagcgtcgacaaggagatgcgggtactggtg
gggcgcatcgtggcgtggatgaccacgtacttgaccgaccatctagacccctggatccaggagaacggcggatgggagcg
gtttgtggacctctacgggaacgacgctgctgcggaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9CVY0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Anser brachyrhynchus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattatttagctcaagattatctgcagtatgtgcttcaggaatcacatctcgg
accagcccaaaccagagttgctcatgtcttgcgaaacattgcatcttcgctgcaagatcaaacagaggaggctctcagac
ccttcctggacaggattgatattacttctgtagatgttgccaagagaattttcaatggtgtcatggatgagaaatttgct
gatggaaatactaattggggaagaattatgaccatatttacttttgggggtcttctcactaagaagcttcaagaacatgg
agttcagctcactggagaggagaaggagcagatctcttatttcattacagagtacatcataaacaacaaagccgaatgga
tagatgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gacatattcgtagctcttttttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8B9DB39_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anser cygnoid GN=BCL2L1 (length=693 residues).
atgtccggcagcaaccgggacctggtgattgactttgtttcctacaagctgtcgcagaagggctacagctggagccagct
ggaggaggaggaggatgagaacaggactgacttcgcggcggaggccgacacggacggggtgctcaacgggagcccgtcct
ggcacccgcccgccagccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgaaatcgttcggtcg
gccgccgtgaggcaggcgctgcgagaagccggggacgagttcgagctgcggtaccgccgggccttcagcgacctcacctc
ccagctccacatcacccccggcacggcgtaccagagcttcgagcaggtggtgaacgaactcttccgcgacggagtgaact
gggggcgcgtcgtggctttcttctccttcggaggggcgctgtgcgtggagagcgtcgacaaggagatgcgggtactggtg
gggcgcatcgtggcgtggatgaccacgtacttgaccgaccatctagacccctggatccaggagaacggcggatgggagcg
gtttgtggacctctacgggaacgacgctgctgcggaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9E009_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Anser cygnoid GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattatttagctcaagattatctgcagtatgtgcttcaggaatcacatctcgg
accagcccaaaccagagttgctcatgtcttgcgaaacattgcatcttcgctgcaagatcaaacagaggaggctctcagac
ccttcctggacaggattgatattacttctgtagatgttgccaagagaattttcaatggtgtcatggatgagaaatttgct
gatggaaatactaattggggaagaattatgaccatatttacttttgggggtcttctcactaagaagcttcaagaacatgg
agttcagctcactggagaggagaaggagcagatctcttatttcattacagagtacatcataaacaacaaagccgaatgga
tagatgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gacatattcgtagctcttttttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8B9E2U6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anser cygnoid GN=BCL-2 (length=1080 residues).
atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgctgctgctg
ggactccctcccgccaccgccctgccgggctgctgtccccgcaccccgagccccccggctcggctgctgctagcgaggcg
cccccgggcgaggggctgcgccccgcgccccccgtggtccaccttgccctgcgccaggccggggacgagttctcccgccg
ctaccagcgggacttcgcccagatgtccggccagctgcacctgacgcctttcacggccagaggccgcttcgtggccgtgg
tggaggagctcttccgagacggggtgaactggggccggatcgtggccttcttcgagttcggcggcgtgatgtgcgtcgag
agcgtcaaccgggagatgtctcccctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggtacgtgccctgcgctttgctttcctcctccgatggcccacggctttgggggctc
tggggtgtctctggggctcacgggtgcccacgtgtgctcacctcagtgtgagcgtcgggacgcgaggtttgcctgctgcg
tcttttgtaccggtgtgggccttctgccggctcctctgctgtcgggtgtcacctgatggtggggctgcagtgaaatggtg
ttgtttttttttgtggaggggggcagctgcagctccctcgtcaggtgccgaaaggccaagcaaggtgtcctttccatcgg
agagctctgctttcccatcaccttcgcccactggtggcatcagccctggccaaggcttgttccagcgcagcatgggaagg
ggttgcagaggctggggatgggcacagggggtggcaggtcctggatgtggggaccatgtggacatccctgcatgttgggg
tggtgcaccgggcacggcgagtgtggggacatggtgctag
>gnl|bcl2dbcds|A0A8B9EU67_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anser cygnoid GN=MCL-1 (length=570 residues).
gctcttcggtcccgccgccccccgctcgccgccgttgtggagccccgaggaggagctggacggttgcgaacccgaaaccg
agaggggacccgggggggactcgatgcccgggacccccccggagctgcccgccgacgaaaagcgctggaaacgctgcgga
gggtcggggacggagtcctggagaaacacgagctggccttccaaggaatgcttcgcaagctagaaatcaagaaggaggaa
gacctgcagtcggtgggcgaggtggcagcccacgtcttcagcgacggagtgacgaactgggggcgagtcgtcacgctcat
ctccttcggtgcctttgtcgccaagcacctgaagagcataaagcaggagaagtgcatcggctccttggccaggatcatca
cggacgcgctcgtctcgtccaagcgcgagtggctgctgagccagggaggctgggagggctttgtcgacttcttccgagtg
gaagacctagaaggcagcatcaggaacgtgctgatggcgttcgcgggggtggcaggactgggagcgagcttggcctacat
gatccggtga
>gnl|bcl2dbcds|A0A2K5C7L5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=717 residues).
atgtttggcctccaaagaaacgcgctaatcggactcaacctctactgtgagtgggccggcttggggactggcagtggcgg
caccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgtggtgattggcggaagcgccggcgctagcccctcggccgccctcacgcctgacgcccgggggtcgtgcggccgctgc
tggttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcatgtcgcccga
agaagagctggacaggtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggtggaggagc
ctggtaatgactccagtacggatgggtcactaccctcgacgccgccgacatcactggagattatctctcggtaccttcgg
gaacaggcgactggcgccaaggacacaaagccaatggacaggtccggggccgccagcaggaaggctctggagaccttacg
acgggttggggacggcgtgcagcgcaaccacgagacggccttccaagttcttccatgtagaagacctagaaggtggcatc
agaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatagccttgtaa
>gnl|bcl2dbcds|A0A2K5CFB8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=1059 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcact
gtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5CFB8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=600 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcactgtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5CFB8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=789 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
>gnl|bcl2dbcds|A0A2K5CWY6_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L2 (length=615 residues).
catctttcatccttgcctcttatagccgcccggatggcgaccccagcctcggccccagacacacgggctctggtggcaga
ctttgtaggttataagctgaggcagaagggttatgtctgtggagctggccccggggagggcccagcagctgacccgctgc
accaagcaatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatctggcggctcagctgcat
gtgaccccaggctcagcccaacaacgcttcacccaggtctccgatgaacttttccaagggggccctaactggggccgcct
tgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgc
aggagtggatggtggcctacctggagacgcggctggccgactggatccacagcagtgggggctgggcggagttcacagct
ctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacagg
ggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K5CWY6_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L2 (length=651 residues).
atgccccttctggttctctgtccatatattcatgccagtctttcatccttgcctcttatagccgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
tgaacttttccaagggggccctaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggccgactgg
atccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcggga
ggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtaggggccttttttg
ctagcaagtga
>gnl|bcl2dbcds|A0A2K5CWY6_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaacttttccaagggggccctaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaagaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggttgactttaaggctttcatttattcatctctgactcaggtgatcccgaaacgaaccaacagaccaggca
tcagcacaacagaccggggttttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
>gnl|bcl2dbcds|A0A2K5CWY6_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L2 (length=837 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcctgaagaggagccgggattggtcgagggtgac
ccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaa
gctaaaagaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatcatgt
ccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagctg
gaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaagggtt
tgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaaggcaaa
tcaaggtgatcccgaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgca
cggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctacagggg
ccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5D2I1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatattcacaatctaactcaggactatctgcggtacgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagggtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagc
catgcttggacaatgttaatattgtgtccatagataatgccagaatgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagtcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgcgaaatgctatctctcttgaagcaatactattga
>gnl|bcl2dbcds|A0A2K5D2I1_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatattcacaatctaactcaggactatctgcggtacgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagggtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagc
catgcttggacaatgttaatattgtgtccatagataatgccagaatgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagtcaaaacggaggctgggcgaaatggcacagtctcctgcttgtgctggtggagtcagtggcccagaaggagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K5DMS4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=492 residues).
atgtttggcttccaagtggtaatcagactcaacctctactgcggtgccatccctccaggaccgcggcttttggcgactgg
cgccaaggacacaaagccaatgggcaggtctgaggccgccaacagtaaggcgctggagaccttacgaggggttggggaag
gcgtgccccgcaaccacgagatggccttacaaggcatgcttcggaatctggacaacaaaaacgaagacaatgtcaaatct
ttctacggcgtaacaaactggggtaggattgtgactctcagttcttttggtgcctttgtggccaaacacttgaagaccat
aaaccaagaaagttgcatcgaaccattagcagaaagtatcagatattctcgctgggatgggtttgtggagttcttccgtg
tagaggacttagaaggtggcatcagaaatgggctgctggctttcgcaggtgttgctggagtaggaactgatttggcatat
ctaataagatag
>gnl|bcl2dbcds|A0A2K5EB04_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgagagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcacccccaggggccgcccccgcgccgggcatcttctcctcccagcctg
gacacacgcccggtcccgccgcgccccgggacccggtctccaggacctcgccgccgccgcccccggccgcccccgccgcc
gccgccacggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggggacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgcgctgtggatgaccgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagcttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5EPX0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=405 residues).
aatgcctcatgttccagacctgcatgcttttcttccccaggcatgcttcgaaaactggacatcaaaaacaaagacgatgt
caaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttctt
ttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagac
gttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataa
gatag
>gnl|bcl2dbcds|A0A2K5EPX0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=399 residues).
agccagagttataataacttaaagataaccacatgcatgcttcgaaaactggacatcaaaaacaaagacgatgtcaaatc
tttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttcttttggtg
cctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagacgttctc
gtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctaga
aggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5F974_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L10 (length=642 residues).
atggctgacccgctgcggcagcgcaccgagcggctggtggcggactacctggagtactgctcccaggagcctggcacccc
cgagtcgccgccgtccacggccgaggccgctgtgctgcgcgccatggccgccggtgtacggaaactctaccggtccttct
tctccgcctacctcggctacccggggaaccgcgtcgagctggtggcgaggatggcggaggccctgctctccgacagtccc
ggccccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtcgcggctgaaggagccggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcatgcggagggggaca
cgggcctcccgagtagctgggaatataggatggcttttgttacttcttcaggacctcctcctcgctggcattatggagaa
aactgctggtccaggttttcctgtcatggttgttaacagcagcattcatctacttctggacacgataattaggagttttt
aa
>gnl|bcl2dbcds|E2IV75_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aotus vociferans GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A8B9NWH6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Apteryx owenii GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggctgggatggccggtgtccttaatgggagcccatcctggc
acccccctgctagccacatagtgaacggagccgctgtgcacaggagcagcctcgaagtccatgaaattgttcaagcagct
gacgtgaggcaggcactgagagaggcgggagatgaatttgagttgaggtaccggagagctttcagtgacctcacttccca
gctccacatcacccctggcactgcgtatcagagctttgagcaggtggtgaacgaactcttccgggacggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgcgtggagagcgttgacaaggagatgcgggtattggttgga
cgcgttgtatcttggatgaccacgtacttgaccgaccatctagacccctggatccaagagaatggcggatgggagcggtt
tgtggacctctacgggaatgatgctgctgccgagatgaggaagggccaggagaccttcaacaaatggctcctgactgggg
cgaccgtggcaggagtgcttctcctgggatctctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9NWH6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Apteryx owenii GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggctgggatggccggtgtccttaatgggagcccatcctggc
acccccctgctagccacatagtgaacggagccgctgtgcacaggagcagcctcgaagtccatgaaattgttcaagcagct
gacgtgaggcaggcactgagagaggcgggagatgaatttgagttgaggtaccggagagctttcagtgacctcacttccca
gctccacatcacccctggcactgcgtatcagagctttgagcaggtggtgaacgaactcttccgggacggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgcgtggagagcgttgacaaggagatgcgggtattggttgga
cgcgttgtatcttggatgaccacgtacttgaccgaccatctagacccctggatccaagagaatggcggatgggagcggtt
tgtggacctctacgggaatgatgctgctgccgagatgaggaagggccaggagaccttcaacaaatggctcctgactgggg
cgaccgtggcaggagtgcttctcctgggatctctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9P3N9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Apteryx owenii GN=MCL-1 (length=1077 residues).
tccccgtggcttttcccacatgctcccacgtcctttggggcgggcgcgattttgcgccagccacgtgcggggagggagcg
aagggcggcagggcgaagtgcaggaggcctggcctccgctggggatcgccgtgtggatccctggaaagtccgcagagatg
ggaaaccgcaagggccgttggcagggggatcccaaagagaaaccccccccgctgcagctggcgtgcggctctgctcacta
gcaggatgctcggctcgaaggcagccggatttgggatgcgtcgaggttagggagcagggcacgaagcacagcaggggcag
accagaacgagacggcgccgcgaatcccccaaaacgagccaaaccgtatcccagcgggtcggcgcctcccgcttttcccc
ggaatggtatttccccacgtctacgtgatgccgctcaccaggccgctcgctccggagccgatcggctcgttccgggtgca
ccggggccgcccggcgtcgacgagctgcgccaggactcgctggagctcatcggccgctacctgcgggaggcggcgggcga
agccgagcccggcgctaagaagctcttcccggggctgctgggcggcccgggtaggcccggcggggcgggcgacggcgtca
tggagaaggcgctggagacgctgcggcgggtcggcaacggcgtcatgcagaagcacgagctcgccttccaaggaatgctg
cggaagctggaaatcaagaaggaggaagacctgcagtcagtgtgtgaggtggcagcccatgttttcagtgatggagtaac
aaactggggcagagttgtgacactcatctcatttggtgcctttgttgcaaaacacctgaaaagcataaaccaggagaagt
gcatcagctcattagcagggatcatcacagatgctcttgtctcatctaaacgagagtggctgatgagccaaggaggctgg
gagggctttgttgacttcttccgagtagaggacctagaaggaagcatccggaatgtactgatggcttttgcaggagttgc
tggactgggagcaagcttggcctacatgatacggtga
>gnl|bcl2dbcds|A0A8B9PRT7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Apteryx owenii GN=BCL-2 (length=717 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccattataaactctcgcagagggg
atacgactgggctgccagcggcgaccgggcgccagcgtctccagggctctctcctcctgctgctgctgctcttgctgctg
ctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagtaacgcggcc
ccgggtgacgggctgcgcccggcgccaccggtggtccacctcgccctgcgccaagccggggatgagttctcccgccgcta
ccagagggacttcgcccaaatgtctggccagctgcacctgacacccttcacggccagaggccgctttgtggccgtggtgg
aggagctcttccgagacggggtcaactgggggagaatcgtggccttcttcgagttcggcagcgtcatgtgcgtggagagc
gtcaaccgggagatgtcccccctggtggacagcattgccacctggatgaccgagtacctgaaccggcacctgcatacttg
gatccaggacaacggcggctgggatgccttcgtggagttgtacggcaacagtatgcggcctttgttcgatttctcctgga
tctctctgaagactatcctaagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8B9PRT7_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Apteryx owenii GN=BCL-2 (length=684 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccattataaactctcgcagagggg
atacgactgggctgccagcggcgaccgggcgccagcgtctccagggctctctcctcctgctgctgctgctcttgctgctg
ctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagtaacgcggcc
ccgggtgacgggctgcgcccggcgccaccggtggtccacctcgccctgcgccaagccggggatgagttctcccgccgcta
ccagagggacttcgcccaaatgtctggccagctgcacctgacacccttcacggccagaggccgctttgtggccgtggtgg
aggagctcttccgagacggggtcaactgggggagaatcgtggccttcttcgagttcggcagcgtcatgtgcgtggagagc
gtcaaccgggagatgtcccccctggtggacagcattgccacctggatgaccgagtacctgaaccggcacctgcatacttg
gatccaggacaacggcggctggcaggtaactccaagcaggcatcaccggagggacgtgctggatctcagacagactttgc
gcagcccagcgtggcggagcttgcctcaccgagacgttggagta
>gnl|bcl2dbcds|A0A8B9S513_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Apteryx owenii GN=BCL2A1 (length=525 residues).
atggaaaccgctgagttttattacgtttattatttagctcacgattatctgcagtatgttcttcaagaatcacaccttgg
accagcccaaaccagagttgctcacgtcctgcgaaacattgcattttcactgcaagatcaaacagaggaggctctccgac
cattcttggataggattgatattacctctgtagatgttgccaagcgaattttcaatggagtcatggaagaaaaatttgct
gatggaaatactaactggggacgaatcatgaccatatttacatttggaggacttctcactaagaagcttcaagagcatgg
agttcagctcacaggagaggagaaggagcagatttcttatttcatcacagagtacatcataaacaacaaagctgaatgga
tagatgcaaacggtggctgggaaaacggcttcctgacaaagtttgaaaggagatcactactgtctctctccaaaattaca
gccatattcatagcttttttttccctgttcagagagtactactga
>gnl|bcl2dbcds|A0A663E5S6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttggctcaagattatctgcaatatgtgcttcaggaatcacatcttgg
accagcccaaaccagggttgctcatgtcttgcgaaacattgcatcttcgctgcaagatcaaaccgaggaggctctcagac
cattcttggacaggattgatattacttctgtagctgtggccaagagaattttcaatggtgtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacctttggaggtcttctcactaagaagcttcaagagcatgg
agttcagctcactggagaggagaaggagcagatttcttatttcatcacagagtacataataaacaacaaagccgaatgga
tagatgcgaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactatctttctccaaaatcaca
gccatgttcatagctgttttttccttgctcagagagtactactga
>gnl|bcl2dbcds|A0A663ECL2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=BCL2L1 (length=693 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccacgcaccggagcagcctcgaagtccatgaaatcgttcaaaca
gctgatgtgaggcaggcgttgagagaggcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccatatcacccctggcacggcgtatcagagctttgagcaggtagtgaatgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
gggcgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacgatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A663EQJ0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=MCL-1 (length=933 residues).
agcggaacgccgtcatcggcttcaacctctactgcggcggcggcggcccggccctggcgcccgcctcgccgggggggggg
gccggccccaccgccgcccaccgcagccgccgccgctgaggtacccgggaccctgattggctccgtgggggcctgggccg
ccgccggtcgccctgagcacccccgcgcgctggttggctgcggcgcggccccccgcgcggcgctgccccccgcggcgcgg
ccgggcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggccgagcgcggcccggcgggggactcgct
gcccggcacgccgcccgggccgccggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgctacctgc
gggaggcggcgggcgaggcggagcccgccgtgaagaagcttttgccggggctcctgggcgggcccggccggcctggcgga
tcgggtgatgccgtgatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgcagaaacacgagctggc
cttccagggaatgcttcggaaactggaaatccagaaagaggaagatctgcagtcggtgtgtgaagtggctgcccatgtgt
tcagtgatggagtaacaaactggggtcgagtggtgacgctcatctcgtttggtgcctttgttgcaaaacacctgaaaagc
ataaaccaggagaggtgcatcagctcgctggcagggatcatcacagatgcgcttgtctcatctaagcgtgagtggctaat
gagccagggaggctgggagggctttgttgacttctttcgagttgaggacctagaaggcagcatcagaaatgtactgatgg
cgtttgcaggtgtggctggactaggagcaagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A663EQJ0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=MCL-1 (length=984 residues).
agcggaacgccgtcatcggcttcaacctctactgcggcggcggcggcccggccctggcgcccgcctcgccgggggggggg
gccggccccaccgccgcccaccgcagccgccgccgctgaggtacccgggaccctgattggctccgtgggggcctgggccg
ccgccggtcgccctgagcacccccgcgcgctggttggctgcggcgcggccccccgcgcggcgctgccccccgcggcgcgg
ccgggcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggccgagcgcggcccggcgggggactcgct
gcccggcacgccgcccgggccgccggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgctacctgc
gggaggcggcgggcgaggcggagcccgccgtgaagaagcttttgccggggctcctgggcgggcccggccggcctggcgga
tcgggtgatgccgtgatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgcagaaacacgagctggc
cttccagggaatgcttcggaaactggaaatccagaaagaggaagatctgcagtcggtgtgtgaagtggctgcccatgtgt
tcagtgatggagtaacaaactggggtcgagtggtgacgctcatctcgtttggtgcctttgttgcaaaacacctgaaaagc
ataaaccaggagaggtgcatcagctcgctggcagggatcatcacagatgcgcttgtctcatctaagcgtgagtggctaat
gagccagggaggctgggagggctttgttgacttctttcgagttgaggacctagaaggcagcatcagaaatgtactgatgg
cgtttgcaggtgtggctggactaggagcaagcttggcctacatgatccgattgcaggtaccgatgaggatttattgcttt
gggaacagaaagtggaagaattga
>gnl|bcl2dbcds|A0A663FHR0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=BCL-2 (length=738 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccgccgaggacagggcacccctgcctccgggtctctctcctcctcctgctgctgctgctgcggttg
ctgctgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcg
gctgctgctagccacgcgcccccggccgaggggctgccccccgcgccccaggtcgtccacctcgccctgcgccaggcggg
cgacgagttctcccgccgctaccagagggacttcgcccaaatgtccggccagctgcacctgacgcccttcacggccaggg
gccgcttcgtggcggtggtggaggagctcttccgagacggcgttaactggggcaggatcgtggccttcttcgagttcggc
ggcgtgatgtgcgtggagagcgtcaaccgggagatgtctcccctcgtagacagcatcgccgcctggatgaccgagtacct
gaaccggcacctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggc
ctttgttcgatttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgct
tatcttggacataagtag
>gnl|bcl2dbcds|A0A3P8NP63_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=837 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagttgctgggatgcattattgtga
>gnl|bcl2dbcds|A0A3P8NP63_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=834 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagatcttctacaatcttttga
>gnl|bcl2dbcds|A0A3P8NP63_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=825 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagtggtttgtaa
>gnl|bcl2dbcds|A0A3P8P0F1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3P8PVZ8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Astatotilapia calliptera GN=BCL2L10 (length=822 residues).
atgatttatggattatttgtcacccttttttgtaccataccaaaccatgaccacacttccgctggttattccgtggcggt
ggtgtcttctttccacagtccacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcattctgcatcag
ctgaagggaagactcaactgtaccgacgctctccttccgccgtctgtatgtgcagagagcagtctgatatcgctgggagg
aaaatgaaattctgtgggctgtggaaagagaccctggttttggccgaggactacctgtccttttgctgcacgagtccaca
tcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc
gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaaggag
ctggttggagatggacacttgaactgggggagggttgtttctcttttcgcctttactggagtgctggccagaaagatcct
ggagcagaagccggggctggaccctcgtcaacagcaggaactgggacaggagcccatgagctgcagaaggctggcagaga
ccatagctgattacctgggagaagagaagaaagactggctgttggataatgatggatgggaaggcttctgtaagttctcc
cgcagtgccagagaagtgagccaggactcatccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct
taccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A3P8QVM8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Astatotilapia calliptera GN=BCL-2 (length=687 residues).
atggagaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcgggggttcgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggtccaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctcctccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttattgctttcttcgagtttgggggcactgtgtgcgtggagtgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagttgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagcctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A3B1IEV7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=729 residues).
atgaacccaaccgcgatcagcctcctgtgtgacggaacaagcccggttctctacagaaccgagaaagaggagaagctgcc
ccggacggagcggccggaacgcggcctggaggggctgcagtccgctaaaggagtctccatgggcggcgggtctctgcccg
actccccgctggcggacgtagacttcatccaggactttagctgccgctgcccgggcgcgctggaggcggagacccgccgc
ctgatggtggagttttaccgcgggtacctgggccagaagccccgggagcagagcccggccctgcggaccatgagccgggt
ggtggcgggggtcgtcctcaaacacgggatcgcctacaacggtatggtccagaagctgaatttggaggagcaggacgaca
gtatggacattattagcagcgtagctaaggctctgtttagcgacggaaccacgaactgggggcggatcgttagcctggtg
gcgttcggcgcggtggtgtgtgatcatctgaagaagaagagtcgagatcactgcgtggagaacgtcgcccaacacatctc
cacctacctcaacacccaccaacaccagtggctcatcaacaacaacgcctgggacggattcgtggaattcttccgcgagg
acgactcagaatcacgagtccgaaacgccctgatggccttcgctggatttgccgggctgggggcggggctagcactactg
atgcgctga
>gnl|bcl2dbcds|A0A3B1JJ42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Astyanax mexicanus GN=BCL2L1 (length=720 residues).
gttatgtcgtactataaccgagaattagtggtgtactttattaagtacaaactctcacagaggaactatcctactaatca
catcggactcatggaagaaacaaatcgaactgaagggggccaggaagcggaggggaatgcagaggcggccggggtgactc
ccaccgcagtcgttaacgggtccgtaaatgggacgagtcacggtgcggcagggtcgcccacctcgtccccccagagaagg
gccaacggggctcgggggctggatgcagtgaaagaggcactgcgggactcagccaacgagtttgagctgcgatactctcg
cgccttcagcgacctgtcctcccagctgcacatcacgcctgctactgcgtaccagagctttgagagcgtgatggacgagg
tgtttcgcgatggcgtcaactggggccgcgtcgtaggtttgttcgctttcggcggggctctgtgtgtggagtgcgtggag
aaggagatgagccccctggtgggacgcatcgcagagtggatgaccgtctacttggacaaccacatccagccctggatcca
ggagcaaggaggatgggaacgctttgcagagatctttgggaacgacacagcagcagagagcagaaggatgcaggaacgct
ataagatgtggctgctggtggggatgaccctgttcacaggaattgtggtgggctctctcatcgctcagaagcgtctgtaa
>gnl|bcl2dbcds|A0A3B1K5R1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=735 residues).
atgatgagcccacaggatatgtgttcgtataacaagaagacggccgacattgttccccgggtcgctgttcgcggaggagg
gggaggagcggggctctcgctcggtctcgcggccgacattagacctaccaggcccggcgtcgacgacggctcagtgccca
gctcccccttgtcggactgcggggagatggccgttgggaactgcaagcagtacgaaacgctggacggagacacgcgagag
attatcagtgactttctgaggaacttttgcggactctctcggtcctgtggaggacacggtgcggttgtacagacaatgaa
gcgggtggtggacgatctggtggtcaaacatgggattgcgtacaaaggtatgttgaacaaactgggtatggaagacagag
gagatgacatgtatgtaattagggcagtagctaaggagctattcagtgatggcatcaccaactggggcagggtcgccagc
ctggtggcctttggagcagtggtgtccaagcatcagcatgacatgggccgaggccactgtgtgagtctagtgggtgaaga
actatcctcatatcttctgtcagacgaaagggactggctcctaaaaaacaaagcatgggatggctttgtggagttttttc
gtgttcctgatcctgagtcaacgatgagaaatgcattaatggcctttgttactgtggcaggtcttggagcctcaatagca
tttttggcaagataa
>gnl|bcl2dbcds|A0A8B9JW80_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=729 residues).
atgcatatttttctaagccacaacgtgcagaacgagactcggtttaagaccgtcgacattgttccccgggtcgctgttcg
cggaggagggggaggagcggggctctcgctcggtctcgcggccgacattagacctaccaggcccggcgtcgacgacggct
cagtgcccagctcccccttgtcggactgcggggagatggccgttgggaactgcaagcagtacgaaacgctggacggagac
acgcgagagattatcagtgactttctgaggaacttttgcggactctctcggtcctgtggaggacacggtgcggttgtaca
gacaatgaagcgggtggtggacgatctggtggtcaaacatgggattgcgtacaaaggttggttagcttatctaagagatg
acatgtatgtaattagggcagtagctaaggagctattcagtgatggcatcaccaactggggcagggtcgccagcctggtg
gcctttggagcagtggtgtccaagcatcagcatgacatgggccgaggccactgtgtgagtctagtgggtgaagaactatc
ctcatatcttctgtcagacgaaagggactggctcctaaaaaacaaagcatgggatggctttgtggagttttttcgtgttc
ctgatcctgagtcaacgatgagaaatgcattaatggcctttgttactgtggcaggtcttggagcctcaatagcatttttg
gcaagataa
>gnl|bcl2dbcds|A0A8B9LKW7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Astyanax mexicanus GN=BCL2L1 (length=717 residues).
atgtcgtactataaccgagaattagtggtgtactttattaagtacaaactctcacagaggaactatcctactaatcacat
cggactcgtggaagaaacaaatcgaactgaagggggccaggaagcggaggggaacgcagaggcggccgcggtgactccca
ccgcagtcgttaacgggtccgtaaatgggacgagtcacggtgcggcagggtcgcccacctcgtccccccagagaagggcc
aacggggctcgggggctggatgcagtgaaagaggcactgcgggactcagccaacgagtttgagctgcgatactctcgcgc
cttcagcgacctgtcctcccagctgcacatcacgcctgctactgcgtaccagagctttgagagcgtgatggacgaggtgt
ttcgcgatggcgtcaactggggccgcgtcgtaggtttgttcgctttcggcggggctctgtgtgtggagtgcgtggagaag
gagatgagccccctggtgggacgcatcgcagagtggatgaccgtctacttggacaaccacatccagccctggatccagga
gcaaggaggatgggaacgctttgcagagatctttgggaacgacacagcagcagagagcagaaggatgcaggaacgctata
agatgtggctgctggtggggatgaccctgttcacaggaattgtggtgggctctctcatcgctcagaagcgtctgtaa
>gnl|bcl2dbcds|A0A663M6G8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Athene cunicularia GN=MCL-1 (length=474 residues).
aggggcagggctggtgccaggctgcaaactgacttctgtgctgtggttctgatgcggtggggctttaaagcccttgtgag
aaaggggagtgtgatgtcatctcttgcaggaatgcttcggaagctggaaatccagaaagaggaagatctgcagtcagtgt
gtgaagtggctgcccacgtgttcagtgatggagtaacaaactggggtagagtggtgacgctcatctcatttggtgccttt
gttgcgaaacacctgaagagcataaaccaggagaaatgcatcagctcgttggcagggatcatcacggatgcactcatctc
atcgaagcgcgagtggctcatgagccaaggaggctgggagggctttgttgacttctttcgagtcgaggacctggaaggca
gcatcagaaatgtactgatggcatttgcaggtgtggctggactgggagcaagcttagcctacatgatccggtga
>gnl|bcl2dbcds|A0A663MPN9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Athene cunicularia GN=BCL-2 (length=639 residues).
atgcaagaatataacggcagtgattttacttggttgacaaatccccttgcctaccttcctgccatcagaagcagccccac
agctcaccgcacttttccaagtctctcccacagacacgatgcgctccagcatttatcctcgctgcgagctgcccgcaggc
cctgccgggctgcagccccgcggccgcgcagaatcgtccaccttgccctgcgccaggcgggcgacgagttctcccgccgc
taccagagggactttgcccaaatgtccggccagctgcacctgacgcccttcacggccaggggccgcttcgtggcggtggt
ggaggagctcttccgagacggggttaactggggcaggattgtggccttcttcgagtttggcggcgtgatgtgtgtggaga
gcgtcaaccgggagatgtctccccttgtagacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaac
tggatccaggacaacggaggctgggatgccttcgtcgagttgtatggcaacagtgtgaggcctttgtttgatttctcctg
gatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A663N622_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Athene cunicularia GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttagctcaagattatctgcaatatgtgcttcaggagtcacatcttgg
accagctcaaaccagggttgctcacgtcttgcgaaacattgcatcttcgctgcaagatcaaaccgaggaggctctcagac
cattcttggacaggattgatattacctctgtagctgttgccaagagaattttcaatggtgtcatgcaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacgtttggaggtcttctcactaagaagcttcaagagcatgg
agttcagctcactggagaggagaaggagcagatttcttatttcatcacagagtacataataaacaacaaagccgaatgga
tagatgcaaacggtggctgggaaaatggcttcctaacgaagtttgaaagaagatcactactatctttctccaaaattaca
gccatcttcatagctgttttctccttattcagagagtactactga
>gnl|bcl2dbcds|A0A8B8V3A7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL-2 (length=702 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcaggcaccgcgtccccgggggccgcccccgcgccaggcatcttctcctcccagcctg
ggcgcaccccagcgccatccaggacctccccgccgccgccccagaccgcccccgccgcccccgccggggggcctgcgctc
agccccgtgccacctgtggtccacctgaccctgcgccaggccggtgatgatttctctcgtcgctaccgccgcgacttcgc
cgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
atggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatg
tcccccctggtggacaacatcgccctgtggatgactgagtacctgaaccgacacctgcacacctggatccaggataacgg
aggctgggatgcctttgtggagctgtatggtcccagcatgcggcctctgtttgatttctcctggctgtctctgaaggcac
tgctcagtctggccctggtgggagcttgcgtcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8B8V3A7_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcaggcaccgcgtccccgggggccgcccccgcgccaggcatcttctcctcccagcctg
ggcgcaccccagcgccatccaggacctccccgccgccgccccagaccgcccccgccgcccccgccggggggcctgcgctc
agccccgtgccacctgtggtccacctgaccctgcgccaggccggtgatgatttctctcgtcgctaccgccgcgacttcgc
cgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
atggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatg
tcccccctggtggacaacatcgccctgtggatgactgagtacctgaaccgacacctgcacacctggatccaggataacgg
aggctggcacattccactcatcattgttattaactatttcttctgcgcttcacatttgtctgaacttggaacatatgctt
acgaagctgttggaaacttcccaagcctatttgattctgctgatatttccatagtgtga
>gnl|bcl2dbcds|A0A8B8V3A7_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL-2 (length=615 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcaggcaccgcgtccccgggggccgcccccgcgccaggcatcttctcctcccagcctg
ggcgcaccccagcgccatccaggacctccccgccgccgccccagaccgcccccgccgcccccgccggggggcctgcgctc
agccccgtgccacctgtggtccacctgaccctgcgccaggccggtgatgatttctctcgtcgctaccgccgcgacttcgc
cgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
atggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatg
tcccccctggtggacaacatcgccctgtggatgactgagtacctgaaccgacacctgcacacctggatccaggataacgg
aggctggacaaaagataaacccagctgtccttcagtgagaatgatgacggaatga
>gnl|bcl2dbcds|A0A8B8VBB9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggacgagaacagaactgaggccccagaagggactgaatcagacatggaaacccccagtgccatcaatggca
acccgtcctggcacctggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaagcgctgagggaggcaggtgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacggcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctatgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B8WSS7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtaggctataagctaaggcagaagggtta
tgtttgtggagctggcccaggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggctttctttgtctttggagccgcgctgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagcgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C0CSU7_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL2A1 (length=528 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccacagcctgg
atctggtccaagcaaaacatccagggtgttacaagacattgctttctcagtccaaaacgaagttgaaaagaatttgaaac
cattcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggtattctcatcaagaaacttctaggagagcg
aattgccccagatgtggacacttacaaggagatttcttactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaacggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacttttctggaagtt
acaggaatgatctgtgaaatattatgtctcctgaagcagtactattga
>gnl|bcl2dbcds|A0A8C0CVU0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=447 residues).
atgctcggcctcaagagaaacacagtaatcggactcaaactctactggggggaaccggattgggaccagacggccttcca
aggcatgcttcagaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtg
acggagttacaaactggggcaggattgtgactcttctttcttttggtgcctttgtggccaaacacttgaggagtataaac
caagaaatctgcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacaagactggctagtcaaacg
aagaggctgggatgggtttttggacttcttccatggagaggacctagcaaacggcctcagaaatgtgctgctggcttttg
caggtgttgctggagtaggagctggtttggcgtatctaatacgatag
>gnl|bcl2dbcds|A0A8C0DF47_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=1056 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggccggatagcggcag
cggcgcctccgctccaggaaggcggcttttggctgcgggaaaggaggccacggccgggcgagaggtagggggaggggaaa
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgctaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggcctccgacgccatcatgtcgcccgaggaggagctggacgggtgcgagccggagc
ctctagggaagcggccggccgtcctgcctttgctggagttggtcggcgaggccagtaacagccccggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcaggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggacttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggc
gtatctaataagatag
>gnl|bcl2dbcds|A0A8C0DF47_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=816 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggccggatagcggcag
cggcgcctccgctccaggaaggcggcttttggctgcgggaaaggaggccacggccgggcgagaggtagggggaggggaaa
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgctaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggcctccgacgccatcatgtcgcccgaggaggagctggacgggtgcgagccggagc
ctctagggaagcggccggccgtcctgcctttgctggagttggtcggcgaggccagtaacagccccggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcaggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggatgggtttgtggacttcttccatgtaga
ggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcgtatctaa
taagatagccttttaa
>gnl|bcl2dbcds|A0A8C0DF47_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=597 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggccggatagcggcag
cggcgcctccgctccaggaaggcggcttttggcaaccggcaccaaggacgcgaagccactgggcaggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaac
aaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
cggagtaggagctggtttggcgtatctaataagatag
>gnl|bcl2dbcds|A0A4W2C0F3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos indicus GN=BCL2L10 (length=576 residues).
tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctg
cgcccgggagccgggcactccagttcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatcc
aggaagcaaatcgaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcag
aggctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagag
gccgccgcagactacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccag
tcattccagccatcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctg
gataaaattattgtga
>gnl|bcl2dbcds|A0A4W2CQV1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=558 residues).
atgtgtgaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccgggagcaggcaaccgg
cgccaaggatgtgaagcccctgggcaggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcggggatg
gggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatct
ttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactcttatttcttttggtgc
ctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaa
ggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4W2D608_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos indicus GN=BCL2L1 (length=717 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtggtatgaaagaacacagaactgagaccccagaagggagagagtcagatatggaaacccccaatagccccacagtga
atggagccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggag
gcaagcaatgagtttaaactttggtaccaacagacattcagcgacctgacgtcccagctccgcatcaccccagggacagc
atgtcagagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctcct
tcagtgggacaatatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaatggccact
tacctaaataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatac
aacaaacgagagccagaagggccaggagcgcttcaactccatttacactactgctgctgtcgcaggcctcgcaaacctca
tttcaaacacaaaactttattcaaaattagaccaaagatgcccatactatgtgggccactcaggctcagatagatga
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=891 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcaatcaggaggaggaggaggagtcgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagttagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaag
ggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
cagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgataccg
tgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggtcaggatag
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2DSR6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos indicus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A4W2DSR6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos indicus GN=BCL-2 (length=612 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggatgaccgagtacctgaaccggcacctgcacac
ctggatccaggacaacggaggctgggtaggtgctcgtctggatgtgagtctgagcgggacacctcggtcccagtgcggtc
cgagtggtggggtgtggctgggcccagggtcaagggcaggccggtggagtaa
>gnl|bcl2dbcds|A0A4W2F845_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos indicus GN=BCL2L1 (length=711 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgtcagatatggaaacccccagtggatcagtggcaacccatcctggcacctggcagatagccccacagtgaatggag
ccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggaggcaagc
aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
gagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctccttcagtg
ggacactatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaacggccacttaccta
aataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatacaacaaa
cgagagccagaagggccaagagtgtttcaactccatttacactactgctgctgtcgcaggcctcacaaacctcatttcaa
acacaaaactttattcaaaattagaccaaagatgcccatactatgtgggccactcaggctcagatagatga
>gnl|bcl2dbcds|A0A4W2FG99_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos indicus GN=BCL2L10 (length=576 residues).
tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctg
cgcccgggagccgggcactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatcc
aggaagcaaatcgaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcag
aggctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagag
gccgccgcagactacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccag
tcattccagccatcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctg
gataaaattattgtga
>gnl|bcl2dbcds|A0A4W2G6Q5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=558 residues).
atgtgtgaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccgggagcaggcaaccgg
cgccaaggatgtgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcggggatg
gggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatct
ttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactcttatttcttttggtgc
ctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaa
ggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1098 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctggttctcccagaccagtgaagctgagatggttcatgaagtatttttcggt
gaaattttaagcaactgtgactctgctccaagttctcctgttcctgaggagctggaagcgatcaaagctcgagttaggga
gatggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggca
atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactat
ggtgcaacagcagaagagctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatt
tagtggccatccgaaagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaat
ccttatttagaggaagacagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttc
ccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
ccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=972 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggtcaggatag
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=891 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcaatcaggaggaggaggaggagtcgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagttagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaag
ggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
cagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgataccg
tgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggtcaggatag
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1011 residues).
atgggaacggttctcttttctgggcacccactccagggctggaagagttcaacaagtgcatggaacgtcagagaccttct
ggaaatgctgaatttactccaaggtttcatgaggcccagccggcttctcttcacagcctccagggtcagaagccctgcct
ggcccttgatgccctcctggccctgttcttcctggcctccagcagccctcttctttcctgagttgtggctcttcccaagc
ctgcgtcccagccccgcccctctctctggacgcatctctgggccccatcatcacccggcgccgggccctccctcccgccc
cccctttctcctccctccttccttccctcccttcctccctgtctccctccctcccagctcctgcaccaggaaacagccgg
atcccggcagcggcctgacccccgcccggatggcgaccccagcctcggccccagacacacgggctctagtggcagacttt
gtgggctataagctgaggcagaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacacca
agccatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtga
ccccgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaagggggccccaactggggccgccttgtg
gccttctttgtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcagga
gtggatggtggcctacctggagacgaggctggctgactggatccacagcagtgggggctgggcggagttcacagctctat
acggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggct
gtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-06 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8B9W7D1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos mutus grunniens GN=MCL-1 (length=1065 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcagtcgatactagattgtatacagaaccagctga
tgtaatggtatgcaacctggtgtag
>gnl|bcl2dbcds|A0A8B9W7D1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos mutus grunniens GN=MCL-1 (length=951 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggtaagtttgttttaa
>gnl|bcl2dbcds|A0A8B9W7D1_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos mutus grunniens GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8B9W7D1_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos mutus grunniens GN=MCL-1 (length=591 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccgga
aggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaa
ctggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactg
gggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcg
aaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatggg
tttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagt
aggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8B9WB42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L1 (length=711 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgtcagatatggaaacccccagtggatcagtggcaacccatcctggcacctggcagatagccccacagtgaatggag
ccactggccacagcagaagcttggatgcccagaaaacgatccccatgacaacagtaaagcaagccctgagggaggcaagc
aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
gagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctccttcagtg
ggacactgtgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaatggccacttaccta
aataaccacgtcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatacaacaaa
cgagagccagaagggccaggagcgcttcaactccatttacactactgctgctgttgcaggcctcgcaaacctcatttcaa
acacaaaactttattcaaaattggaccaaagatgcccatactatgtgggccactcaggctcagacagatga
>gnl|bcl2dbcds|A0A8B9WT05_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8B9X9C2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L1 (length=654 residues).
aaatttatcttacagggaaaggggtatagcaaccgacggctggtggttgactttctctcttacaagctttcccagaaagg
atacagctggagtcgatttaatgatgtggaagagaacagaactgaggcctcggaagggacaaaatcagatatggaaaccc
caatgccatcaatgacaacccatcttgccactggccacagcagaagcttggacgcctggaaagtgatccccgtgacaaca
gaaaagcaagccctgagggaggcaggcaatgacgaccagacgtcccagctccacatcaccccagggacagcatatcagag
ctttgaacagatgatgtatgaactcctccaggacggggtgaactggggtcgcattgtggcctttttttccttcagtgggg
cactatgcatggaaagcatagacaaggagacacaagtattggtgagtcaaagcacaacttggatggccacctacctaaat
gaccacctagagtcttggatccaggagaacggcggctgggacacttctgtgaaactctgtgaaaacaatacaaccaccga
gagccaaaagggccaggagcgcttcaacagctggtccctgacgggcatgacttcggctggtacagctctgctgggcttgc
tactcaactcatag
>gnl|bcl2dbcds|A0A8B9XQH5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B9Y853_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L10 (length=699 residues).
atgcgagaaggggcggggcgtcggcaggcccagaaaacaggccggggtcggacccccggtagaggcggagccatggtgga
cccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagcccggcactccagctcctg
cgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaaacgtcttgccccta
taccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaagaccctggccccag
ctggggccgcgtggcctcactcgtgacctttgcggggtcgctgctggagaggccaccgcagacgacccgacggcaggaga
agagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcgaaaggcaccgc
gcctggctgatggctaacggcggctgggatggattttgtctcttcttcagccactcattccagccatcttgggaaagaca
gctggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatcttttcttcacatag
gtcctgtgttcttgccagacgtattccagctctttgacttacgtcaccattgggaatag
>gnl|bcl2dbcds|A0A8B9Y853_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L10 (length=699 residues).
atgcgagaaggggcggggcgtcggcaggcccagaaaacaggccggggtcggacccccggtagaggcggagccatggtgga
cccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagcccggcactccagctcctg
cgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaaacgtcttgccccta
taccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaagaccctggccccag
ctggggccgcgtggcctcactcgtgacctttgcggggtcgctgctggagaggccaccgcagacgacccgacggcaggaga
agagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcgaaaggcaccgc
gcctggctgatggctaacggcggctgggatggattttgtctcttcttcagccactcattccagccatcttgggaaagaca
gctggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatcagccaacatggacc
cagccaagcttgtcagcagccaggggaataacatctgtgtggataaaaagccagcctag
>gnl|bcl2dbcds|A0A8B9YDG7_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2A1 (length=906 residues).
atgactgacactgagtttggctacgttcacgggctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaatatccagggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggactctgaagc
agtgcttggataagtttgatgtggtgtccgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgggcaagtg
tattgcctcagacatggacatgtgcaaggacatttcttactttgtggcggagttcatcaccgaaaatacaggagagtgga
taaagcaaaatggaggctgggtgtttacccataatgaatatcaaaagtccaaaagagtgtccatctttctgagcatgcca
gatgaaattgagacagaggagatcatcaaggacattttccgacaaggcaaaacctgctttatccctcggtaccagttgca
gagcaatcacatggatatggtgaagttagcatcgccagaggaaatcgcttcgctgcccagaacttcctggaacattcagc
agcccggtgaggatgaagttctggaggaggccttgtcaacagggggacttgacctcatctttgtgccgggtctcgggttc
gacaaacagagcaaccgtttgggacggggcaagggctactatgacgcctacctgaagcgttgtctgcagtcccaggacgt
gaaaccctacaccctggccttggctttcaaagagcagatctgcctccaggtcccggtgaatgagaatgatgtgaaggtag
acgaagtgctttacgaagactcctga
>gnl|bcl2dbcds|A0A8B9YDG7_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2A1 (length=606 residues).
atggcggcagcggtggccgtgagcggcgccaagcggagcctgcgggccgagctgaagcagcgtctgcgggcgctgagcgc
tgaggagcggctgcgccagtcccacctcttggcccagaaggtgtttacccataatgaatatcaaaagtccaaaagagtgt
ccatctttctgagcatgccagatgaaattgagacagaggagatcatcaaggacattttccgacaaggcaaaacctgcttt
atccctcggtaccagttgcagagcaatcacatggatatggtgaagttagcatcgccagaggaaatcgcttcgctgcccag
aacttcctggaacattcagcagcccggtgaggatgaagttctggaggaggccttgtcaacagggggacttgacctcatct
ttgtgccgggtctcgggttcgacaaacagagcaaccgtttgggacggggcaagggctactatgacgcctacctgaagcgt
tgtctgcagtcccaggacgtgaaaccctacaccctggccttggctttcaaagagcagatctgcctccaggtcccggtgaa
tgagaatgatgtgaaggtagacgaagtgctttacgaagactcctga
>gnl|bcl2dbcds|A0A8B9YDG7_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2A1 (length=711 residues).
atgactgacactgagtttggctacgttcacgggctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaatatccagggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggactctgaagc
agtgcttggataagtttgatgtggtgtccgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgggcaagtg
tattgcctcagacatggacatgtgcaaggacatttcttactttgtggcggagttcatcaccgaaaatacaggagagtgga
taaagcaaaatggaggctgggtgtttacccataatgaatatcaaaagtccaaaagagtgtccatctttctgagcatgcca
gatgaaattgagacagaggagatcatcaaggacattttccgacaaggcaaaacctgctttatccctcggtaccagttgca
gagcaatcacatggatatggtgaagttagcatcgccagaggaaatcgcttcgctgcccagaacttcctggaacattcagc
agcccggtgaggatgaagttctggaggaggccttgtcaacagttgcagtctgtctggtaatgagtgagtga
>gnl|bcl2dbcds|A0A8B9YDG7_BCL2A1-04 BCL2-related protein A1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2A1 (length=528 residues).
atgactgacactgagtttggctacgttcacgggctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaatatccagggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggactctgaagc
agtgcttggataagtttgatgtggtgtccgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgggcaagtg
tattgcctcagacatggacatgtgcaaggacatttcttactttgtggcggagttcatcaccgaaaatacaggagagtgga
taaagcaaaatggaggctgggaaaatgggtttgtaaagaagtttgaaaccaaatctggctggctgacttttctggaagtt
acaggaaagatctgtgaaacattatgtcgcctgaagcaatactattga
>gnl|bcl2dbcds|A0A3Q1LRT3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=714 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgtcagatatggaaacccccagtggatcagtggcaacccatcctggcacctggcagatagccccacagtgaatggag
ccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggaggcaagc
aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
gagctttgaacaggtaataaatgaactcttccgggacagggtgaaatggggtcacgttgtggcctttttctccttcagtg
ggacactatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaacggccacttaccta
aataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatacaacaaa
cgagagccagaagggccaagagcgtttcaactgctggtccctgacgacacgactgtggctgtttggcattttcttaatta
aacatatatttaccaaacaacccagcaattgtactcttgagcatttatctgggagatacgcaacattactgtag
>gnl|bcl2dbcds|A0A4W2C0F3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos indicus GN=BCL2L10 (length=576 residues).
tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctg
cgcccgggagccgggcactccagttcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatcc
aggaagcaaatcgaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcag
aggctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagag
gccgccgcagactacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccag
tcattccagccatcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctg
gataaaattattgtga
>gnl|bcl2dbcds|A0A4W2CQV1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=558 residues).
atgtgtgaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccgggagcaggcaaccgg
cgccaaggatgtgaagcccctgggcaggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcggggatg
gggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatct
ttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactcttatttcttttggtgc
ctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaa
ggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4W2D608_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos indicus GN=BCL2L1 (length=717 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtggtatgaaagaacacagaactgagaccccagaagggagagagtcagatatggaaacccccaatagccccacagtga
atggagccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggag
gcaagcaatgagtttaaactttggtaccaacagacattcagcgacctgacgtcccagctccgcatcaccccagggacagc
atgtcagagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctcct
tcagtgggacaatatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaatggccact
tacctaaataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatac
aacaaacgagagccagaagggccaggagcgcttcaactccatttacactactgctgctgtcgcaggcctcgcaaacctca
tttcaaacacaaaactttattcaaaattagaccaaagatgcccatactatgtgggccactcaggctcagatagatga
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=891 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcaatcaggaggaggaggaggagtcgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagttagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaag
ggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
cagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgataccg
tgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggtcaggatag
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2DSR6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos indicus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A4W2DSR6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos indicus GN=BCL-2 (length=612 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggatgaccgagtacctgaaccggcacctgcacac
ctggatccaggacaacggaggctgggtaggtgctcgtctggatgtgagtctgagcgggacacctcggtcccagtgcggtc
cgagtggtggggtgtggctgggcccagggtcaagggcaggccggtggagtaa
>gnl|bcl2dbcds|A0A4W2F845_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos indicus GN=BCL2L1 (length=711 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgtcagatatggaaacccccagtggatcagtggcaacccatcctggcacctggcagatagccccacagtgaatggag
ccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggaggcaagc
aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
gagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctccttcagtg
ggacactatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaacggccacttaccta
aataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatacaacaaa
cgagagccagaagggccaagagtgtttcaactccatttacactactgctgctgtcgcaggcctcacaaacctcatttcaa
acacaaaactttattcaaaattagaccaaagatgcccatactatgtgggccactcaggctcagatagatga
>gnl|bcl2dbcds|A0A4W2FG99_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos indicus GN=BCL2L10 (length=576 residues).
tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctg
cgcccgggagccgggcactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatcc
aggaagcaaatcgaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcag
aggctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagag
gccgccgcagactacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccag
tcattccagccatcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctg
gataaaattattgtga
>gnl|bcl2dbcds|A0A4W2G6Q5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=558 residues).
atgtgtgaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccgggagcaggcaaccgg
cgccaaggatgtgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcggggatg
gggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatct
ttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactcttatttcttttggtgc
ctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaa
ggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1098 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctggttctcccagaccagtgaagctgagatggttcatgaagtatttttcggt
gaaattttaagcaactgtgactctgctccaagttctcctgttcctgaggagctggaagcgatcaaagctcgagttaggga
gatggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggca
atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactat
ggtgcaacagcagaagagctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatt
tagtggccatccgaaagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaat
ccttatttagaggaagacagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttc
ccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
ccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=972 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggtcaggatag
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=891 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcaatcaggaggaggaggaggagtcgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagttagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaag
ggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
cagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgataccg
tgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggtcaggatag
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1011 residues).
atgggaacggttctcttttctgggcacccactccagggctggaagagttcaacaagtgcatggaacgtcagagaccttct
ggaaatgctgaatttactccaaggtttcatgaggcccagccggcttctcttcacagcctccagggtcagaagccctgcct
ggcccttgatgccctcctggccctgttcttcctggcctccagcagccctcttctttcctgagttgtggctcttcccaagc
ctgcgtcccagccccgcccctctctctggacgcatctctgggccccatcatcacccggcgccgggccctccctcccgccc
cccctttctcctccctccttccttccctcccttcctccctgtctccctccctcccagctcctgcaccaggaaacagccgg
atcccggcagcggcctgacccccgcccggatggcgaccccagcctcggccccagacacacgggctctagtggcagacttt
gtgggctataagctgaggcagaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacacca
agccatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtga
ccccgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaagggggccccaactggggccgccttgtg
gccttctttgtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcagga
gtggatggtggcctacctggagacgaggctggctgactggatccacagcagtgggggctgggcggagttcacagctctat
acggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggct
gtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-06 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A5PJR2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|E1B9B3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=747 residues).
atgactgaaggcggagccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgc
ccgggagccgggcactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccagg
aagcaaatcgaaacgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagagg
ctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtaaccttcgcggggtcgctgctggagaggcc
accgcagacgacccgacggcaggagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatgactaacggcggctgggtgagcgcgaaggacgcggggctggtg
ggcagcctgggacgcgcccacgctgccggatggattttgtctcttcttcagccactcattccagccatcttgggaaagac
agctggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatcgtgagttctaaaa
ttcttatttctacctgcctaactctgagcaaccaagcaaaattgaaatgtgaaagaccaaatcagagtaaaccaccttcc
gagacatttttatctgcattcatgtaa
>gnl|bcl2dbcds|F1MQX4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=573 residues).
ggaatgttgccaatattttcagaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccg
ggagcaggcaaccggcgccaaggatgtgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
accgagtcggggatggggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaa
gacgatgttaaatctttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|F1MV39_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=564 residues).
gttgctgatggacaggaaagcctggtggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagcc
gggcactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatc
gaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgac
gaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagaggccgccgcagac
tacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttct
gcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccagtcattccagcca
tcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctggataaaattatt
gtga
>gnl|bcl2dbcds|F6R2C4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos taurus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|O02718_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos taurus GN=BCL-2 (length=687 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgccccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgagggaacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataag
>gnl|bcl2dbcds|Q05KI8_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos taurus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggtcggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|Q05KJ0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q05KJ0_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C0EQC0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Bubo bubo GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttagctcaagattatctgcaatatgtgcttcaggagtcacatcttgg
accagcccaaaccagggttgctcatgtcttgcgaaacattgcatcttcgctgcaagatcaaaccgaggaggctctcagac
cattcttggacaggattgatattacctctgtagctgttgccaagagaattttcaatggtgtcatgcaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacgtttggaggtcttctcactaagaagcttcaagagcatgg
agttcagctcactggagaggagaaggagcagatttcttacttcatcacagagtacataataaacaacaaagccgaatgga
tagatgcaaacggtggctgggaaaatggcttcctaacgaagtttgaaagaagatcactactatctttctcaaaaattaca
gccatattcatagctgttttctccttattcagagagtactactga
>gnl|bcl2dbcds|A0A8C0FD84_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bubo bubo GN=MCL-1 (length=561 residues).
agggagaactgttttgacctggttttgtgtaacttggaaacgagctgttttggggctagcctgagactttggggtggtgg
ggctgagctcccggcctcggggctcgtgctggggctgcttttggcatgtcacaccgcgtctgatcccagatcagggtggt
acctggcacaggagggtggtgtctcatctcttgcaggaatgcttcggaagctggaaatccagaaagaggaagatctgcaa
tcagtatgtgaagtggctgcccacgtgttcagtgatggagtaacaaactggggtagagtggtgacgctcatctcgtttgg
tgcctttgttgcgaaacacctgaagagcataaaccaggagaagtgcatcagctcgctggcagggatcatcacggacgcgc
tcgtctcatcgaagcgcgagtggctaatgagccaaggaggctgggagggctttgtcgacttcttccgagtcgaggacctg
gaaggcagcatcagaaatgtactgatggcgtttgcaggtgtggctggactgggagcgagcttggcctacatgatccggtg
a
>gnl|bcl2dbcds|A0A8C0FL84_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bubo bubo GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagtggaggacgccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccgtgcaccggagcagcctcgaagtccatgaaatcgttcaagcg
gccgatgtgaggcaggcgctgagagaggcgggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccccggcacggcgtatcagagctttgagcaggtagtgaacgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtatcttggatgaccatgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggtaag
aactcatctccctggtggggatggctgccagtgtcctccctcgctccaggctggcagcggtgccggtcaaaccggtgcgc
agctccctgcagtgtttattctagtgcctgtcctagaccttgcagggagataa
>gnl|bcl2dbcds|A0A8C0IE77_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bubo bubo GN=BCL-2 (length=696 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcacccctgcctccgggtctctctcctcctgctgctgctgctgcggtcgctg
ctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgct
gctagccacgtcgtccacctcgccctgcgccaggcgggcgacgagttctcccgccgctaccagagggactttgcccaaat
gtccggccagctgcacctgacgcccttcacggccaggggccgcttcgtggcggtggtggaggagctcttccgagacgggg
ttaactggggcaggattgtggccttcttcgagtttggcggtgtgatgtgcgtggagagcgtcaaccgggagatgtctccc
cttgtagacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctg
ggatgccttcgtcgagttgtatggcaacagtatgaggcctttgtttgatttctcctggatctctctgaagactatcctga
gtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|J7H260_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bufo japonicus formosus GN=MCL-1 (length=639 residues).
atgggcggctctctgccctccccgcagtccgagctggacgaggacgaggattacatggacgtacagtcggactcccgggg
ctccacctcccctccgctcacccccacctgctccccggaccccctgcacacggaaacccgcgccctgctgcacaccttct
tcagggaatgggccggagacgcgaagcaggaggacggcgacagcccgaaggcgctgcccaccatgcgcaggctggggggc
gacatcaatgagaagcaccgaatggcctttcagggcatgttgcagaagttatctatacaacgtccagaagatatccagaa
gctctccgaggtcccctctatggtcttcagcgatggggttaccaattggggccgtatcgtcaccgtgataagctttggtg
cgtttgtggctaaacatttgaaaagcatccacatggagaactgcgttggaatcctagcggacagcttcacagactatctt
atgacccagaagaaagaatggatcgtagaacacaatggctgggatggctgtgtcgaattctttcacgtcgaggactatga
gagtggactaaaaacagtcttgatggccttcgctggtgtggctggtcttggagcaagcctggcgtacatgatccggtga
>gnl|bcl2dbcds|A0A8B9Z3D5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Buteo japonicus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttggctcaagattatctgcaatatgtgcttcaggaatcacatcttgg
accagcccaaaccagggttgctcacgtcttgcgaaacattgcatcttcgctgcaagatcaaaccgaggaggctctcagac
cattcttggacaggattgatattacttctgtagctgtggccaagagaattttcaatggtgtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacctttggaggtcttctcactaagaagcttcaagagcatgg
agttcaactcactggagaggagaaggagcagatttcttatttcatcacagagtacataataaacaacaaagccgaatgga
tagatgcgaatggtggctgggaaaatggcttcctaacgaagtttgaaagaagatcactactatctttctccaaaatcaca
gccatgttcatagctgttttttccttgctcagagagtactactga
>gnl|bcl2dbcds|A0A8C0ASR2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Buteo japonicus GN=MCL-1 (length=585 residues).
gggaacggactggaagtgagaactgaccaattttacctggttttgtgtagctcagaaatgagctggtttgggtctagcct
gagtcgtcggggtggcgggactgagctcctggcctcagggctcacgctgggacttgtgggggctgcatcttctcactggt
tgccttgtggggtatttggcattgtgtgcatgcctgcttctaaaccaacatctcttgcaggaatgcttcggaaactggaa
atccagaaagaggaagatctgcagtcggtgtgtgaagtggctgcccatgtgttcagtgatggagtaacaaactggggtcg
agtggtgacgctcatctcgttcggtgcctttgttgcgaaacacctgaaaagcataaaccaggagaggtgcatcagctcgc
tggcagggatcatcacagatgcacttgtctcatctaagcgcgagtggctaatgagccagggaggctgggagggctttgtt
gacttctttcgagtcgaggacctagaaggcagcatcagaaatgtactgatggcgtttgcaggtgtggctggactaggagc
aagcttggcatacatgatccggtga
>gnl|bcl2dbcds|A0A8C0AYR5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Buteo japonicus GN=BCL2L1 (length=693 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccatgcaccggagcagcctcgaagtccatgaaatcgttcaaaca
gctgatgtgaggcaggcgttgagagaagcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccctggcacggcgtatcagagctttgagcaggtagtgaatgaactcttccgtgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacgatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C0AYR5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Buteo japonicus GN=BCL2L1 (length=816 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccatgcaccggagcagcctcgaagtccatgaaatcgttcaaaca
gctgatgtgaggcaggcgttgagagaagcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccctggcacggcgtatcagagctttgagcaggtagtgaatgaactcttccgtgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatggtccag
gccatggcctctgtccccagccctgtcacacacctccctcagagggagaggggctgtggctgtttgccgtgcagtggctc
tattgaaatttgctcggctcttgctgttgctggagatgaaggactggaggcagccggcttggacgagccgggccggagtg
actgcattcctggccaggcctcgtgcttggcccgctctcccgaagcccagggaaaggccggagtttcacgatccagagtg
cctgccttcgccatag
>gnl|bcl2dbcds|A0A8C0BN28_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Buteo japonicus GN=BCL-2 (length=600 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccgccgaggacagggcacccctgcctccaggtctctctcctcctgctgctgctgctgctgcggttg
ccgctgctgctgctgctgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgag
ccccccggctcggnggccaggggccgcttcgtggcggtggtggaggagctcttccgagacggcgtcaactggggcaggat
cgtggccttcttcgagttcggcggcgtgatgtgcgtggagagcgtcaaccgggagatgtctcccctcgtagacagcatcg
ccgcctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgggatgcctttgtggag
ttgtatggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagactatcctgagtctggttctggtggg
agcttgcatcactcttggcgcgtatcttggacataagtag
>gnl|bcl2dbcds|A0A8C3BNR4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cairina moschata domestica GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattatttagctcaagattatctgcaatatgtgcttcaggaatcacatcttgg
accagcgcaaaccagagttgctcatgtcttgcgaaacattgcatcttcgctgcaagatcaaacagaggaggctctcagac
ccttcctggacaggattgatattacttctgtagatgttgccaagagaattttcaatggtgtcatggatgaaaaatttgct
gatggaaatactaattggggaagaattacgaccatatttacttttggaggtcttctcactaagaagcttcaagaacatgg
agttcagctcactggagagaagaaggagcagatctcttatttcatcacagagtacatcataaacaacaaagccgaatgga
tagatgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gacttattcgtggctgttttttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8C3CGW6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cairina moschata domestica GN=BCL2L1 (length=684 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtcgcctacaagctgtcgcagaagggctacagctggagccagct
ggaggaggaggatgagaacaggactgaggtggcggccgaggccgacgcggtgctcaacgggagcccctcctggcacccgc
ccgccggccaggtagtgaacggcgccgccgtgcaccggagcggcctggaggtccgcgagctcgtccagtcggccggcgtc
cggcaggcgctgcgcgaagccggggacgagttcgagctgaggtaccgccgggccttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaactcttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtcgacaaggagatgcgggtgctggtggggcgcatc
gtggcctggatgaccacctacctgagcgaccacctcgacccctggatccaggagaacggcggatgggagcggtttgtgga
cctctacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggctcctgaccggggcgacgg
tggccggagtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C3CIW8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cairina moschata domestica GN=BCL-2 (length=834 residues).
cccctcggggacttgaagcatcaaagcagccggagcttaacgtttctgaagacttggcgatgtttgggtcgtgtcgttgc
tggtgttttttgtagaggaaacttgacagaggaacatatttatagtcccaaaagaggctacgataaccgggagatagtgc
tgaagtacatccactataaactctcgcagaggggatacgactgggctgccggcgaggacagggcgcccgcgcctacggct
ctcgctcctgctgctgctgcggttgctgctgctgggactccctcccgccaccgccccgccgggctgctgtccccgcaccc
cgagccccccggctcggctgctgctagcgaggcgcccccgggcgaggggctgcgccccgcaccccccgtggtccacctcg
ccctgcgccaggccggggacgagttctcccgtcgctaccagcgggacttcgcccagatgtccggccagctgcacctgaca
cccttcacggccagaggccgcttcgtggccgtggtggaggagctcttccgagacggggtgaactggggccggatcgtggc
cttcttcgagttcggcggcgtcatgtgcgtggagagcgtcaaccgggagatgtctcccctggtggacagcatcgccgcct
ggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtat
ggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagactatcctgagtttggttctggtgggagcttg
catcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8C3GNC2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cairina moschata domestica GN=MCL-1 (length=1269 residues).
atgttcgccctgccgcgcaacgccctcatcggcttcaacctctactgcggcggcggcaccgggcccgggggaggaggagg
aggaggaggaggaggagggggcccggcctcaacgggggggaccccggccccgccgcccccctcccctcacgccgccgccc
ccccccctccgttcccggcggctcgcggcgccccctgctcgctgctgattggctccgccgccgctccgcgctcgctgatt
ggctccgccgctccgccgttgtggagccccgaggaggagctggacggctgcgagcccgaggccgagctgggggggcccgg
aggaggagggggggggtctctcccggggacccccccggagttacccacggacgagttgaggcaggactcgttggaactga
tcctccggtacctccgggaagcggcgggggaaacggaaccgggcttgaaaaagttttttccgggccttttgggaagaccc
gggggggttgcggggggggacggcgtgatggagaaagcgctggaaacgctgcggagggtgggggacggagtcctggagaa
acacgagctggccttccaaggaatgcttcggaagctggaaatcaagaaggaggaagacctgcaggccgtgggtgaggtgg
cggcccacctcttcagcgacggggtgaccaactgggggcgcgtcgtcaccctcatctccttcggcgccttcgtggccagg
cacctgaaaagcgtgaagcaggagaaaagcatcggctccctggccaggatcatcacggacgccctcgtctcgtccaagcg
cgagtggctcgtgagccagggaggctgggagggtttcgtcgactttttccgagtggaagacctggaaggcagcatcagga
acgtgctgatggcgttcgcgggagtggcgggactgggagcgagcttggcctacatgatccggaaggcgtgcgccggtcgg
attgcgaggggaccgatgaggattatcgctttgggagcggaaagcggaagaagttcggtcaatcggctcggtttgagagc
ccaaggggactgcttcggttttacccccggagttttagcctcgcctagaccgaagcctcgtgggcttggcgtggcgggag
cgagatattcagagcttctggtgagagcagctcctctgtcagagcttcgagtgcgagcccggcgccgcctcgggaaggag
cggagccaccccgggggctggcagcaggtggcagggaggcggcggagcggggccggcgcggcgcggtga
>gnl|bcl2dbcds|A0A8C3JHE5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Calidris pygmaea GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagagg
atacgactgggctgccggtgaggacccggcacctctgccaccaggtctctctcctcctgctgctgctgctgctgctgctg
ctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagccacgtg
cccccggccgaggggctgcgccccgcgccccaggtggtccacctcaccttgcgccaggcaggggacgagttctcccgccg
ctaccagagggactttgcccaaatgtccggccagctgcacctgacccccttcacggccaggggccgcttcgtggcggtgg
tggaggagctcttccgagacggggttaactggggcaggatcgtggccttcttcgagttcggcggcgtgatgtgcgtggag
agcgtcaaccgggagatgtctcccctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|A0A8C3K1C5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Calidris pygmaea GN=BCL2A1 (length=525 residues).
atggaaacggctgagttctattacgtttattacttagctcaagattatctgcaatatgtgcttcaggagtcacatcttgg
accagcccaaaccagggttgctcacgtcttgcgaaacattgcatcttcgctgcaagatcaaactgaggaggctctcagac
cgttcctggacaagattgatattacctcggtagctgttgccaagagaattttcaatggtgtcatggaagaaaaatttgct
gacggaaatactaactggggacgaattatgaccatatttacatttggaggtcttctcactaagaagcttcaagagcatgg
agtccagctgactggagaggagaaagagcagatttcttatttcatcacagagtacataatgaacaacaaagccgaatgga
tagatgcgaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gccatgttcctggctgttttctccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8C3KQJ2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Calidris pygmaea GN=BCL2L1 (length=693 residues).
atgtccaacagtaaccgggagttagtgattgactttgtttcctacaagctttcacagaagggatacagctggagcgatct
gcaggaggaggatgagaacaggactgactttgtggcagaggaggacgagatggacggcgtcctcaacgggagcccctcct
ggcaccaacccgccagccacgtagtgaacggagccaccgtgcaccggagaagcctggaagtccatgaaatcgttcaaaca
gccgatgtgaggcaggcgctgagagaggcgggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccccggcacggcgtatcagagctttgagcaggtagtgaacgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccgggagaatggcggatgggagcg
gtttgtggacctctacgggaacgatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A2R8MY14_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcgcccccaggggccgcccccgcggagggcatcttctcttcccagcccg
ggcacacgcccggtcccgccgcgccccgggacccggtcgccaggacctcgccgccgccgcccccagccgcccccgccgcc
gccgccacggggcctacgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagcttggtcctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|A0A8I3ZZI7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagcccagtggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A8I3ZZI7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=639 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagcccagtggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctggatgaaggtgatctttcaaatctcctctgcagagatccaatgggataatggtgactaccatttattgagcatctag
>gnl|bcl2dbcds|F7CT87_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L10 (length=579 residues).
atggctgacccgctgtggcagcgcaccgagcagctggtgacggactacctggagtactgctcccgggagcctggcacccc
cgagtcgccgccgtccaccgccgaggccgctgtgctgcgcgccgtggccgccagtgtgcggaaactctaccggtctttct
tctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgaggatggcggaggccctgctctccgacagtccc
ggccccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtctcggctgaaggagccggaaggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagttcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggatggcttttgttacttcttc
aggacctcctccttgctggcattatggagaaaagtgctggtccaggttttcctgtcatggttgttaacagcagtattcat
ctacttctggacacgataa
>gnl|bcl2dbcds|F7GTF7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=1065 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacagagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgactggcggaagcgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgccggaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggagcctgctaatggctccagtacggacgggtcacta
ccgtcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcagagattgtagtgagctgagatcgagccattgtactccagcccaggggatggtacgagactt
tgtctcaaaaaaaaaaaaaagttaa
>gnl|bcl2dbcds|F7GTF7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=594 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctgg
agtaggagctgggttggcatatctaataagatag
>gnl|bcl2dbcds|F7HXW0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2A1 (length=528 residues).
atgacagactctgaatttggatatattcacaatctaactcaggactatctgcagtacgtcctgcagataccacagtctgg
aatgggtccgagcaaaacgtctagagtgctacaacaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagt
catgcttggacaatgttgatattgcgtccatagataatgccagaacgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatctcacattttgttgctgagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgcgaaatgctatctctcttgaagcaatactgttga
>gnl|bcl2dbcds|F7HXW0_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2A1 (length=489 residues).
atgacagactctgaatttggatatattcacaatctaactcaggactatctgcagtacgtcctgcagataccacagtctgg
aatgggtccgagcaaaacgtctagagtgctacaacaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagt
catgcttggacaatgttgatattgcgtccatagataatgccagaacgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatctcacattttgttgctgagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggggaaatggcacagtctcatgcttatgctagtatcagtggcccagaagaagaggaaaatg
gctttgtaa
>gnl|bcl2dbcds|U3CRF8_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctccgccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaaaggtta
tgtctgtggaactggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgaattcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggttcagcccaacaacgcttcacc
caggtctccgatgaacttttccaagggggtcccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcagatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcacggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|U3CRF8_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcctgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggttcgggagcccccggcagtcaagaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
cagatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccg
cgcacggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|U3CRF8_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L2 (length=891 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcctgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggttcgggagcccccggcagtcaagaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
cagatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccg
cgcacggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggtcaggatag
>gnl|bcl2dbcds|A0A8C0KQ53_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Canis lupus dingo GN=BCL2A1 (length=525 residues).
atgacggactgcgagtttggctacacgctggcgctggcccaggactacgtgaggcacgtcctgcagatcccgcagcccgg
cccggcccccagcagagcgtccagggtgctccaggacgtggccttctccgtccaggggcaggtggaaaagaacctgaagc
cgtgcttggacagttttgacgtggtgtctgtcgacacggccagaaccatattcaatcaggtgatggagaaggaatttgaa
gacggcgtcattaactggggaaggatcgtgaccgtttttgcctttgaaggaattctcaccaagaaactcctcgagcagcg
aatttcctcggatgtggatgccgagaaggtttcctacttcgtggcagagttcatcacgagaaacatgagagactggataa
gacaaaacggaggctgggaaaacggctttgtgaagaagttcgaacccaagtctggatggctgacttttctggaagttctg
ggaacagtgtgtgaaatgtggtcacacctaaagcaatactactga
>gnl|bcl2dbcds|A0A8C0KWE3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus dingo GN=BCL-2 (length=714 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgccgccgccgccgccgccgccgccgcg
ggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccg
ccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggagg
agctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
aaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggat
ccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggctgt
ctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C0L4C8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus dingo GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C0MCZ5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C0MCZ5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=813 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttttaa
>gnl|bcl2dbcds|A0A8C0MTY3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2A1 (length=789 residues).
atgtcccatctctttggtggttcttatgatgcccaacgatgttctggggagagaaggctgcctgctgttggcttcatgtt
cctgtggcccacgcccgagagtgacgaggaggaaggagccggcccagtggtgcacacagaaattccaccagcttccacgt
gccgccctgagtcacatcccgagccccgccagccccggcctcacagggcctcaggcagctcacgggggaccaggctccca
tcccggcgggcgggcgggccaaggatgacggactgcgagtttggctacacgctggcgctggcccaggactacgtgaggca
cgtcctgcagatcccgcagcccggcccggcccccagcagagcgtccagggtgctccaggacgtggccttctccgtccagg
ggcaggtggaaaagaacctgaagccgtgcttggacagttttgacgtggtgtctgtcgacacggccagaaccatattcaat
caggtgatggagaaggaatttgaagacggcgtcattaactggggaaggatcgtgaccgtttttgcctttgaaggaattct
caccaagaaactcctcgagcagcgaatttcctcggatgtggatgccgagaaggtttcctacttcgtggcagagttcatca
cgagaaacatgagagactggataagacaaaacggaggctgggaaaacggctttgtgaagaagttcgaacccaagtctgga
tggctgacttttctggaagttctgggaacagtgtgtgaaatgtggtcacacctaaagcaatactactga
>gnl|bcl2dbcds|A0A8C0NC28_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=720 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgcc
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcct
ggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C0NC28_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=693 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgcc
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctggatgacttgggttttcctgttggttttactttcctttccctgtgtccactcctggc
cccttgtgcagtgccaggccccctggccatggccaccacacagtccagcctga
>gnl|bcl2dbcds|A0A8C0NC28_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=720 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgcc
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctggagtccacatcctttgatggtctcctctgctgaaaaaacttgcgtctacagtgtct
atataaagcatagaagcattgattctcatctgtggattctctcatgctctgactttagttgtagtgatcgatgcctgtag
>gnl|bcl2dbcds|A0A8C0Q5E6_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaag
agttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaa
ggttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8C0Q5E6_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagctg
agaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaaga
gttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaag
gttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgataccg
tgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8C0Q5E6_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtcaccgtagg
ggccttttttgcgagcaagtga
>gnl|bcl2dbcds|A0A8C0TGM4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8I3MLT5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgcgggc
cccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggctgtctc
tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8I3MLT5_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgcgggc
cccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctggagtccacatcctttgatggtctcctctgctgaaaaaacttgcgtctacagtgtctatataaagc
atagaagcattgattctcatctgtggattctctcatgctctgactttagttgtagtgatcgatgcctgtag
>gnl|bcl2dbcds|A0A8I3MNK9_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtcaccgtagg
ggccttttttgcgagcaagtga
>gnl|bcl2dbcds|A0A8I3MNK9_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=996 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaag
agttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaa
ggttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtttctgtag
>gnl|bcl2dbcds|A0A8I3MNK9_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaag
agttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaa
ggttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8I3MNK9_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagctg
agaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaaga
gttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaag
gttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgataccg
tgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8I3MYG9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2A1 (length=834 residues).
atgagcatgatacaggaatgtgcatcactgctggggagaaataaaatgtcccatctctttggtggttcttatgatgccca
acgatgttctggggagagaaggctgcctgctgttggcttcatgttcctgtggcccacgcccgagagtgacgaggaggaag
gagccggcccagtggtgcacacagaaattccaccagcttccacgtgccgccctgagtcacatcccgagccccgccagccc
cggcctcacagggcctcaggcagctcacgggggaccaggctcccatcccggcgggcgggcgggccaaggatgacggactg
cgagtttggctacacgctggcgctggcccaggactacgtgaggcacgtcctgcagatcccgcagcccggcccggccccca
gcagagcgtccagggtgctccaggacgtggccttctccgtccaggggcaggtggaaaagaacctgaagccgtgcttggac
agttttgacgtggtgtctgtcgacacggccagaaccatattcaatcaggtgatggagaaggaatttgaagacggcgtcat
taactggggaaggatcgtgaccgtttttgcctttgaaggaattctcaccaagaaactcctcgagcagcgaatttcctcgg
atgtggatgccgagaaggtttcctacttcgtggcagagttcatcacgagaaacatgagagactggataagacaaaacgga
ggctgggaaaacggctttgtgaagaagttcgaacccaagtctggatggctgacttttctggaagttctgggaacagtgtg
tgaaatgtggtcacacctaaagcaatactactga
>gnl|bcl2dbcds|A0A8I3P430_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8I3P430_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=594 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagcc
ggaaggcgttagagaccctccggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8I3RSU6_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtcaccgtagg
ggccttttttgcgagcaagtga
>gnl|bcl2dbcds|A0A8I3RSU6_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaag
agttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaa
ggttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8I3RSU6_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagctg
agaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaaga
gttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaag
gttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgataccg
tgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|Q6R755_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgatttctcctggctgtctc
tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q75SV7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=720 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgac
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcct
ggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q76LT7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q8HYS5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcagtaatccggactcaactctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggagggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagctggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
agcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A076FU27_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccagagccgcgggcgccgcgccccccggggccgcccccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatatgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A076FZV9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccggagccgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A452E1B1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagtttttccagaaaggatacagctggagtcagtt
tagtgatatggaagagaacagaactgagaccctagaagggacagaatcagatatggaaacccccagcgccatcagtggca
acccatcctggcacctggcagatagctctgtggtgaatggagccactggtcacagcagaagcttggacgctgggaaaatg
atccccacggcagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggacaacatatcagagctttgaacaggtaataaatgaactcttccaggatg
gggtgaactggtgtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaaagcatagtcaaggagatgcag
gtattggtaagtcaggtcacgacttggatggccacttacctaaataaccacctagagccttggatccaggagaatggcga
ctgggacatttttgtggaactctacgaaaacaatacagcaaccgagagccaaaagggccaagagcacttcaaccgctggt
ccctgacggacgtgactgtggctggtatggctctgctgggcttgctcttcaacacataa
>gnl|bcl2dbcds|A0A452ECF0_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Capra hircus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggttcggcccagcagcgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaaccgtagg
ggcctttttcgctagcaagtga
>gnl|bcl2dbcds|A0A452EK63_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Capra hircus GN=BCL2A1 (length=528 residues).
atgactgacactgagtttgactacgttcacaagctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaacatccagggtgttacaagacgtggcttcctctgtccaggacgaagtggaaaggactttgaagc
agtgcttggataagtttgatgtggtgtctgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgagcaagcg
tattgcctcagacatggacatgtgcaaggacatttcttatttcgtggcggagtttatcaccgaaaacacaggagagtgga
taaggcaaaacggaggctgggaaaatgggtttgtaaagaagtttgaaaccaaatctggctggctgacttttctggaagtt
acaggaaagatctgtgaaacattatgtcgtctgaagcaatactattga
>gnl|bcl2dbcds|A0A452EV13_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccggagccgcgggcgccgcgccccccggggccgcccccgcgccgggcatcctgtcctcccagccgg
gccgcgcgcccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A452FHY1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgagagctggtggttgactttctctcttacaagctttcccagaaaggattcagctggagcctcag
aagggacaaaatcagatatggaaaccccaatgccgtcaatgccaacccatcttggcacctggcgcatagccctgcggtga
atggagccactggccacacagaagaaagtggtcctgtggcaacagcacagcaagccccgagggaggcaggcagcgagttt
gaactgaggcaccaacagacggtcagcgacctgacgtcccagctccacaccaccccagggacagcatatcagagctttga
acaggtaatgtatgagctcttctgggacggggtgaactgggatcacactgtggcctttttctccttcaggggggcactat
gcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggatggccagccagctaaatgaccac
ctagagccttggatccaggagaatggcggctgggacacttctgtggaattctgtgaaaacaatacagcaaccgagagcca
aaagggccaggagcgcttcaactgctggtccctgacggctgtgactttggctgggggatcaggactcagcaggaaggcag
ctgtctctaaagataccccttggctcaccttcccctctccccatgctcaagcctactga
>gnl|bcl2dbcds|A0A452FHY1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=723 residues).
atgtctcagagcaaccgagagctggtggttgactttctctcttacaagctttcccagaaaggattcagctggagcctcag
aagggacaaaatcagatatggaaaccccaatgccgtcaatgccaacccatcttggcacctggcgcatagccctgcggtga
atggagccactggccacacagaagaaagtggtcctgtggcaacagcacagcaagccccgagggaggcaggcagcgagttt
gaactgaggcaccaacagacggtcagcgacctgacgtcccagctccacaccaccccagggacagcatatcagagctttga
acaggtaatgtatgagctcttctgggacggggtgaactgggatcacactgtggcctttttctccttcaggggggcactat
gcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggatggccagccagctaaatgaccac
ctagagccttggatccaggagaatggcggctgggacacttctgtggaattctgtgaaaacaatacagcaaccgagagcca
aaagggccaggagcgcttcaactgctggtccctgacggctgtgactttggctgggctcgctcttcaactcatagtgactg
ttcctttcattacagtcattcatgttttgcacaagcttgtgttcccttccttttgttacagctatagagaccttacaatt
taa
>gnl|bcl2dbcds|A0A452FWV3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcttggcacctggcggatagccctgcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacattaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacgtttgtggaactctatgggaacaacgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A452GA25_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcct
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A452GA25_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1008 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcgcgccggcccgagccccccggccactcttg
cgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagggccccgacgtcaccgcgacccccaccagactg
ctgttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgccatcatgtcgcccga
agaggagctggacgggtgcgagccagaccctctcgggaagcggcctgccgtccggcctttagctttgatggtcggagaag
ccagtaacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatcagaggaggaggaggacgagttatat
cggcagtccctggagattatctctcagtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtc
tggggccaccagccggaaggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagacggctttcc
aaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatggttcatgttttcagt
gacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaa
tcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaac
aaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttt
gcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A250YBR2_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Castor canadensis GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggagagggcccagctgctgacccgttacaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcacattctctgatctggcggctcagctacatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagcatcaacaaagagatggaaccactggtgggacaagtacaggagtggatggtggcctacctggagacacgcc
tagccgactggatccacagcagtgggggctgggcggagttcacagctctgtacggggacggggccctggaggaggcgcgg
cgcctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A250YBR2_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Castor canadensis GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggagagggcccagctgctgacccgttacaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcacattctctgatctggcggctcagctacatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagcatcaacaaagagatggaaccactggtgggacaagtacaggagtggatggtggcctacctggagacacgcc
tagccgactggatccacagcagtgggggctgggcggagttcacagctctgtacggggacggggccctggaggaggcgcgg
cgcctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A250YD48_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Castor canadensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaataggactgaggccccagaagggattgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatgacagcagtgaagcaagcgctgagggaggcaggtgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacataaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggctacttacctgaatgaccacctagaaccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A250YD83_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Castor canadensis GN=BCL-2 (length=720 residues).
atggcgcaagctgggagaacagggtatgataaccgggagatagtgatgaaatacatccactataagctgtcacagagggg
ctacgagtgggatgccggagacgtgggcgccgcgcccccggaggccaccccagcgccgggcatcttctccttccagcccg
ggagcaaccccctgcccgctgcgccccgggaccgggccgccaggaccacgtcgctgccgcccccggtcgcccccgccgcc
cgcgccgggcctgcgctcagcccagtaccacctgtggtccacctgaccctccgccaggctggcgatgacttctcccggcg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcctctggtggacaacatcgccttgtggatgattgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagtgtgcgacctctgtttgacttctcct
ggctgtctctgaagactctgctcagcctggccctggtgggagtctgtatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A8C0WAG3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Castor canadensis GN=BCL2A1 (length=627 residues).
atgtgccccactcccgccaagctcggcgagccctggcttcagtccgccgcagctgccccggtgagcggctgcagcccgcg
cggcacctgctgcgggaagatgagcgagggcgagttcgccttcacgcatgcgctggcccaggactacctgcgccacgtgc
tgcaggtgcagcccgccggcctgggggccagcaaggcggcccgagtgctgcgagacgtcgccttctccatccaagaagaa
gtggaaaagagtctgcagccatacttggacaaatgtgatgtggcgtccgtagatactgccagaaccatattcaatcaagt
gatggaaaaggaattcgaagacggcgtcattaactgggggaggattgtgaccatatttgcattcggaggagttctcatca
agaaacttctacgagagcggattgccccagatgtggatacttacatggagatttcttactttgtggctgagttcatagtg
aataacacaggagaatggataaagcaaaacggaggctgggaaaatggctttataaagaagtttgaacctaagtctggctg
gctgacttttctggaagtcatagaaaagatctacgacatgctgtccctcctgaggctatactattga
>gnl|bcl2dbcds|A0A8C0WJK2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Castor canadensis GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcggtaatcggactcaacctctactgtgggggtgctgggctgggggccggtagcggcgg
cgccaccacccctccgcgagggcggcttctggccgcggaggaggcctcggcccggcgagaggtagggggaggggaagccg
gtgcggtgattggcggcagcgcaggcgcgagccccccggccgccctggcgcaggacgcccgaagggtcgcgcggccggcg
cccattggcgccgagatccccgacgtcactgcgacccctgcgaggctgctgttcttcgcgcccacccgccgtgcgtcgac
gcctaaggagatggaagccccggcctccgacgccatcatgtcgcccgaagaggagctggacggctacgagccggagcctc
tcgggaagcggccggctgtcctacccttgctggagttggtcggggaggccactaagagccccagcgcggacgggtcactg
ccctcaacgccacccccagcagaggaggaggaggacgaattgtaccggcagtcgctagagattatctgccggtaccttcg
cgagcaggccaccggcgccaaggacgccaagccaatgggcgggtctggggcggccagcaggaaggcgctggagaccctgc
gacgggtcggcgacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgag
gacgatgtcaaatctttgtctcgagtgatgatccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C0XBQ2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Castor canadensis GN=BCL2L10 (length=567 residues).
atggcggacccgctgcgggagcgcaccgagcggctgctgaccgactacctgcagtactgcgcccgggagcccgagccggg
cgcccccgagccgcccccgtccacgcccgaggccgccgtgctgcgcgccgccgccacccggttacggcgtcgccactggg
ccttcttctcccgctacatcggctaccagggcaatcgcgtcgagctgatggcgcggatggccgaagctacgttctccgac
aaccgcggcctcaactggggccgcgtagtgacgctcgcggccttcgcggggacgctgctggagagagggccgtcggtggt
cgccgagtggaagacgcgccacgaagttgcccgggactgtccgcgcctggtggccttgctgtgcgctcggctcgtgggac
agcaccgtgcctggctggaggctcaaggcggctgggatggcttttgtcagttcttcaggacacccttaccactcactttt
tggagaagacggttgatctggactttcctgtcatgctttttagcaacggccttaatgtatttctggacacagttacataa
gttctaa
>gnl|bcl2dbcds|A0A1L5BWY3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Castor fiber GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaataggactgaggccccagaagggattgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatgacagcagtgaagcaagcgctgagggaggcaggtgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacataaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggctacttacctgaatgaccacctagaaccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C3W949_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Catagonus wagneri GN=MCL-1 (length=1095 residues).
atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgggggggccggactggggccgggtagcggcag
cagtgcctccgctccgggagggcgcctcttggctgcgggaaaagaggccacggcccagagagaggtagggggaggggaag
ccggcgcggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagatgcccggagggtcgcgcggccc
tcgcccattggcgccgagggcccagacgtcaccgcgacccccgccagactggtgttcttcgcgcccacccgcctcgcgtc
gccgcccgaagagatggactccccggcctccgacgccatcatgtctcccgaagaggagctggacggctacgagccggagc
ccctcgggaagaggccggccgtcctgcccttgctggggttggtcgaggaggccagtagtggccccggcacggacggctca
ctcccctcgacgccgcccccggcagaggaggaggacgacgagttgtaccggcagtccctagagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtgcggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggtgtggtcctttaaaaacaag
ttctacagctatgttttggagcagaggagacgcaacaggacttctgtggctgggcagagtgagaattcaaccagatggaa
gaaatcccagggacttagacttaggtactttcctgaggctttctacttcctgtaa
>gnl|bcl2dbcds|A0A8C3W949_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Catagonus wagneri GN=MCL-1 (length=1056 residues).
atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgggggggccggactggggccgggtagcggcag
cagtgcctccgctccgggagggcgcctcttggctgcgggaaaagaggccacggcccagagagaggtagggggaggggaag
ccggcgcggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagatgcccggagggtcgcgcggccc
tcgcccattggcgccgagggcccagacgtcaccgcgacccccgccagactggtgttcttcgcgcccacccgcctcgcgtc
gccgcccgaagagatggactccccggcctccgacgccatcatgtctcccgaagaggagctggacggctacgagccggagc
ccctcgggaagaggccggccgtcctgcccttgctggggttggtcgaggaggccagtagtggccccggcacggacggctca
ctcccctcgacgccgcccccggcagaggaggaggacgacgagttgtaccggcagtccctagagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtgcggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|A0A8C3W949_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Catagonus wagneri GN=MCL-1 (length=597 residues).
atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgggggggccggactggggccgggtagcggcag
cagtgcctccgctccgggagggcgcctcttggcaaccggcgccaaggacgcgaagccaatgggcgggtgcggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagacggctttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C3WCN0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Catagonus wagneri GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagacgcgggcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccagcccg
ggcgaacccccgcgcccgccaggacctcgccgccaccgcccccgaccgcccccgccgccgccgcggggcctgcgctcagc
cccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctctcgtcgctaccgccgagactttgccga
gatgtccagccagctgcacctgacacccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatagccctgtggatgactgagtacctgaaccggcacctgcacacttggatccaggataacggagg
ctgggacgcctttgtggagctgtatggccccagcatgcggcctctgtttgatttctcctggctgtctctgaaggcgctgc
tcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C3WEA1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Catagonus wagneri GN=BCL2A1 (length=528 residues).
atgacggacaacgaatttggatatattcacatgctggcccaggactatctgaactatgttcttcagataccacagcctgg
atctggtccaagcaaaacgtccagagtgctacaagacgttgctttctccgtccaaaaccaagttgaaaagaatttgaaac
cttgcttggacaattttgatgttgggtccatagacacggccaggataatattcaatcaggtgatggaaaaggaatttgaa
gacggcatcatcaactggggaaggattgtgactgtatttgcatttgaaggtattctcatgaagaaacttctgcgaaagca
aattgcctcagatgtggacacttacaaggagattccttactttgtcgcggagttcatcaccaaaaacacaggacagtgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacccttctggaagtt
actggaaagatctgcgaaatgttatgtgtcctgaagcaatactattga
>gnl|bcl2dbcds|A0A8C3WJH5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Catagonus wagneri GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcggtgaagcaagcgctgagggaggcgggtgatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacgtggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagtcggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgacactagctggcgtggttctgctgggttcgcttttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C3X592_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Catagonus wagneri GN=BCL2L2 (length=582 residues).
atggcgaccccggcctcagccccagacactcgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgtaccttctcagatctggcgtctcagttgcatgtaaccccagggtcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtcttcggagctgcgctgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtgacctacctggagacgcggc
tagccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C3TNF2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Catharus ustulatus GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcccagagggg
atacgactgggctgccggtgaggacagggcacccctgcctccaggtctctctgctcctgctgctgctgcggttgctgctg
ctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcg
cccctggccgaggggctgcgccccgcaccccaggtcgtccaccttgtcctgcgccaggcgggggatgagttctcccgacg
ctaccagagggactttgcccaaatgtctggccagctgcacctgacgcccttcacggccaggagccgcttcgtggccgtgg
tggaggagctcttccgagatggggttaactggggcagaattgtggccttcttcgagttcggtggtgtgatgtgtgtggaa
agcgtcaaccgggagatgtctccgctcgtggacagcatcgctgcctggatgactgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8C3U3Q2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Catharus ustulatus GN=BCL2L1 (length=696 residues).
atgtacagcagtaatcgggcgttagtgattgactttgtttcctacaagctctcccagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggcgtcctcaacgggagcccctcct
ggcacgcacccaccagccacatagtgaacggagcctccgtgcaccagagcagcctcgaagcccatgagatccgtcgagca
cccgacgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcac
ttcccagctccacatcactcccagcacagcatatcagagctttgagcaggtagtgaacgaactgttccgagatggagtga
actggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattg
gtgaaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatggga
gcgctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctga
ctggggcgacggtggccggagtgcttctgctgggatcgctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C3U920_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Catharus ustulatus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttagctcaggattatctgcagtatgtgctccaggaatcccacctggg
accagcccagaccagggttgctcatgtcctgcgaaccatggcatcttccttgcaagaccaaaccgaggaggctctcaggc
cactcctggacaggattgacatcacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaaagtttgct
gatggaaatactaactggggaagaattatgaccatatttacatttggaggtcttctcaccaagaagcttcaagagcatgg
ggttcagctgactgcagaggagaaggaggagatctcttatttcatcacagagtacatcatcaacaacaaatccgaatgga
ttggtgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gccctgttcatagctgttgtttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8C3UEV5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Catharus ustulatus GN=MCL-1 (length=585 residues).
atgctcggtgctgcagaaccgagagcgaagctggctgagccgggggaggggacacacgtggccgcagggatggggatggg
gatggggacgctttttccgggactcctgggtggtcccgaccggcccggcgcggcgggggatgctgtgatggagaaggcgc
tggagacgctgcggagggtcggtgatggagtgatgcagaaacacgagctcgcttttcaagggatgctgcggaagctggaa
atccagcaggaggaggacctgcagtcggtggtggaggtggctgcacacctgttcagcgacggggtgaccaactggggacg
agtggtgaccctcattgcctttggagccttcgtggccaagcacctgaagagcatcaagcaggagcagagcatcagttccc
tggctgggatcatcacggacgccctggtgtcgtccaagcgccagtggctggagagccaggggggctgggatggctttgtg
gactttttccgagtggaggacctggagggcagcatcaggaacgtgctgatggcgtttgcaggagtggctggcctgggggc
cagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A286XQQ9_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggggatgagttcg
agacccgattccggcgcaccttctctgatctggctgctcagctgcatgtgacccctggctcagcccagcaacgcttcacc
caggtctccgacgaacttttccaaggtggccccaactggggccgtcttgtggccttctttgtctttggcgctgccctgtg
tgctgagagtgtcaacaaagagatgcaaccactggtgggccaagtgcaggagtggatggtggcctacctggagacgcgcc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A286XUI2_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cavia porcellus GN=BCL2A1 (length=609 residues).
atgggtcacatcctgctcagcgccactgctggcagtctcgatctgcgcgagccagcagcaggctgctgtctgccgcccag
gatgattgacctggagttcaggtacacgcaggctctggcccaggactacctgctccacgtcctgcaggtgcctcagtgcg
agaccagccccagcaaggcatccaaggtgctgcaggacatggccctttccgtccaggaagaggtggagaggcggctgaaa
ccgtggctggacagaattgacgtggagtccatcgacactgcgaagtcgatattcaaccaagtgatggagaaggagttcga
ggatggcatcattaactggggacggattgtgactatctttgcttttgggggggtcatcctcaagaaactcccacgagagc
caatcgccccagatgtggacacttacaaggagatttcctacttcgtggctgagttcataatgagccgcatgggaggctgg
atacggcagaacggaggctgggacaacggcttcgtgcggaagtttgagcccaaatctggctggctgacttttgtgggagt
tatgggacagctctgtgagatgctctctctcctgaagcaattctactga
>gnl|bcl2dbcds|A0A286Y1M5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cavia porcellus GN=MCL-1 (length=702 residues).
atgtcgcctgaggaggagctggacgggtacgagccggagcccctcgggaagcggccggccgtgctgcccttgctggggct
ggtgggggaggccgggaagagccccagcgccgacggttcgctgccctcgacgccgcccccggcggaggaggaggaggagg
aggacgcgctgtaccgacagtcgctggagatcatctcgcggtacctgcgggagcaggccgcgggcgccaaggactcgaag
ccgctgggcggggtggggcccaccagcaggaaggcactggagaccctgcggcgggtcggggacggcgtgcagcgcaacca
ccagaccgccttccaaggaatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatccttgtcgcgagtggttg
cccttgttttcagtgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacac
ttgaagagcataaaccaagaaagctgcatcgaaccattagcggaaagtatcacagatgctctggtgcactcaaaaaggga
ctggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatatagaggatctagaaggcggcatcagaaatg
tgctgctggcttttgcaggtgttgctggagtaggggctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A286Y5D6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L1 (length=702 residues).
atgtctcaaagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaaggcccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctaactgatagtcccacggtgaatggggccactggccacagcagtagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctcttagggaggcgggcgatgagtttgaacttcggtaccggcgagcattcagcga
cttaacatctcagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggctacttacctgaatgaccacctagaaccttggatccaggacaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tgctgacgggcgtgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|H0W1T3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cavia porcellus GN=BCL-2 (length=549 residues).
atggctcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcccagagagg
ctacgagtgggatgccggagacgggagcgcactgggtcgcaactccccgcttggtgtgccccgggacccggccgccagga
cctcgccaccgccacccctggccggcctcgccgtcgcccaggggcctgcgctcagcccggtgccacctgtggtccacctg
accctccgccaggccggcgatgacttctcccgccgctatcgccaagacttcgctgagatgtccagccagctgcacctgac
gcctttcaccgcgaggggacgctttgccacgctcttcagggatggggtgaactgggggaggattgtggccttctttgagt
tcggtggggtcatgtgtgtggagagtgtcaaccgggagatgtcacctctggtggacaacatcgccctctggatgactgag
tacctgaaccggcacctgcacacctggatccaggataacggaggatgggtaggtgcatgtttgagtgag
>gnl|bcl2dbcds|A0A2K5KHH8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K5KHH8_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagcttgagcctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctctctcttctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K5KHH8_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaggaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatccttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatccttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5M8B1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5M8B1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtgaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5MMZ4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccgcgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaacactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K5MZX9_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggttcgggagcccccggcagccaagaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
gatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccg
cgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5MZX9_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5MZX9_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L2 (length=813 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggaccaagaggaggaggaggagccgggactggtcgagggtgacccgggggacggcgccattgaggac
ccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaagctaaaggagctacagaacgaggt
agagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
atgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaagctcactttcatggctgtgga
tcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcgtatatagagttctcagacaa
agagtcagtgaggacttccttggccttagatgagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaacca
acagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgcccggaccaccaactacaacagttcc
cgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctacaggggccgggctagagcgacatcatggta
ttccccttactaa
>gnl|bcl2dbcds|A0A2K5MZX9_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K5NZS5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cercocebus atys GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggtcgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A0D6DR75_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Channa striata GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggtttactacataacatataaactgtcggagaaaaactatcctctcaaccacttggg
actcagtgagcctccaaacaggactgatggaggggaggttgagtccgctgaggaacagcggatagcgacgcacgccaacg
gtacttttaacggaagaagtcctggaacccccccagcatccccgctcaggcaacaacggttgccatcaccgacgagcctg
gatgcggtgaaagaggccctccgggactcagccaatgagtttgagctgcgatatgcccgcgccttcagcgatctgcacaa
ccagctgcatatcacgcccgccacggcctaccaaagctttgcgaacgtcatggatgaagtgttccgggacggcgtcaact
ggggccgcatcatagggctctttgcatttggtggggcactgtgtgttgagtgtgtggagaaggagatgagtcagctggtg
gtcaggatcgtagagtggatgacagtgtacctggacgaccacattcagccctggatccaaagtcaaggaggatgggagca
ctttgctgaaatcttcgggcatgatgcagctgcagagagcaggaggtctcaggagagtttcaagaagtggctgctggcgg
ggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A8C0G2Q6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BCL-2 (length=702 residues).
atggctcatcctgggagaagaggctatgataaccgagagatagtgctgaagtacatccattacaaactgtcacagagggg
atatgattgggctgccaatgaaaacagaggaccagtttctccaaatctctctccccctcctgctactgggacctcatctg
accatgctgggctggtctctttgcctcctgagccccctggctcggctgctgctagtaacgtgccccttggtgatgggctg
cacccagcaccgcaggctgttctcttggctctgtgccaagctggagatgaattttcccgtcgctaccacagagattttgc
ccagatgtctggccagctgcacttgaccccattcacggccagggggcgctttgtggcagtggtggaggagctgttccgag
atggggttaactggggaaggatcgtggccttctttgaatttggtggtgtgatgtgcgtggagagcgttaatcgggagatg
tcgcctcttgtggacagcattgctgtgtggatgaccgaatacctgaacagacacctacacaactggatccaggacaacgg
aggctgggatgcctttgtggaattatacggcaggaacatgaggcctgtgtttgatttctcctggatctctttgaagacta
tcctaagtctggctctggtgggagcatgcatcaccctgggcgcttatctgggacataagtga
>gnl|bcl2dbcds|A0A8C0G393_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BCL2A1 (length=528 residues).
atggaaagctctgagtactgctatgtttactatttagtccaagattatctgaaatacattcttcaggaaccacagcttgg
accagctccaagcagagttgctcatgtcttaagacacgctgcatcctttctgcaaaaggaaaatgaagaaagtctgaaac
catgtttggacacacttgatattacctctgtagatgctgccagaagaattttcactcaagtcatggataaagaatttgct
gatggaaacactaactggggacggattttgacaatatttatgtttggaggaattatttctaagaagcttcaagaacacag
agttcagcttacaggagaaaataaaaagcagatttcttatttcatcacggagtacattataaacaccaaggctgagtgga
tagaggcaaatggaggttgggaaaatggcttcctaactatgtttgaggaaaaacgatcatggctgtccttattcaatatt
aaagcaaaaatcatggatgctttttccttcttcagtcagtactattga
>gnl|bcl2dbcds|A0A8C0GRW6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=MCL-1 (length=579 residues).
catgttggcgttaaagcggaacgcggtgatcgcctcaacttgtactgcgggggcggccacgctgccccctccgcgccggc
ctccccagcggcgcggggacccctccgccccggccctgcggaggagggccgggccccgcgcatggagaaggcgctggaga
cgctgcggagggtcggcgacggcgtcattgagaagcaccagatcgccttccaagggatgcttcggaagctagacatcaag
aatgaggatgatctgaagtcagtgactgccgttgcaacccatgttttcagtgatggagtaacaaactggggtagaattgt
gacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagaattgcatcaacacactagcag
ggatcatcacagatgtgcttgtcacaggcaaacgagattggctagttaaccaaagaggctgggagggatttgttgaattc
ttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgcaggctttgctggactgggagcaagctt
agcctacatgatgcgatga
>gnl|bcl2dbcds|A0A8C0IVL6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgactttctctcctacaagctatcgcagaggggatacagctggagtcggtt
tgaaggggaggatgagatcaggactgattctgcagaagaggctgagatggcaagtgtccctaatgggagtccatcctggc
atccgggtgccagccacatagtgaatggggctgctgggcacagtaacagccttgaagcccatgaaagggttccagcaacg
ggagtgaggcaggcgctgagagaggcaggagatgagtttgaattgagatatcggagggctttcagtgacctcacttccca
actccatatcacccctggcacggcataccagagctttgagcaggtagtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcgtggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggatctctatgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcaggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3RIU8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chelydra serpentina GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgactttctctcctacaagctttcgcagaggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaggaggctgagatggcaagcgtccctaatgggagtccatcctggc
atccgggtgccagccacatagtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggccact
ggagtgaggcaggcgctgagagaggcaggcgatgagtttgaattgaggtatcgaagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtagtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcattgcctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcgctt
tgtggatctctatgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcaggcgtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3RME9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Chelydra serpentina GN=BCL2A1 (length=558 residues).
atggaaagctctgagtaccgtaatgtttactatttagtccaagattatctgaaatacattcttcaggaaccacagcttgg
accagccccaagcagagttgctcatgtcttaagaaacgctgcatcctttctgcaaaaggaaaatgaagagagtctgaaac
catgtttggacacacttgatattacctctgtagatgctgccagaagaattttcactcaagtcatggaaaaagaatttgct
gatggaaacactaactggggacggattttgacaatatttatgtttggaggaattctttctaagaggcttcaagaacacag
agttcagcttacaggggataataaagagcagatttcttatttcatcacggagtacattataaacaacaaagctgagtgga
tagaggcaaatggaggttgggtaagtttcagtgctgtattttataaccatttttcactgctgtctagatcagaagaattt
tccttaataaatgttcttttaactactgtcaaaaagaatcatcaacttagccagggctttatcatttgctttatttaa
>gnl|bcl2dbcds|A0A8C3SV21_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chelydra serpentina GN=BCL-2 (length=702 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgctgaattacatccattacaaactgtcacagagggg
atatgattgggctgccagtgaaaacagaggaccagtttctccaaatctctctcctcctactgctgctgggacctcatctg
accctgctgggctggtgtctctgcctcctgagccccctggctcagctgctgctagtaatgtgccccttggtgatgggctg
cacccagcaccgcaggctgttcacttgactctgtgccaagccggagatgaattttcccgccgctaccacagagattttgc
ccagatgtccggccagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgag
atggagttaactggggaaggatcgtggccttctttgaatttggtggcgtgatgtgcgtggagagcgtcaatcgggagatg
tcgcctcttgtggacagcattgctgtgtggatgaccgagtacctgaacagacacctacacaactggatccaggacaacgg
aggctgggatgcctttgtggaattgtacggcaacaacatgaggcctttgtttgatttctcctggatctctttgaagacta
tcctaagtctggctctggtgggagcttgcatcacccttggcgcttatctgggacataagtga
>gnl|bcl2dbcds|A0A8C3T6A5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chelydra serpentina GN=MCL-1 (length=996 residues).
atgttggcgttaaagcgcaacgcggtgatcggcctcaacctgtactgcgggggcggcccggcgctggcgccccccccgcc
ggcctccccgagcggcgcgggaacccctcccgcccccggcgcgcgggaccccggcccttcggcggagggcgcccggccgg
cgacgctgattggcggagccgcttgggcttccaacggtcactctgaggggccccgggcgctgattggcgaggcgccccgc
gcgcggagcagctcccccacgaccccccctgcgctggtggccggggggccccggccgggcccgctgtggcggccggaaga
ggagctggacggctgcgaccccgacgccgagaggatgggcccgccggccgctgccgctggcggctccttgcccagcaccc
cgcccgcggacgacgacgacgacctggacgggctgtaccaggactcgctggagctcatcagccgctacctgcgggaggcc
gcggagctcgccgggcccggcggcaagaagctctacaagcggctgctgagcgggccgcggggggcgggccccgccgccat
ggagaaggcgctggagacgctgcggagggtcggcgacggcgtcattgaaaagcaccagatcgccttccaagggatgcttc
ggaaactagacatcaagaataaggaggatctgaagtcagtgactgctgttgcaacccatgttttcagtgatggagtaaca
aactggggtagaattgtgacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagacttg
catcaacacactagcagggatcatcacagatgtgcttgtcacagacaaacgagattggctagttaaccaaagaggctggg
agggatttgttgaattcttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgcaggctttgct
ggactgggagcaagtttggcctacatgatgcgatga
>gnl|bcl2dbcds|A0A8C3TAL3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chelydra serpentina GN=MCL-1 (length=579 residues).
atgttggcgttaaagcggaacgtggtgatcagcctcaacctgtactgtgggggcggcccatcgctggcgccctccccgaa
cggcgtgggaacccctcccgccccccggctgctgagtgggccacggggggcaggccccgccgccatggaaacggcgctgg
agatgctgcggagggtcggcaacggcgtcattgagaagcaccagatcgccttccaagggatggttcggaagctagacatc
aagaatgaggaggatctgaagtcagtgacggctgttgcaacccatgttttcagtgatggagtagcatggggtagaattgt
gacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagacttgcatcaacacactagcag
ggattatcacagatgtgattgtcccaggcaaacgagattggctagttaaccaaagaggctgggagggatttgttgaattc
ttccgtggagaggatctagaaggtagcatcaggaacgttctggtggcttttgcaggctttgctggactggaagcaagttt
ggcctgcatgatgcaatga
>gnl|bcl2dbcds|A0A8C2UN30_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2A1 (length=528 residues).
atgattgaccaggagttcaggtacacgcaaactctggcccaggagtacctgctgcacgtcctgcaggtgccgcagtgcgg
ggccagccccagcaggacgtccagagtgctacagggtgtggctttctcagtgcagaaagaagtggaggagagcctgaagc
cgtggttggacagatgcgatgtggcgtccgtcaacgctgccagggcgatattcacccaggtgatggagaaggagttcgag
gacggcatcattaactgggggcggattgtgaccatatttgcttttgggggagtcatcctcaagaaacttccgcgagagcc
gctggccccagatgtggacacttacagggagatttctcactttgtggctgagttcgtagtgaaccacacgggagactgga
tccggcagaacggaggctgggaaaacggctttgtgaggaagtttgagcccaaatttggctggctgaccttcgtgggagtt
ctgggacagatctgtgagatgctgtccctcctgaagcaattctactga
>gnl|bcl2dbcds|A0A8C2VJ88_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagttcg
agacccggttccggcgcaccttctcagatctggctgctcagctgcatgtgacccctggctcagcccagcagcgcttcacc
caggtctccgacgaacttttccaagggggccccaactggggccgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagagatggaaccactggtgggccaagtgcaggagtggatggtggcctacctggagacgcgcc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C2VJ88_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L2 (length=507 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagttcg
agacccggttccggcgcaccttctcagatctggctgctcagctgcatgtgacccctggctcagcccagcagcgcttcacc
caggtctccgacgaacttttccaagggggccccaactggggccgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagagatggaaccactggtgggccaagtgcaggagtggatggtggcctacctggagacgcgcc
tggccgactggatccacagcagtgggggctggccctctgcaaagctgatctccagggggaagatgggggctctgattggc
agctgggacagctgtgctaggaaggag
>gnl|bcl2dbcds|A0A8C2VKS3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagaggagagcgccgcgccccccggggccgcgcccacgccgggcatcttctccttccagcccg
ggcgcaactccccggccgctgcgccccgggacccggccgccaggacctcgccgccgccgccgctggccggcctcgccgcc
gccgcgggacctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgtcg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctctggatgacagagtacctgaaccggcacctgcacac
ctggatccaagataacggaggctgggacgcctttgtggagctgtatggacccagtgtacggcctctgtttgacttctcct
ggctgtctctgaagactctgctcagcctggccctggtgggagcctgcatcacgctgggtgcctacctgggacacaagtga
>gnl|bcl2dbcds|A0A8C2YUU6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L1 (length=702 residues).
atgtctcagagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
cagtgatgtggaagagaacaggactgaaggcccagaaggggctgaatcagagacggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccgcacggtgaatggggccactggccacagcagcagtttggatgcccgcgaggtg
atccccatggcagcagtgaaacaagctctgagggaggcgggcgacgagtttgaactgcggtaccggcgagcattcagtga
cctaacatctcagctacacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacgtttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgaccgtggccggcgtggttctgctggggtcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C2YUU6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L1 (length=702 residues).
atgtctcagagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
cagtgatgtggaagagaacaggactgaaggcccagaaggggctgaatcagagacggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccgcacggtgaatggggccactggccacagcagcagtttggatgcccgcgaggtg
atccccatggcagcagtgaaacaagctctgagggaggcgggcgacgagtttgaactgcggtaccggcgagcattcagtga
cctaacatctcagctacacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacgtttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgaccgtggccggcgtggttctgctggggtcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C2YUU6_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L1 (length=702 residues).
atgtctcagagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
cagtgatgtggaagagaacaggactgaaggcccagaaggggctgaatcagagacggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccgcacggtgaatggggccactggccacagcagcagtttggatgcccgcgaggtg
atccccatggcagcagtgaaacaagctctgagggaggcgggcgacgagtttgaactgcggtaccggcgagcattcagtga
cctaacatctcagctacacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacgtttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgaccgtggccggcgtggttctgctggggtcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A0D9RG38_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L10 (length=582 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagcccaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggacgccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctgatgacagcctg
gtggaagaagcagagcttccagccgcggctggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
tgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcaaggcggctgggatggcttttgtcacttcttcagg
agcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcggtta
tctctggacaagattattatga
>gnl|bcl2dbcds|A0A0D9RJZ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaaacgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A0D9RRC3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgtcctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcatcctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataacgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A0D9RU30_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A0D9RZP5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggctcggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgctggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgagcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A0D9S017_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
>gnl|bcl2dbcds|A0A8C3EZ48_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=MCL-1 (length=666 residues).
tgtgctggggggtgctcccccagttcacccagaccctgccccactccactgcttccccccaggccccacctctgtcccac
tccatccccactccactgctgccctgcctcttcccgtcccgttctaccccatcccgagtgcaccctgccctcactcctcc
cacccagtgcctcctacacactggatcatggcaggcaggaggtcggcgatggcgtcattgagaagcagcagatcaccttc
caagggatgcttcggaagctagacatcaagcatgaggaggatctgaagtcagtaactgctgttgcaacccatattttcaa
tgatggggtaacaaactggggtagaattgtgacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataa
accaggagaattgcatcaacacactagcagggatcatcacagatgtgcttgtcacaggcaaacgacattggttagttaac
caaagaggctgggagggatttgttgaattcttccgtgtagaggatctagaaggtagcagcatcaggaatgttctggtggc
ttttgctggactgggagcatccttgttgagaggatttttttttttttttaaaagcagtggttataaatgttcaggcctga
gtctccattgcataatgcagcagtga
>gnl|bcl2dbcds|A0A8C3FIW3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2A1 (length=528 residues).
atggaacgctctgagtactgttatgtttaccatttagtccaagattatctgaaatacattcttcaggaaccacagcttgg
accagccccaagcagagttgctcatgtcttaagaaatactgcatcctttctgcaaaaggaaaatgaagagagtctgaaac
catgtttggacacacttgatattaccactgtagatgctgccagaagaattttcactgaagtcgtggataaagaatttgct
gatggaaacactaactggggacggattttgacaatatttatgtttggaggaattctttctaagaggcttcaagaacacaa
agttcagcttacaggagataataaagagcagatttcttatttcatcaccgagtacattataaacaacaaggctgagtgga
tagaggcaaatggaggttgggaaaacggcttcctacctatgtttgaggaaaaacgatcatggctgtccttattcaacatt
aaagcaaaaatcatggatgctttttccttcttcagtcagtacttttga
>gnl|bcl2dbcds|A0A8C3H9M3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=MCL-1 (length=597 residues).
atgttggcgttaaagcggaacgcggtgatcggcctcaacctgtactgcgggggcggcccgacgctgcccccgtccccgcc
gggctccccgagcggcgccgggacccctcccaccccgggccggctgctgagcgggccgcggggagcgggccccgccgccc
tggagaaggcgctggagacgctgcggagggtcggcgacggcgtcatggagaagcaccagctcgccttccaagggatgctt
cggaagctagacatcaagaatgaggaggatctgaagtcagtgactgccgttgcaacccatgttttcagtgatggagtaac
aaactggggtagaattgtgacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagaatt
gcatcaacacactagcagggatcatcacagatgtgcttgtcacaggcaaacgagattggctagttaaccaaagaggctgg
gagggatttgttgaattcttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgcaggctttgc
tggactgggagcaagcttggcctacatgatgcgatga
>gnl|bcl2dbcds|A0A8C3ITE1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL-2 (length=759 residues).
atgtatttaattgcatgtgtctgtacgttgcactggagggaaaagcacagcacttctgcaagagcttggagtcaaagagg
ctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagaggggatacgattgggctgccaatgaaa
acagaggaccagtttctccaaatctctctccccctactgttgctgggacctcatctgaccatgctgggctggtgtctctg
cctcctgagccccctggctcggctgctgctagtaacgtacctcttggtgatgggctgcgcccagcaccgcaggctgttct
cttgactctgtgccaagctggagatgaattttcccgccgctaccacagagattttgcccagatgtctggccagttgcact
tgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgagatggggttaactggggaaggatc
gtggccttctttgaattcggtggcgtgatgtgcgtggagagcgttaatcgggagatgtcgcctcttgtggacagcattgc
tgtgtggatgaccgagtacctgaacagacacctacataactggatccaagacaacggaggctgggatgcctttgtggaat
tgtacggcaacaacatgaggcctttgtttgatttctcctggatctctttgaagactatcctaagtctggctctggtggga
gcttgcatcacccttggcgcttatctgggacataagtga
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=690 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcgggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=690 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcgggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=690 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcgggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=711 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggagccatctgctgtccc
attgcgtctcgctgcagcggccaaggccccgtctcgacgctggctgtgcccagcccagggcactcggctag
>gnl|bcl2dbcds|A0A8C3KTI3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Chrysolophus pictus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctactatgtttattatttagctcaagattatctgcagtatgtgcttcaggaatcacatcttgg
accagcccaaaccagagttgctcatgtcttgcgaaacattgcatcctcactccaagatcagacagaggaggctctcagac
ccttcctggacaggatcgatattacctccgtagatgttgccaagagaattttcaatggagtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacttttggaggtcttctcaccaagaagcttcaagagcatgg
agttcagctcactggagaggagaaggagcagatttcttatttcatcacagagtacatcataaataacaaagccgcatgga
tagatgcaaacggtggctgggaaaacggtttcctaacaaagtttgaaagaagatcaccactatctttctccacaattaca
gacatatttgcagctgttttttccttgtttagagagtactactga
>gnl|bcl2dbcds|A0A8C3LBC4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chrysolophus pictus GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctatgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccacccgtacccccggccctggctcccactgctgctcccactgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccagctgaggggctg
agccccgcacctcccggcgtccacctcgccctgcgccaggctggggacgaattctcacgccgctaccagagggactttgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagcttttccgtg
atggggtcaactggggtcggatcgtcgccttctttgagttcggtggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaacaggcacctgcataactggatccaggacaacgg
aggatgggatgccttcgtggaattgtacggcaacagcatgaggcctttgtttgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|A0A8C3LRK6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chrysolophus pictus GN=BCL2L1 (length=690 residues).
atgtccagcagaaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagcagaggcagagatggacagcgtcctcaatgggagcccgtcctggc
acccgcctgccggccacgtagtgaatggagccaccgtgcacaggagcagcctggaagttcatgaaattgttcgagcatct
gacgtgaggcaggcgctgagagatgcaggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggctggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A059PJI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Clarias batrachus GN=BCL2L1 (length=717 residues).
atgtcttactacaacagagaacttgtcgtgtacttcatcaagtacaagctctcccagaaaaactacccctgcgaccacat
cggcctcacggaagaggtgaacggccaggtggcggaagagaacgcggtgggagcgggagagtcggagacgccgacagcag
tcgttaatggcaccctaaacgggaccggatcggcaggcactccaccgcgatcgccgactttgtcccctcagaggcaggtg
aatggcagcgcaagcctggaggcagtaaaggaggcgctacgtgactctggcaatgagttcgagctgcgctattcacgcgc
ctttagcgacctgtcatcacagttgcatataactccagtcacggtgtaccagagctttgagagcgtgatggacgaggtgt
tccgcgacggcgtcaactggggccgtatcgtgggcttgttcgcttttggaggtgccctctgtgtcgagtgtgtggaaaag
gagatgagtccgctggtggcacgtatcgccgagtggatgaccgtctacctggacaaccacatccagccctggattgaaga
gcaaggaggatgggaacggtttgcagagatctttgggaaagatgcagcagcagaaggcagaaggtcacaggaaagcttta
agaagtggctgctggcaggtgtgacactcttcacgggggtggtggtgggctccttcatcgctcagaagcgcctgtaa
>gnl|bcl2dbcds|A0A2K5H963_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5H963_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagctgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5HEJ9_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L2 (length=537 residues).
atggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaa
tgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatg
gtgcaacagcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaattt
agtggccatcccaaagggtttgcgtatatagagttctcagacaaagagtcagtgaggacgtccttggccttagatgagtc
cctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttc
cacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccc
cggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5HEJ9_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacgtccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5HEJ9_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K5HK49_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggagccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgcttagcccagtgccacctgtggtccaccttaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgtggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K5I9I0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=1050 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctaatagctccagtacggatgggtcactaccc
tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggtaccttcggga
gcaggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgac
gggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagac
gatgtcaaatctttatctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcat
ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccattagcagaaagtatca
cagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgta
gaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatct
aatcagatag
>gnl|bcl2dbcds|A0A2K5I9I0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctaatagctccagtacggatgggtcactaccc
tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggtaccttcggga
gcaggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgac
gggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagaggacct
agaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaatcagat
agccttactgtaa
>gnl|bcl2dbcds|A0A2K5I9I0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaatcagatag
>gnl|bcl2dbcds|A0A2K5K3B0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L10 (length=615 residues).
atggctgaccagttgcgggagcgcaccaacgtggctgacccgttgcgcgagcgcaccgagcggctgctggccgactatct
ggggtgctgcgcccgggaacccggcacccccgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcgg
cccgattacggcagctccatcggtccttcttctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctg
atggcggaggccgtgctctccgacagccccggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgct
gctggagagagagccgctggtgacagcctggtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcag
ggcggttgggatggcttctgtcacttcttcaggaccccctttccgctggctttttggagaaaactgctgatccaggcttt
cctggcatgcttgttaacaacagccttcggttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K5KAA3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgtcctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaggaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgcatccatagacactgccagaacaatattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K5KAA3_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgtcctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaggaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgcatccatagacactgccagaacaatattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaagaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A0U3DHY6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Coregonus lavaretus GN=BCL-2 (length=684 residues).
atggcaaacgagaatccttatgacagtcgctttattgtcgaaaaatacatccataacaaactgttgaagaagggatttgt
atgggaatttcaagcagaaaacgattctccaaataatttatttggggacccctctacacccaacacccccgaagtttttg
cacggaggtcccagcccaccgccgcggtcgaggacaccgactctcctttccaaaacaggagtccgcaaccggacccacat
gtcaggctccacagggtcctgcgcgaggcgggggacgagattgaaagaatgtatctgcgggactttgcagagatgtcggg
gcaattgcattttacgcccagcacggcacaganaaggtttaccgctgtaatagatgagctcttcagcgacggggtaaact
ggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaggtg
gacaacatcgctctttggatgacggagtacctgaacggacccctacagaactggatccaggagaatggtggctgggacgc
ctttgtggagatctatgaacagcagaggatctctcactcctggccgtacctaaagacagtgttcggcctggccgccctgg
gagccgtcggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A6F8ZUL6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcaatt
ggtgctggagggtgcaagtggacggactgagggggaagaagccattgcaaatgggtctttggggaacaacaggaatggca
gaagcaatttgggtaagccttcatctccacaggggggcattgaggcagtgaaagcagcactacgggactcagtggatgag
tttgagctgcgctacacccgcgccttcagtgacctttcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgctttcggcggggccc
tgtgcattgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggactgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaagaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaacgccagtga
>gnl|bcl2dbcds|A0A6F9B188_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=789 residues).
atgatgacttacaacaacagagaactggtggtttactatattacctataaactatcacagagagactaccccttcaacca
cactgggctcacagaagctcccagtcagactgaggggggtgagggtggacaggtggaagggggggcggcagtcacgacac
accccaacggcacagtaaacgggacgagtcctgggactccaccgcgacagtctcccccctctacccctcagcggacaatg
ggcctggatgcagtgaaagaggcactgcgggactctgccaatgagtttgagctgcgttatgccagagcgttcagtgacct
gtcctcccagctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggacgaggttttccgggacggtg
tgaactggggacgggtggtgggcctgtttgccttcggaggggccctctgtgtagagtgcgtggagaaggagatgagccca
ctagtgggacggattgcagaatggatgaccgtctacctggacaaccacatccagccttggatccagagccaaggaggatg
gatgaaagcagcgttttctctggggtcagctgagagaggggttgtcctgttcctggtgggtgggtgtgttatgggatgga
aggaggacactgttaaagagatctttgggaaggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtgg
ctgctggcggggatgacgctggtcacaggagtcgtcgtagggtcactcatcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A6F9BEN5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=MCL-1 (length=879 residues).
atgaatctgtcgaagtcgtttacacgagccacaactacgatgttgaatattcaaaatggagtcgtcggaggatcttcgta
ccctgctggtgctagccctttgtactatttcggcgcgaatggggccgtatgtgctggggcgtcaccgaagtctaaagtag
atactgacttgggaaatgggactggcgatactccaccacgacccacgaagttagcagtgaatgtcgtgaaaagcaacgtc
ctagataatcatttgtcagaccgaagcaacaatgacgactctgacgactctttgccgtgcactcctcagatggcgtcaga
gtgtgggcctgacatatcgaattgtccatcgggcgatgaagtattggaacatgataccagacaactcattgagaacgtct
tgggggactacacaggactgtctccgtctcgttggaagcaaagcaagactcttacgacgatgaagcgagtggtggaggat
gtaatagcgaagcaccgatacgcatacaatggtatgatcgacaaacttgacttggatgatcgtagcgatgacatgagcgt
catcaagtctgtggccaagaccctgttcagtgatgggatcacgaactggggtcgcatcgccagcctagtggcatttggag
cagtggtgagccagcacctgaaggagaggggcaggggacactgcgttgagttggtgggccaagagatcgccacatacctc
ctctctgaccaaagggactggctggtcaaaaacaatgcatggaatggatttgtagagttctttcatgtgcaggatccaga
gtcctcagtaaggaacaccctcatagcctttgctggagttgctgggattggggcaacactcgccatgttgatcaggtga
>gnl|bcl2dbcds|A0A6F9BJ02_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=570 residues).
atgatgacttacaacaacagagaactggtggaatactatattacctataaactatcacagagggactaccccttcaatca
cattgggctcacggaatcccagagtcggactgaggggggaccggtggacgggagtgcggcagtcatgacatacgtcaact
gcacaatgaacgggacgagtcctggtactccaccaccacggcagtcacccccctcctcccctcggcggacagagggcctg
gacgcagtgaaagaggcactgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctggcctc
ccagctgcacatcacgccgtccacagcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggtgtgaact
ggggacgggtggttggcctgtttgccttcggaggggccctctgtgtagagtgtgtggacaaggagatgagccctctggtg
ggaaggatcacagactggatgacagtctacctggacaaccacatccagccctggatccagagccaaggaggatgggtgag
tcacgactga
>gnl|bcl2dbcds|A0A6F9CY91_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtagtgttttttataagctatagactgtcccagaggaattattcattttgtcaatt
ggggctggagggtgtaagtggacggactgagggagatgaggccattgcaaatgggtctgtggggaacaacaggaacagca
gaagcaatttagggaagccctcatctccactggggggaattgaggcagtgaaagcagcactacgggactcagcggatgag
tttgagctgcgctacaccagagccttcagtgacctcgcctcccaactccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggccgcgtggtgggcctatttgcttttggcggggccc
tgtgtgttgaatgtgttgagaaggatatgagccccctggtggcacgcatcgcagactggatgaccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagatgt
ccgacggtcccaggagagcgtaataaaatggctgctagttggggtgattctgttttcaggagtgctggtcggcactctca
tcatgaagaaacgccagtga
>gnl|bcl2dbcds|A0A8C2T2M7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coturnix japonica GN=BCL2L1 (length=690 residues).
atgtccggcagtaaccgggacttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcggcagaggcagagatggacagcgtcctcaacgggagcccatcgtggc
acccgcctgccggccacgtagtgaatggagccaccgtgcaccggagcagcatggaagttcatgaaatcgtcggagcatct
gacgtgaggcaggcgctgagagaagcaggggatgagtttgagctgaggtacaggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagcttcgagcaggtagtcaatgaactcttccacgatggtgtgaactggg
ggcgcattgtggctttcttctccttcggaggggctctgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggccggagttcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C2TT61_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Coturnix japonica GN=MCL-1 (length=1056 residues).
atgtttgccgtcaaacggaacgccgtcatcggcttcaatctctattgcggcggaggaggcccgggcctggtgcccgcttc
accggcaggagaccaacccgcgccacccgccgccgccgccgctccggccgccgccaccggctctgaggtaccgcggcctc
tgattggctcagcggggctgtgggcctccaccggcctcgccgaagccccccgcgatcctattggctccggggctgccccc
cactctccgattggctccggggctgccccccactctccgattggttccgagtttgccccccactctctgattggtcccgc
cacggcccgccgggctccgtcggactccacaccgaggcccgtcgctctgtggagccccgaggaggagttggacggatacg
aacccgaatccgaacgaggccccgggggcgattcgttacccggtacaccgccagaactgcccgacgacgagctacggcgg
gattccttagagctcatcctccggtatctccgggaagcggcgggagaagcggaacccagcgttaaaaagctttttccggg
tctattgggtgggcctggacggcccggtaaaacggggaacggcgtcatggagaaagcactggaaacgttgaggagggtcg
gggatggagtgatggagaaacacgagctggcgttccagggaatgcttcggaagctggaaatcaagaaagaagaagatctg
caggcagtttgtgaggtggccgctcacgttttcagcgacggagtaacaaactggggccgagttgtcacgctcatctcatt
tggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatgcatcagctcgttggcagggatcatcacagacg
ctttggtctcatccaaacgcgagtggctgatgagccagggaggctgggagggttttgtcgacttcttccgagtcgaggac
ctggaaggcagcatcaggaacgtgctgatggcctttgctggagtggccggcctgggggcgagcttggcctacatgatccg
aaagtggaggagttga
>gnl|bcl2dbcds|A0A8C2TT61_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Coturnix japonica GN=MCL-1 (length=1050 residues).
atgtttgccgtcaaacggaacgccgtcatcggcttcaatctctattgcggcggaggaggcccgggcctggtgcccgcttc
accggcaggagaccaacccgcgccacccgccgccgccgccgctccggccgccgccaccggctctgaggtaccgcggcctc
tgattggctcagcggggctgtgggcctccaccggcctcgccgaagccccccgcgatcctattggctccggggctgccccc
cactctccgattggctccggggctgccccccactctccgattggttccgagtttgccccccactctctgattggtcccgc
cacggcccgccgggctccgtcggactccacaccgaggcccgtcgctctgtggagccccgaggaggagttggacggatacg
aacccgaatccgaacgaggccccgggggcgattcgttacccggtacaccgccagaactgcccgacgacgagctacggcgg
gattccttagagctcatcctccggtatctccgggaagcggcgggagaagcggaacccagcgttaaaaagctttttccggg
tctattgggtgggcctggacggcccggtaaaacggggaacggcgtcatggagaaagcactggaaacgttgaggagggtcg
gggatggagtgatggagaaacacgagctggcgttccagggaatgcttcggaagctggaaatcaagaaagaagaagatctg
caggcagtttgtgaggtggccgctcacgttttcagcgacggagtaacaaactggggccgagttgtcacgctcatctcatt
tggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatgcatcagctcgttggcagggatcatcacagacg
ctttggtctcatccaaacgcgagtggctgatgagccagggaggctgggagggttttgtcgacttcttccgagtcgaggac
ctggaaggcagcatcaggaacgtgctgatggcctttgctggagtggccggcctgggggcgagcttggcctacatgatccg
ctggacttga
>gnl|bcl2dbcds|A0A8C2U1A2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Coturnix japonica GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctctcagcgggg
ctatgactgggctgccggtgaggacaggccgcctgtgcccccggccctggctcctgctgctgctcctgccgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccagctgaggggctg
cgccccgcacctccaggcgtccacctcgccctgcgccaggccggggacgagttctctcgccgctaccagagggactttgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggtcgcttcgtggccgtggtggaggagctcttccgtg
atggggtcaactggggccggattgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacgg
gggatgggatgccttcgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacacaagtag
>gnl|bcl2dbcds|A0A8C2UCW6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Coturnix japonica GN=BCL2A1 (length=525 residues).
atggaaaccgctgagttctattacgtttattatttagctcaagattatctgcaatatgtgcttcaggaatcacgtcttgg
accagcccaaaccagggttgctcatgtcttgcgaaacattgcatcttcactccaagatcagacagaggaggctctcagac
cctttttggacaggatcgatatcacctccgttgatgttgccaagagaattttcaatggagtcatggaagaaaaatttgct
gatggaaatacgaactggggacgaattacgaccatatttacttttggaggtcttctcaccaagaagcttcaagagcacgg
agttcagctcaccggagaggagaaggagcagatttcttatttcatcacagagtacatcataaacaacaaagccgcgtgga
tagatgcaaacggtggctgggaaaacggtttcctaacaaagtttgaaagaagatcaccactgtctttctctacaattaca
gacatatttgcagctgttttttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8C2LQI3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2A1 (length=507 residues).
atgactgactgtgagttcatgtacatccactcgctggctgaggactatcttcagtatgtcctgaaggtacctacttttga
atctgctccaagcaaaacatccagggtgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaatctgaaac
tatacttggatgattttgatgtgagatccatcgacactgccagaacaatattcaatcaagtgatggaaaaagaatttgaa
gatggcatcattaactgggggaggattgtgactgtatttgcctttgggggtgttctcctcaaaaaacttgcacaagagca
gattggcttggatgtgggtgcttacaagcaagtttccaattttgtggctgaattcataatgaataacacagcagagtgga
tacgtcagaatggaggctgggaagatggcttcatgaagaagtttgaacctaaatctggctgggtgacttttctggaaacg
atagggcagatctgggaaatgctcttt
>gnl|bcl2dbcds|A0A8C2MG79_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cricetulus griseus GN=MCL-1 (length=1023 residues).
atgtttggcctgcggagaaacgcggtgatcggcctgaacctgtactgcggcggcgccagcctgggcgcgggcggcggctc
tccggccggggcgcgcctcacggccgaggaggccaaggcgcggcgcgaggggggaggggaggccggcctgctgcccggcg
cgcgggtggccgtgcggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgagaggcggctgctccgg
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgccggcctccgcctcctcctccaccgccgccgccgccgc
catcatgtcccccgaggaggagctggacggctgcgagccggaggcgctcggcaagcggccggccgtgctgcccctgctgg
agcgcgtgagcagcgaggcggctaagaacccgggcgccgccggctcgctgccctccacgccgccgtcggccgaggaggag
gaggacgagctgtaccgccagtcgctcgagatcatctcgcgctacctccgggagcaggcggccggcgtcaaggacgcgaa
gccgctgggcgaggcgggcgcggcgggccggagggcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaacc
acgagacggccttccagggcatgcttcggaaaatggacattaaaaacgaagacgatgtcaaatctttttctcgagtgatg
gtccatgttttcaaggatggcataacaaactggggcaggattgtgactcttatttcttttggtgcctatgtggccaaaca
cttgaagagcataaaccaggaaagctgcatcgaacccttagcagaaagtatcacagatgttcttgtaaggacaaaacggg
actggcttgtcaaacaaagaggctgggatgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaat
gtgctgctggcttttgcgggtgttgctggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C2MG79_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cricetulus griseus GN=MCL-1 (length=879 residues).
atgtttggcctgcggagaaacgcggtgatcggcctgaacctgtactgcggcggcgaccccgacgtcaccgcgtcggccga
gaggcggctgctccggtcgcccggcctcctcgccgtgccgcccgaggagatggccgcgccggcctccgcctcctcctcca
ccgccgccgccgccgccatcatgtcccccgaggaggagctggacggctgcgagccggaggcgctcggcaagcggccggcc
gtgctgcccctgctggagcgcgtgagcagcgaggcggctaagaacccgggcgccgccggctcgctgccctccacgccgcc
gtcggccgaggaggaggaggacgagctgtaccgccagtcgctcgagatcatctcgcgctacctccgggagcaggcggccg
gcgtcaaggacgcgaagccgctgggcgaggcgggcgcggcgggccggagggcgctggagaccctgcggcgcgtgggcgac
ggcgtgcagcgcaaccacgagacggccttccagggcatgcttcggaaaatggacattaaaaacgaagacgatgtcaaatc
tttttctcgagtgatggtccatgttttcaaggatggcataacaaactggggcaggattgtgactcttatttcttttggtg
cctatgtggccaaacacttgaagagcataaaccaggaaagctgcatcgaacccttagcagaaagtatcacagatgttctt
gtaaggacaaaacgggactggcttgtcaaacaaagaggctgggatgggtttgtggagttcttccacgtacaggacctaga
aggcggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C2MSB6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L10 (length=522 residues).
atggacgacccgctgctggaacgcactagacggctgctgactgactacttgatgttctgcgcacgggagccagatgaacc
cgagccactgcccaggtcggtcgaggccgccttgctgcgctccgtggcagagcagttccaagaacagcaccacttttttt
tctcctccttctacggctacaagggcaaccgtgtgctgctgatgacacagatggcagatgcggtgctctctgatagcgaa
ggcttcaactggggccgccttgtgatgctcttggccttcgcggggacaattgtgagtcaagagcagataaatgtgcttct
agactgccaactcatagtggacttgctgtgcgatcggatcctgggacagcatcgctcctggctggaggctcacggtggct
gggatggcttttaccacttcttttcgagccacttaccactcgatttttggaggagtctgctgatcaagacttttctatac
tgggtctttgcaacggccatgctgtttatctggaaaagatta
>gnl|bcl2dbcds|B2Z3Z4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagttctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtaaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcagtga
tctaacatcccagcttcatataaccccagggactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctacggaaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|Q923R6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cricetulus longicaudatus GN=BCL-2 (length=711 residues).
atggctcaagctgggagaacagggtatgataaccgagagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgctacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggacgcatttgtggaactgtacggccccagtgtgaggcctctgtttgatttctcttggctgtctc
tgaanaccctgctcaacctggccctggtcggggcctgcatcactctgggtacctacctgggccacaagtga
>gnl|bcl2dbcds|A0A7M4EJG9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Crocodylus porosus GN=BCL2L1 (length=690 residues).
atgtcgagcagcaaccgggaattagtgattgactttatatcctacaagctgtcacagcggggacacagctggagtcagct
tgaggggcaggatgagaccaggactgagtttgcagaagaggaggacatggcaagtgtcccgaatgggagtccgtcctggc
atcccactgccagccacgtagtgaatggggctgctggacacaggaacaacctggaagcccaggagagtgttccagcggct
gaagtgcggcaggcgctaagggaggcaggagacgagtttgagctgaggtaccgcagggccttcagcgacctcacatccca
gctccacatcacccctggcacagcataccagagcttcgaacaggtggtgaatgaactgttccgggatggagtgaactggg
ggcgcatcgtggcctttttctccttcggaggggccttgtgtgtggagagtgtcgacaaggaaatgcaggtgctggttgga
cgtatcatctcatggatgaccacctacctgaccgaccacctcgacccctggattcaggagaacggcggttgggagcggtt
cgtggatctctatggcgatgacgctgcagccaagagccggagaggccaggagcgtttcaacaagtggctcctgaccgggg
ccacggtggctggcgtgcttctgctgggctctctgctcagccgcaagtag
>gnl|bcl2dbcds|A0A7M4EPU7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=711 residues).
atgtcttccacagtgaaaacaggctatcataaccgggagatagtgctaaagtacatccattacaaactatcacagagggg
atacgactgggctgcccaccaagacagagcatggtgtcctctgagtctctctcctgctgctgctgttgctgctgctggga
cttcctctgacaatactgggctggtgtctctgcatcgtgagcctgctggctcagctgctgctagtaatgtgcctcctggt
aatgacctgggcccagtcctacaggctgtccacctgaccctgcgccaagcgggagatgatttctcctgccgctaccagag
tgacgttgcccaaatgtctggccagctgcacttgacccccttcacagccaggaggcgttttatggcagtagtagaggaac
tgttccgagatggagtgaactggggaagaattgtagccttctttgggttcggtggcgtgatgtgcgtggagaatgtcaac
caggagatgtcgcccctcgtggacaacattgcaacatggatgatggagtatctgaacaggcacctccagaactggatcca
ggacaacggaggctgggatgccttcatagaattgtatggtaacaacatgagactgttgattgacttcttctggatctctt
ggaaaactatcataagtctggttctggtgggagcttgcatcactcttggtgcttatctaggacataagtaa
>gnl|bcl2dbcds|A0A7M4FFQ8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Crocodylus porosus GN=BCL2A1 (length=528 residues).
atggaaagcactgagttctgttatgtttgctgcttagtccaagattatctgaaatatgttcttcaggaatcacagcctgg
accagccccaagcagagtggctcatgttttacgaaacattgcatcctctttgcaaaaggaaactgaagagaatctaaagc
cattcttggacacacttgaattttcatctatagaagttgccagaagaattttcacccaagttatggagcaagaatttgct
gatggcaataccaactggggacggattttgacaatatttatgtttggaggaattgtcactaagaggcttcaagagcatgg
agttcagcttacaggagaaaataaagagcagatttcatatttcatcacagagtacatcatgaacaacaaggctgaatgga
tagaggcaaatggaggttgggaaaatggcttccttatgaagtttgagggtcagaaatcgtggctgtccttatttgatgtg
aaggcaagaatcatggctgtcttctccttcttcagtcaatattactga
>gnl|bcl2dbcds|A0A7M4G2E0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=1035 residues).
atggaggctgggagattatttcagccaaaaagaatacatgtaagaaccaggatgtctcaaacagacagacctcaccgaga
taagccataccgatactacgagagccatggttatgacaggcacaacacagacagaaggactaaagaaccatacccatccc
acggaaggtcagcaaaagagactcacagcacccagaactccagaccttccagactttgttcagatccttataaaaaaaac
gcagtatcaactcatggctacgtcagctcttctcctcacttttatcctcccaaacagaccttttcagagaaatgtgcaaa
catatgctcaacaagaggtattttgaaatttgttgaaattacagtcagcattctgatgctgatttgtgttgcagctgccc
agacagccatttcaggctacacctccatcggcggcttgggaatgggctccttcagcctggataccgcttacagcccattt
gaaggatatgaactgaaggaggtgagagacctggacatgcagttcagccagatgagagccccttgtgtgtacgggggcat
tgccttcagcctgacaatggctgcacttacactcctgttcctcgtcgttggggcaaagcaaattcatcgtctctccatgc
cactgctcgtggcagaatgtgcctttgatattctggctggtatggcatacatctcagccgttggcctctacctgtatttt
gtcatccaggtgaacacaacagatgtatgcaagaggagggagaggttgtatgcacgccggggatacacatcaatgaactg
cgaggtgcaggggggcgatgcagctgttgctgtctttggtattgtggctgcctgtttgtacttcccaagctctgtcatct
gcgctcgcaccattcggaccgtgaggaacttccggaggcaccagacacagcctcagtacagcccagagagcagctacaga
gagagaggccaccacaaagccaacagaagccctgaaagcacccgcagcatgcaggcagtggcaacgttggtgtag
>gnl|bcl2dbcds|A0A7M4G2E0_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=879 residues).
atggaggctgggtcagcaaaagagactcacagcacccagaactccagaccttccagactttgttcagatccttataaaaa
aaacgcagtatcaactcatggctacgtcagctcttctcctcacttttatcctcccaaacagaccttttcagagaaatgtg
caaacatatgctcaacaagaggtattttgaaatttgttgaaattacagtcagcattctgatgctgatttgtgttgcagct
gcccagacagccatttcaggctacacctccatcggcggcttgggaatgggctccttcagcctggataccgcttacagccc
atttgaaggatatgaactgaaggaggtgagagacctggacatgcagttcagccagatgagagccccttgtgtgtacgggg
gcattgccttcagcctgacaatggctgcacttacactcctgttcctcgtcgttggggcaaagcaaattcatcgtctctcc
atgccactgctcgtggcagaatgtgcctttgatattctggctggtatggcatacatctcagccgttggcctctacctgta
ttttgtcatccaggtgaacacaacagatgtatgcaagaggagggagaggttgtatgcacgccggggatacacatcaatga
actgcgaggtgcaggggggcgatgcagctgttgctgtctttggtattgtggctgcctgtttgtacttcccaagctctgtc
atctgcgctcgcaccattcggaccgtgaggaacttccggaggcaccagacacagcctcagtacagcccagagagcagcta
cagagagagaggccaccacaaagccaacagaagccctgaaagcacccgcagcatgcaggcagtggcaacgttggtgtag
>gnl|bcl2dbcds|A0A7M4G2E0_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=711 residues).
atggctaatcctgggagaagaggctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagagggg
gtacgactgggctgcccaccaagacagagcacggggtcctccgagtcattctcctgctgctgctgttgctgctgctggga
cttcctctgaccatgctgggccggtgtctctgcatcctgagcctgctggctcagctgctgctagtaatgtgcctcctggt
aatgagccgggcccagccccacaggctgtccacctgaccctgcgccaagcgggagatgatttctcccgccgctaccagag
tgactttgcccaaatgtctggccagctgcacttgacccccttcacagccagggggcgctttgtggcggtagtggaggagc
tgttccgagacggagtgaactgggggagaattgtggccttctttgagttcggtggcgtgatgtgcgtggagagtgtcaac
cgggagatgtcgcccctcgtggacaacattgcaacatggatgacggagtacctgaacaggcacctccagaactggatcca
ggacaatggaggctgggatgccttcgtggaattgtatggtaacaacatgagaccattgattgacttctcctggatctctt
ggaaaactatcttaagtctggttctggtgggagcttgcatcactcttggcgcttatctaggacataagtga
>gnl|bcl2dbcds|A0A345BSW9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ctenopharyngodon idella GN=BCL2L1 (length=627 residues).
atgtcttactataacagagaactagtggtattttttattaaatataaactctcgcagaggaactacccctgcaaccacat
tgggcttacagaagacacaaatcggactgatggggccgaagagaatggtgagggggcggcaggaacgacgaccctcgtta
acggctccatgaacagaaccccaccacaatcccccgctacatccccccagcatcagacaaacgggagtgggggtctggac
gcggtgaaggaagcactacgcgattctgccaatgagtttgagctgcgttattcccgagcgttcaacgacctttcctcaca
gctccacatcacacctgccacggcataccagagctttgagagcgtgatggatgaggtgttccgcgacggcgtcaactggg
gccgcatcgtgggactgtttgccttcggaggggctctgtgcgtcgagtgtgtggagaaggagatgagcccattagtggga
cgcattgcagaatggatgaccgtctacctggacaaccacattcagccctggatccagagccaaggaggatgggtgagtgg
aaaattacttgcatttctttcctaccttgttccctttcttcagtttaatcacaaagagcctttgtaa
>gnl|bcl2dbcds|A0A8C0U194_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyanistes caeruleus GN=BCL2L1 (length=693 residues).
atgtacagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggcgtcctcaacgggagcccctcct
ggcatgcacccaccagccacatagtgaacggagccaccgtccaccagagcagcctcgaagtccatgagatccgtcgagca
gctgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaatgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcattgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C0UAC7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyanistes caeruleus GN=BCL-2 (length=672 residues).
cagaggaacatatttatagcccaagctcatccggggagaagaggctatgataaccgggagatagtgctgaagtacatcca
ctataaactctcccagaggggatacgactgggctgccggcgaggacagggcacccctgtctccaggtctctctgctcctg
ctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagc
cacgcgcccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcaggggatgagttctc
ccgacgctaccagagggactttgcccaaatgtctggccagctgcacctgacacccttcacggccaggagccgcttcgtgg
ccgtggtggaggagctcttccgagacggggttaactggggcagaattgtggccttcttcgagtttggcggtgtgatgtgt
gtggagagcgtcaaccgggagatgtctcccctcgtggacaacattgctgcctggatgactgagtacctgaaccggcacct
gcaccactggatccaggacaacggaggctgggtaagtcaccccgatcgctcgcttcctctccctgctccggcccgtggct
ggtgggaccccaggctgggcagcgccccagag
>gnl|bcl2dbcds|A0A8C0UE15_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyanistes caeruleus GN=MCL-1 (length=483 residues).
atgctctgcacatccctgagaggctcctgcagcttcaggagctccagtggtggtgggctcacaccccatccccgctcctc
ccgcggggttttggtgctcctaaacccaaatcttccaggaatgctgcggaagctggaaatccagcaagaggaggacctgc
agtcggtggtggaggtggctgcccacttgttcagcgatggggtgaccaactggggccgcgtggtgacgctcatcgccttc
ggagccttcgtggccaagcacctgaagagcatcaagcaggagcagagcatcagttccctggctgggatcatcacggacgc
cctggtctcgtccaagcgagagtggctggagagccaggggggctgggagggctttgtggactttttccgagtggaggacc
tggagggcagcatccggaacgttctgatggcgtttgcaggagtggccggcctgggggctggcttggcctacatgatccgg
tga
>gnl|bcl2dbcds|A0A8C0UPM3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cyanistes caeruleus GN=BCL2A1 (length=522 residues).
atgctgggggtgccttttgctttcaaagaaggaagagcagtgaaaagagagtatgtgctccaggaatcacagctcggacc
agcccagaccagggttgctcatgtcttgcgaaccattgcatcttccctgcaagaccaaaccgaggaggctctcaggccac
tcctggacaggattgacatcacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaaagtttgctgat
ggaaatactaactggggacgaattatgaccatatttacatttggaggtcttctcaccaagaagcttcaagagcatggagt
tcagctgactgcagaggagaaggaggagatctcttatttcatcacagagtacatcataaacaacaaagctgaatggattg
atgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattacagcc
ctgctcatagctgttgtttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8C0UPM3_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Cyanistes caeruleus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttagctcaggattatctgcagtatgtgctccaggaatcacagctcgg
accagcccagaccagggttgctcatgtcttgcgaaccattgcatcttccctgcaagaccaaaccgaggaggctctcaggc
cactcctggacaggattgacatcacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaaagtttgct
gatggaaatactaactggggacgaattatgaccatatttacatttggaggtcttctcaccaagaagcttcaagagcatgg
agttcagctgactgcagaggagaaggaggagatctcttatttcatcacagagtacatcataaacaacaaagctgaatgga
ttgatgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gccctgctcatagctgttgtttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8C3NVU4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cyanoderma ruficeps GN=BCL2A1 (length=525 residues).
atggaaactgctgagttttattacgtttattacttagctcaggattatctgcaatatgtgctccaggaatcgcacctcgg
accagcccagaccagggttgctcgtgtcttgcgaaccatcgcatcttccctgcaagaccaaaccgaggaggctctcaggc
cactcctggacaggattgacatcacctctgtagctgttgccaagagaattttcaatggagtcatggaagaaaagttttct
gatggaaatactaactggggacgaatcatgaccatatttacatttggaggtcttctcaccaagaagcttcaagagcatgg
ggttcagctgactgcagaggagaaggaggagatctcttatttcatcacagagtacatcataaacaacaaatctgaatgga
ttgatgcaaacggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gccctgttgatagctgttgcttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8C3QRB8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyanoderma ruficeps GN=MCL-1 (length=903 residues).
atgttcgccgtgaagccgaaagccgtcatcggcttcaacctctactgcggcggcgccccggcgctgagccccggcgggcc
cggggagcgcccggagcccgccgccgccgccggcgcctcagagcagccccgcgaccgctccggggccgcccccgcccgcg
ccgagccgccccgcgcgctgattggctgcggcgccgcgccccgcgcgctgattggctgcggcgcgactctctggcgcccc
gaggaggagctggacggctgcgagcccgagcccgagcgcggccccgccgccgactcgctgcccgggacccccccggggcc
ccccgacgggctccggcaggactcgctggagctcatcagccgctacctgcgggaagtggcgggcgaggcggagcccgcat
ccaagaaacttttcccggggctcctgggtggtcccggccggcccggcgcggcgggggatgcggtgatggagaaagcgctg
gagacgctgcggagaatcggcgacggcgtcatgcggaaacacgagctcgcctttcaagggatgctgcggaagctgcaaat
ccagcaagaggaggacctgcagtcggtggtggaggtggctgcccacctcttcagcgacggggtgaccaactggggccgcg
tggtgacgctcatctccttcggggccttcgtggccaagcacctgaagagcatcaagcaggagcagagcatcagctccctg
gccgggatcatcaccgacgccctggtctcgtccaagcgggagtggctggagagccaggggggctgggagggctttgtgga
cttcttccgagtggaggacctggagggcagcatccggaacgtgctgatggcctttgcaggggtggctggcctgggggcca
gcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A8C3QX54_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyanoderma ruficeps GN=BCL-2 (length=708 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcacagagggg
atacgactgggctgccggtgaggacagggcacccctgcctccaggtctctctgttcctgctgctgctgctgctgggactt
cctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcgcccccggccgag
gggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcaggggatgagttctcccgacgctaccagaggga
ctttgcccagatgtctggccagctgcacctgacgcccttcacggccaggagccgcttcgtagccgtggtggaagagctct
tccgagatggggttaactggggcagaattgtggccttcttcgagtttggcggtgtcatgtgcgtggagagcgtcaaccgg
gagatgtctcccctcgtggacagcatcgctgcctggatgactgagtacctgaaccggcacctgcacaactggatccagga
caacggaggctgggatgcctttgtggagttgtatggcaacagtatgaggcctttgttcgatttctcctggatctctctga
agactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8C3XCF2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyanoderma ruficeps GN=BCL2L1 (length=693 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagccagct
ggaggaggaagatgagaacaggactgactttgcaggggaggaggacgaggtggatggcgtcctcaatgggagcccctcct
ggcacgcgcctaccagccacatagtgaacggagccaccgtgcaccagagcagcctcgaagtccacgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacaatgctgctgccgaggtgagaaaaggtcaagaaaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C2X310_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=1017 residues).
atgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctaca
ggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaagtgtgataaagca
ggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatgg
aagtggaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccatg
aaggagcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctactc
cccgtccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtgg
cctacccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctgaa
acctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaacagctccgt
gggacccgatggttacatgctatcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagg
atgcctttgtggagctgtatgacagacagagggactccctcttcaattgctcctggccctccattaagacggtcttcggt
ctggctgcactcggggccgccagcctcaccatcggagcataccttactcagaagtga
>gnl|bcl2dbcds|A0A8C2X310_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=1080 residues).
atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaatcaactcctggtggctccttctgccgtttgt
catgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctac
aggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgc
catcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaagtgtgataaagc
aggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatg
gaagtggaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccat
gaaggagcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctact
ccccgtccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtg
gcctacccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctga
aacctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaacagctccg
tgggacccgatggttacatgctatcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcag
attgttaccatgggactgtttcggaccatcgccctcttctacctgggcagttttgacagcattgtgcggcgctgcatgat
tcagagggaacagtcaaaagcagctgataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=555 residues).
atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaatcaactcctggtggctccttctgccgtttgt
catgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctac
aggcaaggagcattcatcactttggtggcacgggatgaggtcaattgcttaaataattcagtgttgacctactggagtgg
ctttttttctgttgcgcaggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctg
gaaagtttgatgaaatggaagtggaccgttttaaaattgttaccatgggactgtttcggaccatcgccctcttctacctg
ggcagttttgacagcattgtgcggcgctgcatgattcagagggaacagtcaaaagcagctgataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=1074 residues).
atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaatcaactcctggtggctccttctgccgtttgt
catgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctac
aggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgc
catcaatgacaaacaggtatattgcttaaataattcagtgttgacctactggagtggctttttttctgttgcgcaggctc
aggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatggaagtg
gaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccatgaagga
gcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctactccccgt
ccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtggcctac
ccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctgaaacctc
aggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaacagctccgtgggac
ccgatggttacatgctatcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagattgtt
accatgggactgtttcggaccatcgccctcttctacctgggcagttttgacagcattgtgcggcgctgcatgattcagag
ggaacagtcaaaagcagctgataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=894 residues).
atgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctaca
ggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaagtgtgataaagca
ggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatgg
aagtggaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccatg
aaggagcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctactc
cccgtccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtgg
cctacccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctgaa
acctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcaattgttaccatgggactgtttcggac
catcgccctcttctacctgggcagttttgacagcattgtgcggcgctgcatgattcagagggaacagtcaaaagcagctg
ataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=687 residues).
atggcgaacgagtgcaatcgcaacattgtggaaaagtacatctgccataaactctccaaacggggctacgtgtttggatt
tgacgacgtccgagatgaagatgccgccgatgacggcttaatagttgtcccgccgccgactctggtccgccggtgccgtg
aatccggcaccgggcccgacatcgagagcgtcccccacctctgcaaacggctcccgcagtccgacccgaccgccgccatc
caccgggtcctgcgcgaggctggggacgaactcgagagactgtaccagccggacttcacggagatgtcgcggcagctgta
cctcacctccaccacggcgcagcggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgcgttcttcgagttcgggggcacggtgtgcgcggagtgcgccgccaagcaggagatgacctcgcaggtggacaac
atcgcggagtggatgacggagtatttaaatggacctctgaacaactggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactccctcttcaattgctcctggccctccattaagacggtcttcggtctggctgcac
tcggggccgccagcctcaccatcggagcataccttactcagaagtga
>gnl|bcl2dbcds|A0A8C2Z1X1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyclopterus lumpus GN=MCL-1 (length=837 residues).
atgaatataataagcacgaaacgagccgcgttcaagatgactggagtcatgggctgtattatccttcctcaaaatggagt
cgtggagcgacccgtgcactacggctcgggagagtcctccccgctggtcgccatgggctccgctaaggactcccacaacg
gcaacgcggcgtccaacgacgccccgaagaggcccaagatcctcggctacgcgtcgaaaatgatccagggcgcggacgac
cacgacggcggctcgctgccgtgcaccccggagccggacagcgagatcgacgtgtcggactcccaggcgggcgccgaggt
gctggagaacgacacgaggcagctcatgggccgcttcctgggagactttaccggactttcgaaatcccagtggcacgaaa
gcagagagctgagcacgatgaagagggtcgtgaaagacgttttggagaagcatagatacgcgtacaatggcatgatcaac
aaattgtcattggacgacagaagtgacgatgccagtttcgtcagagaggtagccaagagcctcttcgcggacgggaccac
gaactggggccggattgtcagcctggtggccttcggggccgtggtgtgtcagtacctgaaggagaagaaccgggggaact
gtgtggagctggtgggacaggagatctccacgtacctgctgtctgaccagagggactggctggtcaagaacaatgcatgg
gagggctttgtggagttctttcgggtagtggacccagagtccacagtgaggaacacactcatggccgtcgctggatttgc
cagcatcggggcgacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A8C2ZH46_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL2L1 (length=678 residues).
atgtccaacatcaacagagagctggtggagttcttcataagctacaagctgtcgcagaagaactacccaacctctctgct
gtggccagaggaggatgccgccggtgggaggacggagggagacgaagccgacccagcatccagtaacggctcgctggtca
acggcggggacggggacggggccggcccgtcggggacgtcatcgcctccgtccggtgacgtggaggccgtgaaggcggct
ctccgggactcggcgaacgagtttgagctgctcttcacgcaagcgttcagtgacctttcctcgcagctcgacgtcacccc
cgtcacggcctaccacagctttaagagcgtgatggacgaggtgttcaaggacggagtcaactggggccgcgtggtgggcc
tgttcgccttcggcagcgtgctgtgtgtggactgcgtcgagaaggacatgagcgagctggtttcccgcatcgcggactgg
atgaccacgtacctggacgagcacatcagcgcatggatccagagccagggaggatgggactgctttgccgagatctttgg
gcgggacagcgctgcggaggcgaggatatctcaggagacgctgaggaggtggctgctcgttggagcggcgctgctaaaag
gagtgctcggcggcatggccatcagcaagaagcggtga
>gnl|bcl2dbcds|A0A8C2ZZ68_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagagctggtggtcttctacataaactataaactctcccagaggaactatcccctcacccacatggg
actcacagagcctctgaacaggactgacgggggggaggcgggggcgggcgatgccgaggaacagcgggtagcgacgcacg
ctaacgggactttcaatggcacaagtcccgggaccccaccggcatccccgctgcgaccgcaacggttgccgtcgacgacg
aacctggacgcggtaaaggaggccctccgggactcggccaacgagttcgagctgcgatacgcccgggccttcagcgatct
gcacaaccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgtttcgggacgggg
tcaactggggccgcatcgtggggcttttcgccttcggcggggccctgtgcgtggagtgtgtggagaaggagatgagtcca
ctggtgggacggatcatcgagtggatgacggtctacctggacaaccacattcagccctggatccagacccagggaggatg
ggagcgcttcgccgagatctttgggcaggacgcggcggcggagagcaggaagtctcaggagagcttcaagaagtggctgc
tggcgggggtgacgctggtgaccggcgtcgtggtggttttgctcatcggccagaagcgcctgtga
>gnl|bcl2dbcds|A0A8C3G7A6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL2L10 (length=579 residues).
atgtcgtgcgggctgtggaaagagaccttggctctggcagaggactacctgtacctgtgctgcacaagcccacggccagc
ccctccacctcccagcgagtcagccactgccatgaggcgcctggcccaggacatggagacgcagcaccaggctcgcttcc
actccctcgctcagaccttcctgaggcagtgcgggccggacccctgctccagcctcaggaaggtgatagaggagttggtg
ggagacggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctggccaggcagctgctggagca
gaatggcacaaagctggggctggaccctgggcaggaactagaacaggagtccggaaactgcaggggactggcggagacca
tagctgattacctgggagaggagaagaaagactggctgctggagaatgatggatgggaggggttctgcaagttctcccgc
agtgccagagaagtcggccaggactcgtccatgaagacggcgctgtttgctgctgctggtgtgggcctcgctggactcac
cttcctcctagtgcgctag
>gnl|bcl2dbcds|A0A3P8UWG7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL2L1 (length=708 residues).
actttgacctttaatattaacagaaaactggtggtcgactacatacagtataaactttcccagaggaactttcccgtcca
ccacctgggactcggtgattctccaaacaggactgatggggaagaggcagggttgggcgcagagcagcggacaagtacgc
acgccaacgggactgtaaacggcacaagttctgggacgccgcctgcatctccactgcggcagcagcattcggcgtcggat
acaagtctggactccattaaagaggctctgcgggactcggccaacgagtttgaactgcgatacgcgcgggccttcagcga
tctgcaccagcagctgcacatcacaccagccactgcctaccaaagtttcgagaatgtgatggacgaagtgttccgggacg
gtgtcaattggggtcgcatcatagggctcttcgccttcggcggggcgctgagtgtcgagtgcgtggagaaagagatgagt
cagctggtggccaggattgcggattggatgacagtctatcttgacaaccacatccagccatggatcgaaacccaaggtgg
atgggagcattttgcggaactctttggtcaggatgcagcagcggagagccggaggtcacaggagagttttaagaaatggt
tgctggctgggatgacgctggtgacaggcgtggtggtgggctccctgattgcccagaaacgtctctga
>gnl|bcl2dbcds|A0A3P8V8T6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=582 residues).
ctggatatggtgctcataagcagtgtctgtttgacgctgtgcacactggaaaatgacaccaggcaattgatttgcgattt
cctgaaagacttcaccacaaaatctacccaacgattggtggagagcaaagcattgtcaactatgaaaagagtggtaaaag
gcattttagacaaacacagacatgcattcagtggcatgatcaacaacctctcttttgaaaacggagtatataatattgga
gttgttggggcagtggccaggagcctcttcagagatggcacctccaactggggtcgaatagttagcctggttgcatttgg
ggcagtgctttgtcagcacctaaaggagaaaggctgggagaacacggtggaccaggttggacaggagatcgcctcatacc
tgttgtcttatcagaaagactggctcctgaaaaacaactcctgggatggcttcgtggaattcttccaaggacaagagcca
gagaaggcaattagatgtacacttcttggctttgttgggtttgcaggactttgggcaacacttgccttactgatgagata
ttttctcaggtttgtgtggtag
>gnl|bcl2dbcds|A0A3P8VHY5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=858 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcaggtcaagaaaatga
>gnl|bcl2dbcds|A0A3P8VHY5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=915 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcagggatttcaactccattggaaaagccttcacagtgg
ccttcgatgccatgttcctcttcattcgtcgctga
>gnl|bcl2dbcds|A0A3P8VHY5_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=849 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3P8VHY5_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=849 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcagataa
>gnl|bcl2dbcds|A0A3P8VHY5_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=855 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcagatggaaatga
>gnl|bcl2dbcds|A0A3P8VMA1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL2L1 (length=645 residues).
atgtcgtgcagtaacagagaattggttaagttctttttaggttataagctttctcagaggaactacccagaatctcttct
gatgttgaggattgggggagaacagcgtgaaggtgaggaggtcaccacagcgtccagtaatggcgttcctcagactcctt
cagctgtgctgcagcactgcagtggtgcagaggctgtaaaggctgctctcaaggactcagctgacgagtttgaacttcgc
ttcacacaagcctttcgtaaccttttcttaaagctggacctcactccggacacagtctaccacagttttaagagcgtgat
ggatgaggtcttcagagacggagtcaactggggacgcatagtcggcctgtttactttcggaggagtactgtgtgtggaat
gtgtgcagaggaatatgagtgagttagttccccgcattgcagactggatgaccatgtacttggatgaatacattgatcca
tggatccagagccaaggaggctgggaccgttttgctgagatttttggcacagactgtattccaagaacgaggagttgtcg
ggacacagtgagaagatggctgctagtgggagcaggcctgcttgcagcagtgttgattggtgttctgatcactaaaaagc
attga
>gnl|bcl2dbcds|A0A3P8W7K5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL2L10 (length=654 residues).
atgtgcaactcagcgtctccttccgccgtctctacgagctctgagcagtctgatatcgctgggaggaaaatgtcatgtgg
gctgtggaaagagaccctggctgtggcagaggactacctgtccctctgctgttcaagcccccggccagcccctccacctc
ccagcgagtcagccgctgccatgagacacctggcccaggacatggagaagcagcaccaagctcgcttccagacgttgtct
cagtctttcctgaggcaatgtggctctgagccctgtgtgtgtcttaggaaggttatggaagagctggtaggagacggaca
cttgaactgggggagagttgtttccattttcacctttactggggttctggccaaacagctgttggtccagaagggtttaa
agccggggcaggaacccgaggcagggcaggaactgggaccggagcctggaacctgcagggaactggcagagaccattgct
gattatctgggagaagagaagaaagcgtggcttttggagaatggtggatgggaggggttctgtgagttctctcacagtgc
cagagagctgagccaggactcgtccatgaagaccgctctgtttgctgctgctagtgttggccttgctggactcaccttcc
tcctggtgcgctga
>gnl|bcl2dbcds|A0A3P8WUE9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL-2 (length=714 residues).
atgtacttggtgccaaattctgctggaatggcgagcgagtgtaaccgctatatagtggaaaagtacatctgccataaact
cgccaagcgtgggtacgtgtgggagcacgacgaggaccgagatggagacgctgctaataatggctcaatagtttcccgtc
caccgactctggttcaccggtgccgtggtgccagcaccgggcctgggaacgacggcatccctaacctctgcaaacggcca
cctgcgcccgaggcgcacgccgccattcacagagtcctgcgcgaagccggagacgaactggagcgactgtaccagccgga
cttctcagagatgtcacggcagctctatctcacctccagcacggcgcagaggagattcaccgaggtgattgacgaactgt
tccgggacggcgtgaactggggccggattatcgccttcttcgagtttggaggcgtcgtgtgtgtggagtgtgcggctaag
gaggacttgacgccgcaagtggagcaggtcgtggactggatgacagagtatttaaatggacctcttaacatctggattaa
agagaacgggggatgggatgcctttgtggagctgtacgacagacagggggagtctgccttcagctgctcctggccctcca
tcaagaccgtctttggtctggctgcactgggggccgccagcctcaccatcggagcgtatctgacccagaagtga
>gnl|bcl2dbcds|A0A3Q2C6K4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinodon variegatus GN=BCL2L1 (length=660 residues).
atgtcatacagtaacagagaactggtagagttctatataagctacaaactgtctcagacaaactgcccaaactctctgct
gaggtcggaggtcactggtggccggaccgagggagacaaggacgcctcggcttccagcaatggcccacttttcaacagca
ggcccagcccccccgggaagcctcgggccccccatggaagcatagaggctgtaaaatccgctctgaaggactcagcaaat
gagtttgaacttctcttctctcaaagtttcagtgacctctccatgcagctagacatcacccctgacacggcctaccacag
ctttaaggccgtgttggacgagttgttcaaggatgggatcaactggggccgtgtggtggggctgtttgcctttggtgggg
ttctgtgtgtgcactgcgtgcagaagaatatgagtgagttggtgtcccgcattgcagactggatgaccatttacctagat
gagcagcttaacccttggatccacagccagggaggatgggactgctttgctaagctgtacggccaagacgccgctgcaga
ggggcggagatctcacgagacattgaacaaatggctgctagttggtgcggctctgctcggcggagttctgctcactgtgc
ttgttgctaagaaacgatga
>gnl|bcl2dbcds|A0A3Q2EDX8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinodon variegatus GN=MCL-1 (length=795 residues).
atgagttaccttattcttccacaaaatggagtcgtggacggacaaacgcactacagcccggagattgcagcaccagaaat
accaatgaactccccaatgggatctcttcaccgaaacttaatgaaacgtccgaaggatctgcaagtagcaacgaatggat
acgttggaaaaaacctttcagacaacagcgcagacgacggcgggtctctgccgtgcaccccggagatgccaacggacagc
caccccgccacaccgggcggccatgcgggggacgaagcgctggacaacgacacgaaggagcttattagcagtttcctaag
agactttacgggacttcctaaacaacggcggaatcaaactaaagctctgtctaccatgaaaagggtggtggaggacgttt
tgtcgaaacacagatacgcttacaatggtatgatgaataagctttgtttagatgaagtaccggacaacatgggatttgtg
agttcagtcgccacgagcctcttttcagacggaaccacgaattggggccggatagtgagcctggtggccttcggggctgt
ggtgtgtcagcacctgaaggagaaaggcagagagaactgcgtggagctggtgagccaagagatctccacatacctgctgc
aaaatcagagggactggctagtaaagaacaattcatggaatggatttgtggagttcttcagagtagaagatcctgaagca
acaatgaggaacactctcatggcttttgttggagtggctggtattggggcaacattggcctttctgatcaggtga
>gnl|bcl2dbcds|A0A3Q2FR43_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinodon variegatus GN=BCL2L1 (length=681 residues).
atgtctcagaacagagaactggtccttttctacattaagttcaaactgtctcagaggaactatcccgtcaaccacataat
gctcaacgagccgcccaacggcaccggcgcccagggggcggagcaggacgacgagcgtacgccggagacgcacgctaacg
ggacttttaacgggaccagtccaggctccccgcggcgacagcaggcgtccacagccgccatggaggcggtgaaggcggcg
ctgagagacacggcctgcgagttcgagctgcgctacgcccgcgccttcaacgaccttcacagcacgctgcacatcacgcc
ggccaccgcctaccagagcttcgagaacgtgatgaacgaggtgttccgggacggcgtcaactggggccgcatcgtgggcc
tgttcgccttcggcggagcgctgtgcgtggaatgcgtggagaaggagatgagtcccctggtggggcggatcgtggagtgg
atgaccgtctacttggatgagcagatcgatccctggatccagagccaaggaggatgggaacgctttgctgaaatcttcgg
aggcgacgcagcggctgagagcagaaggtctcaggagagcctgaagaactggctgctgctggggatgagcgtggccaccg
ccctcatagccggctccatcttcgcccacaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q2GL87_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cyprinodon variegatus GN=BCL2L10 (length=621 residues).
atgtgcagagagccgttacatatcactgggaggaaaatgtcctgtgggctgtggaaagagaccgtggctgtcgcagagga
ttacatgcgcctgcgctgctccagcccgctcccagccccgccacctcccagtgagcccgccgctgccatgaggcgcctgg
cccaggacatggagacccagcaccaggctcgtttccacaccctggcccagagcttcctgaggcacagcgggacggacctc
tgctccagcctcaggaaggtgatggacgagatggtgggggacggactctttaactgggggagggtcgtatccctctttac
ctttgccggcgtgctggccagacagctgcaggagcaaacgggcaaaaacccggggctggatcctgggaggcagcaggaac
tgcaaacggagcccgtaagctgccgggcgctggcagagaccatcgccgattatctggagacgcacaaaaaagactggctg
caggaaaataatggatgggatgggttctgtaactacgcccgcaacgccagagaagtcagccaggactcctccatgaagac
ggcgctggttgctgttgccggagtcggcatcgctggactcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A8C1IQE4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=573 residues).
atggcacaggagaatgtgtatgataaccgcagtatagtggagaagtacatccaccataagctctggaagaaggggtacgt
gtgggaagaggaccgcggcggcacccgtcacgacccgtgcagcgcgcttcataaggtgctgcgggaggccggggacgagc
tggagcggctttatcagtcggactttgcggagatgtccaaacagctgcatctcacgtccatcacggcgcagcagcgcttt
accgcggtcatagacgagctgttcagggacggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgt
ttgtgtcgaatgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggatgaccgagtatctgaatgggc
cgctgcacgcctggatccaggagaacggcggctgggaggcgtttgtggagctctacggcaggcagagggactcggtgttt
cgcagctcgtggtcatcaatagtaacggtcttcggtctagccgctctcggggctgttggcttgaccataggagcctacct
tgctcagaaatga
>gnl|bcl2dbcds|A0A8C1JUN1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=921 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctgcagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggtaaagccatgtg
acaacacatgtactaatctgcacattcttgttctatggtaa
>gnl|bcl2dbcds|A0A8C1JUN1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=744 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctgcagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A8C1JXA4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinus carpio GN=BCL2L1 (length=720 residues).
atgtcttactataacagagaactggtggtattttttattaaatataaactctcacagaggaactacccgtacaatcacat
tgaatttacagaagacacacatcggactgatgcggtggaagggaatgatgatgaggaggcagcaggaacaacgaccctcg
ttaatggctccctgaacggaacaagtactggttccactgggaccccaccaaggtcccccacttcagccccccagcgtcag
acgaacgggactgggggtcttgatgcagtaaaggaggcgcttcgcgattctgccaacgaatttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcgcattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcggagatctttggaaaagatgcagcggcagagagcagaaaatcgcaagaaaact
tcaagaagtggttgctggctggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C1YDY0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=783 residues).
atgactctaagttttgggattaaacgaacggccgcgttgagtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgg
gcccgcgctcaaaccgcgcacggaggacgagcttgacgggtacgcggatgacacggaagccgcgctgaagccgccgaggc
ccgggacgaacggcttgaaagggctgcagctggacgggcggttcgtgtccgcgggggacggctctctaccggccaccccg
gacccgaaggagctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatttctatcgcacgcacacggg
aatgtgtccgccggaccggaagcgtcatcacgcgttaccgacaatgaggcgcgtcgtcgcggacattctgataaagcacc
agatcacttacaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagcc
aagaccatgttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgca
gctgaaggagctgcagagagagcagtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacg
actggctgctcaacaacaagagctggcatggattcgtggagtttttccgcgtggaggacgtggagtctgtggttcgcagc
gctctgatggctgttgtgggatgtgctgggattggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|X4ZGI8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=690 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttccggggaggatgatgacactatcaatacgggagtggaggactcctctccgagctctgacagga
ggctccaggctccctcagccggagggggaaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccagatgacattcagtcccagtgcagcacaacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggacgc
ctttgtggagttatacagtcagcagagagaccctatgttccacccattgtcgtacctaacgaaagtgcttggattggcag
cactaggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
>gnl|bcl2dbcds|A2BF68_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaaatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|A2BF68_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=390 residues).
atgattctctggactctttcaggtatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagca
agtggcaacagagctctttagcgatggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgt
gcaaataccagaatgacagaggacatagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagag
cagcgggactggatactcagaaacaaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgt
gagaaacacacttctaacaattggtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|A3KNH9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Danio rerio GN=BCL-2 (length=687 residues).
atggctaacgaaattagctatgacaatcggaatattgtggagaaatacctcaagcataaactttcaaagcgaggatatgt
gtggaaatgtcagtcctctgctgaggaagatgacaccttcaataaagcagtggaggaatcctctccaaactctgacagga
ggcttcaggctccctcagccggcggagggaacaactctgaatgcctgatagcccgggtcactcgttcagaccctcatttg
aggctctaccgggtgttacgggatgctggagatgaaatagaaaggatttaccaacgcgaatttgaggaaatgtcccaaca
aatggtgttcaacccaaattctgcgcaacgcagctttctaaccgtggccgaagagctctttagagacggagtgaactggg
ggcggatcattgcattcttcgagtttggtgggaccatgtgcgtggaaagcgtcaaccgggagatggcgtcccaggtagat
aatattgcacactggatgactgactacctgaacgggccactggaaaactggatcgaggaaaatggaggttgggatgcctt
cgtggagatgtacggtcagcagagagactctgtgttccacccgttttcatacctaacaaaagtgctcggcttggcggcgc
tgggcttggcaggagtgaccatcggagccttttttgctcagaagtga
>gnl|bcl2dbcds|B2GRK1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|B2GRK1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|Q1L8X3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=768 residues).
atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgttcaaactccgacgctaaagac
gtgcgtcgaagacgaactggacggatacattgaggaggaggaggcgcctctgaagcggcttagaccgggtacaaacggcc
tgaaggggctgcagctggacggtcgatttgtttctgcgacagacggatctctaccgaccaccccagatccggaggagctc
gactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgcacacacacgggaatgtgtccggtaga
ccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaag
gaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgtttaaa
gatggcgtcactaactggggccgaattgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagctcca
gcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaa
acaagagctggcatgggttcgtggagtttttccaccaggaggacgtagagtctgttgtccgtcatggtctgttggcgctg
gtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
>gnl|bcl2dbcds|Q564A4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Danio rerio GN=BCL-2 (length=687 residues).
atggctaacgaaattagctatgacaatcggaatattgtggagaaatacctcaagcataaactttcaaagcgaggatatgt
gtggaaatgtcagtcctctgctgaggaagatgacaccttcaataaagcagtggaggaatcctctccaaactctgacagga
ggcttcaggctccctcagccggcggagggaacaactctgaatgcctgatagcccgggtcactcgttcagaccctcatttg
aggctctaccgggtgttacgggatgctggagatgaaatagaaaggatttaccaacgcgaatttgaggaaatgtcccaaca
aatggtgttcaacccaaattctgcgcaacgcagctttctaaccgtggccgaagagctctttagagacggagtgaactggg
ggcggatcattgcattcttcgagtttggtgggaccatgtgcgtggaaagcgtcaaccgggagatggcgtcccaggtagat
aatattgcacactggatgactgactacctgaacgggccactggaaaactggatcgaggaaaatggaggttgggatgcctt
cgtggagatgtacggtcagcagagagactctgtgttccacccgttttcatacctaacaaaagtgctcggcttggcggcgc
tgggcttggcaggagtgaccatcggagccttttttgctcagaagtga
>gnl|bcl2dbcds|Q568V1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=732 residues).
atgagcttcctcgcgcagggcgttcaaactccgacgctgaagacgtgcgtcgaagacgaactggacgggtacattgagga
ggaggaggcgcctctgaagcggcttagacctggtacaaacggcctgaaggggctgcagctggacggtcgatttgtttcta
cgacagacggatctctaccgaccaccccagatccagaggagctcgactacgccgaactggaacgcgatactcggcagctc
ttattggatttttaccgcacacacacgggaatgtgtccggtagaccgtaaactccatcacgccataccgacgatgaagcg
ggtggtcgacaatattctcgtgaagcaccagatcgcatacaaaggaatgatccagcgtcttcagctggactctcagccgg
cctctctggacttcatcagatgtatagcaagcaccatgtttaaagatggcgtcactaactggggccgaatcgcgagtctg
gtggcgttcggggccgtggtttgctctcgattgaaggagctccagcaggatcagtgtgtggagagagtggctgagcagat
ctcctcatatctgacctcagaacagcaggactggatcctcaaaaacaagagctgtcatgggttcgtggagtttttccacc
aggaggacgtagagtctgttgtccgtcatggtctgttggcgctggtcggatgtgccggtatcggcgccggtctggccttc
ctcatccggtga
>gnl|bcl2dbcds|Q568W5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaataatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q8UWD6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaaatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtagtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q90Z98_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgcttcgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|Q9I9N3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=768 residues).
atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgttcaaactccgacgctaaagac
gtgcgtcgaagacgaactggacggatacactgaggaggaggaggcgcctctgaagcggcttagaccgggtacaaacggcc
tgaaggggctgcagctggacggtcgatttgtttctgcgacagacggatctctaccgaccaccccagatccggaggagctc
gactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgcacacacacgggaatgtgtccggtaga
ccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaag
gaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgtttaaa
gatggcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagctcca
gcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaa
acaagagctggcatgggtttgtggagtttttccaccaggaggatgtagagtctgttgtccgtcatggtcttttggcgctg
gtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
>gnl|bcl2dbcds|A0A8C4BCS5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Denticeps clupeoides GN=MCL-1 (length=774 residues).
atgagcctgagcgccatgaagcgtccggcgggcagcgtgatcggcctgctctgctcgcacttcgcggttccatgcgcggt
cgcggacaacaaaggggaccccggggacgagctggacgaggcggactctttcgcgctgaagcccgagcgccgggacatgg
gcctggacagcggcttccagagctccgacgacgacgcgtccctgcccgcgtcccccgacgggccgccgcgcacgatcctg
gaccgcgaccgcgacgccctggagctcgagaccaggcagctcgtcggcgacttctaccggatctacgtcggagggaagcc
cgccgacacgcgtccgcacaacgcgctgccgaccatgaggaaagtcgtggacgaggtgctgcggaagcaccagatatctt
tcaaaagtatggtccagaaattggtgctgcagtctcagaacgagaagatggcctttgttacggcagtcgccaagaacata
tttaaagatggaaccaccaactggggccgcatcgccagcctggtggcatttggggccgtggtctgccgagaactgaaggc
gattgacagggaggactgtgtggagaccgtgactacgcagatctgcacgtacctcgccaccgaacaaagggagtggttcg
tcaataacagcggctgggttggctttgtggacttctttcacgtggaggatccagagactgtagtctggaacaccttgatt
gcagtagcaggcttcgcggggctgggagctggcctggcgctcatgatcagatga
>gnl|bcl2dbcds|A0A8C4CMF6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Denticeps clupeoides GN=BCL2L1 (length=726 residues).
atgtcctacagcaacagagagctggttgtgtattacatcaactataaactgtcccagaggaactaccctctgagccacgt
cggcctgacccaccagatggagtctccagtggacagcagtcaggagggcgcaggtgtgacggcgctgtccaacggctcag
tgaacggaacaagcgcgttgccggcatccgccgagctgtccccgctgctgtccccggtgctgtccgggaacggtagcggt
ggtggcgccagcagcagcagcagcatcgatgccgtgaaggaggcccttcgagactctgccaacgagttcgagcttcgtta
ctcgcgggccttcagcgacctctcgtcccagctgcacatcacgcccgccaccgcgtaccagagcttcgagagcgtgatgg
acgaggttttccgcgacggcgtgaactggggccgcgtggtgggcctgttcgccttcggaggggcgctctgcgtggagtgc
gtggagaaggagatgagtccgctggtagcgcgcatcgccgactggatgaccgtctacctggacaaccacatccagccctg
gatccagagccaaggaggatgggaccgcttcgctgagatcttcggcaaggacaccgccgcagagagtcgtcgctctcagg
aaagctttaagaattggcttgtggcagggatgaccttggttacaggagtcgtggtgggttcactcattgtccggaagcac
ctgtaa
>gnl|bcl2dbcds|A0A1X9JZA1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgccataaactctccaaacagggctacgagtgggggtt
tgacgctgtccggaatgcagatgccggtaataatgggtcaatagttgcccctccaccgagtttggtccgccggtgccgtg
gagccagcaccgggcccgacagcgagagcatcccccacctctgcacacggctcccccagtccgacccgcatgccgccatc
cacagagtcctacgcgaggctggagacgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgta
tctcacctccaccacggcgcagaggagattcgccgacgtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcgggggcacggtgtgcgtggagtgcgtggcgaaggaggagatggcagcgcaggtgaacaac
atcgcggagtggatgactgagtatttaaatggacctctgaacagctggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactccgtcttcagttgctcctggccctccattaagacggtcttcggtgtggctgcgc
ttggagcagctagcctcaccatcggagcgtaccttacacagaagtga
>gnl|bcl2dbcds|A0A8C4HJC9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL2L10 (length=591 residues).
atgtgcagagagcagtctgatatcgctgggaggaaaatggcatgcgggctgtggaaagagaccctggctctggcagagga
ctacctgtccctgtgctgcacaagcccccagccagcccctcaacctcccagcgagtcagccgctgccatgaggcgcatgg
cccaggacatggagacgcagcaccaggctcgctttcagtccctggctcagaccttcctgaggcagtgcgggccggacccc
tgctccagcctcaggagggtgatggaggagctggtgggagacggacacttgaactgggggagggttgtttccattttcac
ctttactggggtgctggccagactgctgctggagcagaaggacacaaagccggggctggaccctggaagatgcagtggac
tggcggagaccatcgctgattacctgggagaggagaagagagagtggctgctggagaatgacggatgggaggggttctgt
aagttctgccgcagtgccagagaagtgagtcaggactcgtccatgaagacagcgctgtttgccgctgctggcgtgggcct
cgctggactcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A8C4IRU9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL2L1 (length=621 residues).
atgtcgtacagtaacagagagctggtggagttctttataagctataaactgtctcagaggaaccacccaacctctctact
gaggccggagaatgccggtgaaaggactgagggagacaaggccaactcagctgccagaaacggcttgctggccagcgctg
acatagaggctgtaaaggcagctcttcgggactcggcagatgagtttgaactgctcttcacgcaagcgtttagtgacctt
tcctcgcagattgacatcactcctgacacggcctaccacagctttaaaagcgtgatggacgaggtgttcaaggatggagt
gaactggggacgtatagtgggcctgtttgcctttggcggtgtactgtgtgtagaatgtgtcgagaaagatatgagtgagc
tggtttcccgcatcgcagactggatgaccatgtacctggatgagcacatcagtccgtggatccagagccaaggaggatgg
gactgctttgctgaggtttttgggcgagacgccgccgcagaagcgaggagatctcgggagactctgagtagatggctgct
aattggggtggcgctgctaatgggagctgtggtcggggttctcattgctaagaaacattga
>gnl|bcl2dbcds|A0A8P4G790_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=MCL-1 (length=1101 residues).
atgaatataattcagacaaatcgggccgcctacagcctaacgaacggaaacatgagcgtatttctcactcaaaatggagg
cgtcgacggacacatgcactacggaccaggagattcatcccctcagatcgcaatgggctcttctctagcctctcacaacg
ggagtgtcggctccagcgacgccccgaaacggccaaagaacctgggagtgagtccgactaatgggtatttaacaaaagcc
attcgcggggtcagcgacgacgtcgaggacggctctctgccgtgcaccccggagctcctctcggacactgaaatcgacgt
ctccgggtgtccagcgggggacgaagtgttgaacagtgaaacgacgcaactcattgactgtttcctgagagactttactg
gactttctaaatctcggtggaacgaaagcaaagcactagcaacgatgaaaagagttgtggatggcgttttggagaaacac
agatacgcgtacaatggtatgatcagaaaactgtcattagatgaaagggaggacgatgcaagctttgtcggggcggtagc
aaagagcctctttgcagatggaaccaccaactggggtcgtgttgccagcctggttgcctttggagcggtggtgtctcagt
acctgacggagaagggcaggggcaactgtgtggagctggtgggacaggagatctcctcgtacctgctgacgcaccagcgg
gactggctggtcaagaacaactcttgggatggctttgtcgagttctttcgagtagcagacccggagtccacagtgaggaa
cacactcatggcctttgctggatttgccggtatcggggcgacactggccctgttgatcagacggcctaggctgctgtttc
ctcgaaatttgatgagactgcagcagcgcctccatcacactaagcgctcagctgcatccgccgagttgcacagttctttg
caaagctggtgcataacatctgaatgcaccagcacaagctatattgtgaaactggggttaaagagttcaaaattgtgtac
cactctatttcctgggttggaaggctacctagaaactggggactttaaacaaatacattga
>gnl|bcl2dbcds|A0A8P4G790_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=MCL-1 (length=1176 residues).
atgaatataattcagacaaatcgggccgcctacagcctaacgaacggaaacatgagcgtatttctcactcaaaatggagg
cgtcgacggacacatgcactacggaccaggagattcatcccctcagatcgcaatgggctcttctctagcctctcacaacg
ggagtgtcggctccagcgacgccccgaaacggccaaagaacctgggagtgagtccgactaatgggtatttaacaaaagcc
attcgcggggtcagcgacgacgtcgaggacggctctctgccgtgcaccccggagctcctctcggacactgaaatcgacgt
ctccgggtgtccagcgggggacgaagtgttgaacagtgaaacgacgcaactcattgactgtttcctgagagactttactg
gactttctaaatctcggtggaacgaaagcaaagcactagcaacgatgaaaagagttgtggatggcgttttggagaaacac
agatacgcgtacaatggtatgatcagaaaactgtcattagatgaaagggaggacgatgcaagctttgtcggggcggtagc
aaagagcctctttgcagatggaaccaccaactggggtcgtgttgccagcctggttgcctttggagcggtggtgtctcagt
acctgacggagaagggcaggggcaactgtgtggagctggtgggacaggagatctcctcgtacctgctgacgcaccagcgg
gactggctggtcaagaacaactcttgggatggctttgtcgagttctttcgagtagcagacccggagtccacagtgaggaa
cacactcatggcctttgctggatttgccggtatcggggcgacactggccctgttgatcagatcctccccgttgtctcggg
ttacaggacaaacaacactcatcgaggtcttaggaggaaatggagtagagcctctccatggtgatgatccacagcagacc
tccctgtgtcctctcctgtggctaatgatgttagccaccaccctggttacccctgcacagttcattgtgaagaacaggct
gctacacaatggggaattgaggctgaggcaattttctagagcggtttgcaccatacacaagtgtattgggagtgcagaaa
acagactgcactgcagtgtcttggggctgaatatgcaaagcacccttggtctttga
>gnl|bcl2dbcds|E6ZFR0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL2L1 (length=663 residues).
atgtcgtacagtaacagagagctggtggagttctttataagctataaactgtctcagaggaaccacccaacctctctact
gaggccggagaatgccggtgaaaggactgagggagacaaggccaactcagctgccagaaacggcttgctggccagcaaga
acacaagtggccagccggggacgtcttcgtcctcaggcgctgacatagaggctgtaaaggcagctcttcgggactcggca
gatgagtttgaactgctcttcacgcaagcgtttagtgacctttcctcgcagattgacatcactcctgacacggcctacca
cagctttaaaagcgtgatggacgaggtgttcaaggatggagtgaactggggacgtatagtgggcctgtttgcctttggcg
gtgtactgtgtgtagaatgtgtcgagaaagatatgagtgagctggtttcccgcatcgcagactggatgaccatgtacctg
gatgagcacatcagtccgtggatccagagccaaggaggatgggactgctttgctgaggtttttgggcgagacgccgccgc
agaagcgaggagatctcgggagactctgagtagatggctgctaattggggtggcgctgctaatgggagctgtggtcgggg
ttctcattgctaagaaacattga
>gnl|bcl2dbcds|A0A8C4JDK2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dromaius novaehollandiae GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaaggactacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggccgggatggccggtgtcctcaacgggagcccgtcctggc
acccccctgccagccacgtagtgaacggagccgccgtgcacaggagcagcctcgaggtccatgaaactgttcaagcagcc
gatgtgaggcaggcgctgagagaggcaggcgatgaatttgagctgaggtaccagagagctttcagtgacctcacttccca
gctccacatcacccctgccacggcgtatcagagcttcgagcaggtggtgaacgaactcttccgggatggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgtgtggagagcgttgagaaggagatgcgggtattggttgga
cgcattgtatcttggatgaccacgtacttgaccgaccatctagatccctggatccaagaaaatggcggatgggagcggtt
cgtggacctctacgggaataatgctgctgctgagataaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggcaggcgtgcttctgctgggatctctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C4JDK2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Dromaius novaehollandiae GN=BCL2L1 (length=633 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaaggactacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggccgggatggccggtgtcctcaacgggagcccgtcctggc
acccccctgccagccacgtagtgaacggagccgccgtgcacaggagcagcctcgaggtccatgaaactgttcaagcagcc
gatgtgaggcaggcgctgagagaggcaggcgatgaatttgagctgaggtaccagagagctttcagtgacctcacttccca
gctccacatcacccctgccacggcgtatcagagcttcgagcaggtggtgaacgaactcttccgggatggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgtgtggagagcgttgagaaggagatgcgggtattggttgga
cgcattgtatcttggatgaccacgtacttgaccgaccatctagatccctggatccaagaaaatggcggatggcgctgcat
gggactctgcccgtgggaggtatatggcctacagatgtctgagttttcttcttgcttctgctttgggatctga
>gnl|bcl2dbcds|A0A8C4K2K9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Dromaius novaehollandiae GN=MCL-1 (length=537 residues).
cctgtggggaggcctctggggggggtgtgtgggcctggcctgtgtggggccctcgaggtgggtgggcaccggctctgccc
cgcggctgcaggcagctctgggggctgggggcgacctgggcccccaccagctttgggggctggagcgaggctgcagatcg
cctctcccgcagggatgctgcggaagctggacatccagaaggaggaggacctgcagtccgtgtgcgaggtggcagcccac
gttttcagtgacggagtaacaaactggggcagagttgtgacactcatctcgtttggtgcctttgttgcgaaacacctgaa
gagcataaaccaggagaagtgcatcagctcgttagcagggatcatcacagacgcgctggtctcctctaaacgggagtggc
tagtgagccagggaggctgggagggcttcgtcgacttcttccgcgtggaggacctggaagggagcatcaggaacgtcctg
atggctttcgcgggcgtcgccggactgggcgcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A665TFT7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Echeneis naucrates GN=MCL-1 (length=816 residues).
atgagcctttttcaaacacacaagtcttctgccttcgggtccgcctccacctccatgaacctgctaatctgcgacccgaa
cgtactgccgaagatgtggaccggcggggccggggcctcctccgtggactctccgatccggagcgacgtcgccaaacgac
ccaccaacctggaggtgagctctaaaggcggctgcccgccgaaaatcgtccgggaaaacagcggcggggagtccgtagct
tgcaccccggagagcaactcagacagcgaggccgaggcctcctctccggccgagagggagctgctcagggccgatacatg
ccagctcataagccagaccatgaggtggtacaccgagtggtccacgccgaggacgaagcagcacagagggctggacacca
tgaagagagtcgtggacgggctcctggagaagcacggaatcgcctacaatggtatggtcaacaaactgtcactggacaac
acagaggacatgagttttgtctgtttggtggcccagaaactcttctcagacggcaccaccaactggggccgtgtggccag
cctggccgccttcggggtggtggtgtgtcggaggctgaaggagatgggcagggagagctgtgtggaatctgtaggaatgg
agatctccaaatacctgttgtctgaacagaaggactggctgctgaagaacaattcatgggatggctttgtggagttcttt
cacgttgtggacccagagtcatcagtgaggaacacactcatggcctttgctggagtggcaggcatcggcgcaacactggc
cctgttgatcagatga
>gnl|bcl2dbcds|A0A665U7Y7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Echeneis naucrates GN=BCL-2 (length=687 residues).
atggagagcgagtggaaccgcaatattgtggaaaattatttacgctataaactcgccaaacggggctatgcgtggggatt
tgatgacgtccggaatgaagatgctgctactaatggctcaatagttgccccatccccgactttggtccgccggttccgcg
aagccagcagcgggcccgacaaccagagcgcgcccgagcggtacggacggcccccgcagtccgacccgaacgccgacatc
cacagagtcctccgggaggccggagacgaacttgagaggttgtaccagccggacttcacggagatgtcccggcagctgta
catctcctcctccgtggcgcagaggaggttcgccgaggtgatagacgaactcttccgggacggagtgaactggggccgga
ttatcgccttcttcgagttcgggggggccgtgtgcgtcgagtgcgcggccaaggaggagttgagcccgcaggtggacaac
gtcgcggagtggatgacggagtatttaaacggacctcttaacagctggataaaggataacgggggatgggatgcctttgt
ggagctgtatgacagacagggcgactccatcttcagctgctcctggccctccatcaagacggtcttcggtctggctgcac
tcggggccgccagcctcaccatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A665VM40_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Echeneis naucrates GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggttgttttctacataaaatataaactttcccagagaaactatcctctcaaccacatgga
gttcaatgaatctcttcacaggactgatggtgggggggcagggttggttgaagaacaaagggtagcaacgcattccaacg
gaacttttaatggcacaagttctggaacccggtcagagtccccacaggggcagcaacacttggcatcaatgacaagcctg
gatgcagtgaaggaggccctcctggattctgccaacgagtttgaattgcgatactcccgcgccttcagcgacttgcacaa
ccagctgcatatcacaccggccacagcttacataagctttgaaaacgtgatggatgaagtgttccgtgacggcgtcaact
ggggccgcatcatagggctttttgtgtttggtggggcactatgtgtcgagtgcgtggagaaggagatgagtccactggtg
gtcaggatcattgaatggatgacagtctacctggacaacaacattcagccctggatccagggtcaaggaggatgggagca
ttttgctgaactctttgggcacgatgctgcagcggagagcagaaggtcacaggaaagtttcaccaagtggctgctggcag
gaatgaccctgctgactggagttgtggtggggtcactgatcgccagaaagcgcctgtga
>gnl|bcl2dbcds|A0A665VSD7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Echeneis naucrates GN=BCL2L1 (length=654 residues).
atgtcgtacagcaacagagagctggtggagttcttcatacactccaaactgcctctggcctcgctgctgaggccagagga
tgctggtggacagactgaaggagacaaggccaactcagctgctaggaatggcctacctgtcatcagtgggagcatgctga
gttacactaggacccccccacccccaccatgtgacattgaagctgtaaaggaagctcttagggactctactgatgagttt
gaattcctcttcaggcaagcatttagtgacctttcctcacagcttgacatcacttctgacacagtctaccagagcttcga
gaccgtgatggatgaggtgttcaaggatggcatcaactgggggcggatagtggccctgtttgcctttgggggtgaacttt
gtgtggaatgtgttgagaagaatatgagtgagatggttcccagcattgcagagtggatgaccatatacttggatttgcac
atccgtccatggatcgagacgcaaggaggctgggactgctttgctgagatttttgggcagaactccgctgcaacagcgag
gagatctcaggaggctgcgaggaggtggctgctagttggagtggcgctgctgacaggagtgctgatgggtgtgctcattg
ctaagaaacagtga
>gnl|bcl2dbcds|A0A665VTJ8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Echeneis naucrates GN=BCL2L10 (length=579 residues).
atgtcatgtggggtgtggaaagagaccttggttgtggcagaggactacctatacctttgctgcacaaagccacagccagc
acccccacctcccagcgaatcagccgctgccatgaggaccgtggcccaggacatggaggcgcagcaccaggctcgcttcc
actcccttgttcagaccttcctgaagcagtctgggcaggacccctgtggcagcctcaggaaggtgatggaggagctggtg
ggagatggacacttgaactgggggagggtggtttccattttcacctttactggggtgctggccagacagctgctggagca
gagtggcatgaatccggggctggaccctgggaaaaaactgggacaggggcctggactctgcaggggactggcggagacca
tagctgattacctgggagaggagaagaaagactggctgctggagaatgatggatgggagggattctgtaagttctctcaa
agtgccagagaggtgagtcaggactcgtcaatgaagacggcgctgtttgctgctgctggcgtgggcctcgctggactcac
cttcctcctggtacgctag
>gnl|bcl2dbcds|A0A4W4F1X6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Electrophorus electricus GN=MCL-1 (length=795 residues).
atgagtatgacgacgatgaagcgcacgacagcgatagggctgctgtgtaacggggctcaacacggagtgaaggacagctt
cgtcctcggggtgcgtcccacaatggcggcggaggacgagctggacggatgcgcggaggacacggatgggtggcccctca
aacccgccaggcacggtagaggcttgacactcgacacccggttccctcagtcttcaaacgcagacggctctctgcccact
tcccccgactcccaggagactctcccggacttcaggtctgatctggacgcggagactcgggagcttctcggatactttta
tcggacttacacaggacttccgcacaggagaactaaactcagcgctctgcccacgcttacgagggtcgtgggcgatgtga
tctgtaagcaccggattgcatataatggtatggtacagaagctgcagatggaggagcagagtgacgacctggaggttgtg
agcactgtggccaagagcatgttcagtgacggcatgactaactggggccgtgtggccagcctggtggcatttggcgcggt
gctgtgtgagagcctgaaggagagtgggagagatcactgtgtcgacaccgtagcccatcgcatctcatcctacctcacca
cctaccagcatgaatggctcctcaacaacaagtcctgggatggctttaaagaatttttccaagtggaggatccagagtct
gtggttcggaatgctttgatggcagtggcaggatttgctggtcttggggcagggctagctctcctgatgaggtga
>gnl|bcl2dbcds|A0A4W4F7Z4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Electrophorus electricus GN=BCL-2 (length=672 residues).
atggcaaacgaaaatctcgatcataatcgtaacatagtagaaaagtatctcaaccacaaactgtcgaaaaatgggtacat
gtgggaattccattcgcgtgagacggaccctgaccctgcctctaatggctttgacgctccggagcggcgatgtcaagcaa
gcacagacgaggaagagaccgttcaccgagccccacgcgcgccccttcccgacccgtatgctgctctccacagggttttg
cgcgaggccggcgacgagctggaaagattatatcagccggactttgccgagatgtcaaagcagttacacctaacatctat
cacggcgcagagaaggttcacagctgtcatagacgaactgtttagggacggggtcaattggggtcggattattgcgtttt
tcgagttcggagcgtcggtgtgtgtagaatgtgtaaataaagagatgagtgcgcaggtggataacattgcgggctggatg
acggagtatttgaatggaccactgcacagctggatccaggagaacggtggatgggatgccttcatggagctgtatggcag
gcaaaaggactccgttttcagtagttcttggccttccatagtgacagtcttcagcttggcagcactgggagcagtcggct
tcaccataggagcctacttagctcagaaatga
>gnl|bcl2dbcds|A0A4W4GHX3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Electrophorus electricus GN=BCL2L1 (length=702 residues).
atgtcgtactacaacagagaactggtcatgtactatatcaggtacaaactctcccagaggaactatccctgtagccacat
cgggctcacagaagatatgggccagactgaggggggtccggagggagaggatggtgcggaggccgcggcaacgccgacgg
cagtggccaatggctctacggcaagccccacccggttgccggcctcgcctgggccaagggcggcgaacggaggcggggga
ctggaagccgtgaaggaggccctgcgggactcggccaacgagtttgagctgcgctactcgcgcgcattcagcgacctgtc
ctcacagctgcacatcacgccagccacggcgtaccagagtttcgagagcgtcatggacgaggtgttccgcagtggcgtca
attggggccgaatcgtgggcctgtttgccttcggtggggccctttgcgtggagtgtgtggagaaggagatgagtccactg
gtggggcgcattgccgagtggatgaccgtctacttagacaaccacatccagccgtggatccaggagcaaggaggatggga
gcactttgcggagatcttcgggaaggacgcagcagcagagaacagaaggtcgcaggaaagcttcaagaaatggctgttgg
ctggaatgaccctgttcacaggggtcgtggtaggctccctctttgctcagaagcgcctgtaa
>gnl|bcl2dbcds|A0A4W4H9I6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Electrophorus electricus GN=MCL-1 (length=693 residues).
atgattaatccacaagatatgtgttacagcaaggagagctccggaccaggaatgagacccgtgctatctttaggaatcac
ctctgacaaaagggtcattggcgaaggctcgttaccaaattcccccgagtcagactgcgaggagttgagcgtagttcgct
tcacggagggcagaactctggagaacgacacgcgagaaatcattaacgattcgcttctcgagcttacaggccgttctaat
tactacagtcgtcataggaaggtcgtaggaacaatgaagcgcgttgtaaacagcctggtggagaagcatgaacttgctta
taaaggtatgattgtgaaactgaatttggaggagagaggcgaagatatgcgtgtgattacgacagtagctaaggagatgt
tcagtgatggcaaaaccaactggggccgcattgccagtttgctggcctttgggtccatggtgtgcaaatatcataatgag
aagggccaaggccaccgtgtgcgtctggtgggagaagaaatctcctcttatctcctttctgacaaaagggactggctatt
gaaaaataaagcatgggatggttttgtggatttttttcatgtttcggatcctgagtcgaaactgaggaatgcgttaatga
ccattgctactgtggcagggattggggctggaattgccttttttagaagataa
>gnl|bcl2dbcds|A0A219P0Y3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Epinephelus coioides GN=BCL2L1 (length=699 residues).
atgtgtcaaaacagagaactggtggtttgctacataaaatataaactaacccagagaaactatcctctcaaccacatggg
actcatagagcctccaaacaggactgatgggggggaggcagggttaggtgaggagcagcgggtagcgacacacgccaacg
ggacttttaatggcatgagtcccgggaccccgccagcatccccgctgcggcagcaacagttgccatcaacaacgagcctg
gacgcggtgaaagaggccctccgggactccgccaacgagtttgagctgcgatacgctcgcgccttcagcgatctgcacca
ccagctgcacatcacgccggccacagcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacggagtcaact
ggggccgcatcgtagggcttttcgctttcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagtccgttggtg
ggcaggatcatagagtggaagacccgctatctggacaaccacattcagccctggatccagagccaaagaggatgggagcg
cttcgccgaaatcttcgggcaggacgcggcggcagagagcaggaggtctcaggagagtttcaaaaagtggctgctggcgg
ggatgaccctggtgaccggagttgtggtgggctcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A510BW31_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Epinephelus coioides GN=BCL2L1 (length=666 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagctacaagctgtctcagaggaaccacccgacctctctact
gaggccagagggtgctgaaggaaggaccgagcgagacaaggccagctcagctgccagtaacggcttgctggtcaacagca
ggaatgggggcagccagccggggacttcatcacccccgcatggtgacatagaagctgtaaaggcagctctgcgggactca
gcagatgagtttgaactgcttttcacgcaatcatttagtgacctttcctcgcagctagacatcactcctgacacagccta
ccacagctttaagagtgtgatggacgaggtgttcaaggatggagtcaactggggacgtgtagtgggcctgtttgcctttg
gcggtgtgctgtgtgtggaatgtgtagagaaggatatgagtgagctggtttcccgcatcacagactggatgaccacgtac
ctggatgagcacatcaatccatggatccagacccaaggaggatgggactgctttgctgagatttttgggcagaacagcgc
tgcagaagcgaggcgatctcaggagagtctgagaagatggctgctagttggagtcgcgctgctcatgggagtgctggtcg
gtgtggtcatcgccaagaatcactga
>gnl|bcl2dbcds|A0A8C4L1K6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus asinus asinus GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcgaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggacgcctttgtggaactgtacggccccagcatgcggccgctgtttgatttctcctggctgtctctgaaggcgctgc
tcagtctggccctggtgggagcttgtatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C4L244_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Equus asinus asinus GN=MCL-1 (length=1053 residues).
atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttggcggccggcggcggcgg
cgcctcgtcgccgggagggcggcttttggctgcggggaaggaggccacggcccggcgagagggagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgggagcccccagaccaccctcgcgccggactccctgagggtcgcgcggccctcc
cccattggcgccgagggccccgacgtcaccgcgcccccctccaggctgcgtttcttcgcgcccacccgctgcgcgtcgcc
gcctgaggggatggaagccccggccgccgacgccatcatgtcgcccgaggaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccttgctggagtttgtccgggaggccagcagtggcccctgcacggacggctcgctc
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctggagattatctctcgttaccttcg
ggaacaggctaccggcgccaaggacacgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccctgc
ggcgggtcggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttcggaaactggatatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggagtgacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgtcctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggcgctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C4L2X1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Equus asinus asinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctgggacacctttgtggaactctacgggaacaacgcggcagccgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaagtga
>gnl|bcl2dbcds|A0A8C4LWK5_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Equus asinus asinus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccccggggagggcccagccgctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgctgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagactcggc
tggccgactggatccacagcagtggaggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcattgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C4PQL1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Equus asinus asinus GN=BCL2A1 (length=525 residues).
atgaccgactgtgagtttggatatattcacatgctggcccaggactacctgaagtacgtcctgcagataccacaacctgg
atctggtccaagcaaaacatccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatttgaaac
catgcttggacaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaa
gacggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaagaaacttctaccagagcg
aattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacttttctggaagtt
actggaaagatgtgtgaaatacttttcctgaagcaatactattga
>gnl|bcl2dbcds|A0A3Q2H0F6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Equus caballus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctgggacacctttgtggaactctacgggaacaacgcggcagccgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|A0A3Q2H0F6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Equus caballus GN=BCL2L1 (length=738 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctggaaagaaactgctttggggaccttctgctacttcgtttcatccctgatgagactctcaggccaaggcggagccttac
agctagctccaagctacagtgctttttgggcagactccagagctcccctcggaactagaggtttttctctcgctcttcag
gaaatgccattgcaatga
>gnl|bcl2dbcds|A0A3Q2HRY3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus caballus GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggacgcctttgtggaactgtacggccccagcatgcggccgctgtttgatttctcctggctgtctctgaaggcgctgc
tcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A3Q2HRY3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus caballus GN=BCL-2 (length=858 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctggcaactttgccaagcaccaacaggctctcaggaaatgttcagcggtgggtggaccattcattctggctctccattgc
agaatctttgtgtgtcaagggcaggaaattggttttcagagaagaaaaatatgacttggtgtttaacttcagacaaggat
gtaatcgacaggacacccatccgcatgtatcagggaaggaagagtagagaggcagaaatacaaagccagtgcagacctcc
gtgcatgctgctgcacctgctggaaatccaggttccagttctgtttctcagtgagtaa
>gnl|bcl2dbcds|A0A5F5PK00_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=696 residues).
atgaccgactgtgagtttggatatattcacatgctggcccaggactacctgaagtacgtcctgcagataccacaacctgg
atctggtccaagcaaaacatccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatttgaaac
catgcttggacaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaa
gatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaagaaacttctaccagagcg
aattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
taaggcaaaatggaggctgggtgattgcccacagtcagtatcaaaaatccaaaaggatttccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcagggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcaa
tagcaatcacatggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaacatcctggaatattcatc
agcctggtgaggaggaggttcgggaggaggccttgtcaacagcagcctggagatga
>gnl|bcl2dbcds|A0A5F5PK00_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=693 residues).
atggaaaagcaatttgaagatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaa
gaaacttctaccagagcgaattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacga
aaaacacaggagaatggataaggcaaaatggaggctgggtgattgcccacagtcagtatcaaaaatccaaaaggatttcc
atctttctgagcatgcaagatgaaattgagacagaagagatcatcagggacattttccaacaaggcaaaacctgctttat
cccacggtaccagttcaatagcaatcacatggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaa
catcctggaatattcatcagcctggtgaggaggaggttcgggaggaggccttgtcaacagggggacttgatctcatcctc
atgccaggtcttgggtttgataagcatggcaaccggttggggaggggcaagggctactatgacacctacctgaagcgctg
tctgcagcaccaggaagtgaagccctacaccctggccttggctttcaaagaacaaatttgtgtccaggtcccagtggacg
aaaatgacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa
>gnl|bcl2dbcds|A0A5F5PK00_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=636 residues).
atgaccgactgtattctcatcaagaaacttctaccagagcgaattgccccagatgtggatacttacaaggagatttctta
ctttgttgctgagttcataacgaaaaacacaggagaatggataaggcaaaatggaggctgggtgattgcccacagtcagt
atcaaaaatccaaaaggatttccatctttctgagcatgcaagatgaaattgagacagaagagatcatcagggacattttc
caacaaggcaaaacctgctttatcccacggtaccagttcaatagcaatcacatggatatggtgaaattagcatcacctga
ggaaattttgtcacttcccaaaacatcctggaatattcatcagcctggtgaggaggaggttcgggaggaggccttgtcaa
cagggggacttgatctcatcctcatgccaggtcttgggtttgataagcatggcaaccggttggggaggggcaagggctac
tatgacacctacctgaagcgctgtctgcagcaccaggaagtgaagccctacaccctggccttggctttcaaagaacaaat
ttgtgtccaggtcccagtggacgaaaatgacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa
>gnl|bcl2dbcds|A0A5F5PK00_BCL2A1-04 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=525 residues).
atgaccgactgtgagtttggatatattcacatgctggcccaggactacctgaagtacgtcctgcagataccacaacctgg
atctggtccaagcaaaacatccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatttgaaac
catgcttggacaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaa
gatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaagaaacttctaccagagcg
aattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacttttctggaagtt
actggaaagatgtgtgaaatacttttcctgaagcaatactactga
>gnl|bcl2dbcds|A0A5F5PK00_BCL2A1-05 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=612 residues).
atggcggcggcagctgtgagtggtgctaagcggcgcctgcgggccgagctgaagcagcgtctgcgggcgatgagcgccga
ggaacggctacgccagtctcgcctcttgactcagaaggtgattgcccacagtcagtatcaaaaatccaaaaggatttcca
tctttctgagcatgcaagatgaaattgagacagaagagatcatcagggacattttccaacaaggcaaaacctgctttatc
ccacggtaccagttcaatagcaatcacatggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaac
atcctggaatattcatcagcctggtgaggaggaggttcgggaggaggccttgtcaacagggggacttgatctcatcctca
tgccaggtcttgggtttgataagcatggcaaccggttggggaggggcaagggctactatgacacctacctgaagcgctgt
ctgcagcaccaggaagtgaagccctacaccctggccttggctttcaaagaacaaatttgtgtccaggtcccagtggacga
aaatgacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa
>gnl|bcl2dbcds|A0A5F5PML6_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Equus caballus GN=BCL2L2 (length=1035 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccccggggagggcccagccgctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaaggtggccccaactggggccgccttgtggccttctttgtctttggagccgcgctgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagactcggc
tggccgactggatccacagcagtggaggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaggct
gagaagctaaaagagctacagaacgaggttgagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgctcgttccatctatgttggcaatgtggactatggtgcgacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagaatcagtgaggacttccctggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatccctaaacgaaccaacagaccaggcatcagtacaacagaccggggtttcccacgagcccgatacc
gtgccaggaccactaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggagatcgtgcttgattctggtcaataccttcccactgactttggaataa
>gnl|bcl2dbcds|A0A5F5PML6_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Equus caballus GN=BCL2L2 (length=996 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccccggggagggcccagccgctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaaggtggccccaactggggccgccttgtggccttctttgtctttggagccgcgctgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagactcggc
tggccgactggatccacagcagtggaggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaggct
gagaagctaaaagagctacagaacgaggttgagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgctcgttccatctatgttggcaatgtggactatggtgcgacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagaatcagtgaggacttccctggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatccctaaacgaaccaacagaccaggcatcagtacaacagaccggggtttcccacgagcccgatacc
gtgccaggaccactaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtttctgtag
>gnl|bcl2dbcds|A0A5F5PML6_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Equus caballus GN=BCL2L2 (length=954 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcagggagatggaggaagaggctg
agaagctaaaagagctacagaacgaggttgagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgctcgttccatctatgttggcaatgtggactatggtgcgacagcagaaga
gctggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagaatcagtgaggacttccctggccttagatgagtccctatttagaggaagg
caaatcaaggtgatccctaaacgaaccaacagaccaggcatcagtacaacagaccggggtttcccacgagcccgataccg
tgccaggaccactaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggggccgggctagagcgacatcatggagatcgtgcttgattctggtcaataccttcccactgactttggaataa
>gnl|bcl2dbcds|A0A5F5Q151_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Equus caballus GN=MCL-1 (length=1053 residues).
atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcggcggcgg
cgcctcgtcgccgggagggcggcttttggctgcggggaaggaggccacggcccggcgagagggagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgggagcccccagaccaccctcgcgccggactccctgagggtcgcgcggccctcc
cccattggcgccgagggccccgacgtcaccgcgccctcctccaggctgctgttcttcgcgcccacccgctgcgcgtcgcc
gcctgaggggatggaagccccggccgccgacgccatcatgtcgcccgaggaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccttgctggagtttgtccgggaggccagcagtggcccctgcacggacggctcgctc
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctggagattatctctcgttaccttcg
ggaacaggctaccggcaccaaggacacgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccctgc
ggcgggtcggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggagtgacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgtcctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggcgctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A5F5Q151_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Equus caballus GN=MCL-1 (length=594 residues).
atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcggcggcgg
cgcctcgtcgccgggagggcggcttttggctaccggcaccaaggacacgaagccaatgggcgggtctggggccgccagcc
ggaaggcgttagagaccctgcggcgggtcggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggagtgacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgtcctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggcgctggtttggcatatctaataagatag
>gnl|bcl2dbcds|F6ZPD4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Equus caballus GN=BCL2L10 (length=561 residues).
gccgtggcggaggcgctgagggagcgcacggcgctactgctgatcgactacctgcagcgccgcgcccgggagccggccac
gcccgaggtggccgtgctgcgctgcgtggccgcccagatacagccccgcaaccagcgtgttctttcccgctaccgcggct
tccgcggggaccacgtcgggctggcggcacggatggcgcaggcgatcttcggagaccgccacgtccccagctggggccgc
gtggcggcgctcgtgaccctggcggggacgctgctggagagagccccgcggggaacctaccgaaagccgaagcggggcta
caagctggagctgagggagtggaaggccggcgtggaccgggactggccgcgcctggtggacttcctgtgcgcatggctca
aggggcggcaccgcgcctggctggaggctcactatggctgggatggcttttgtgacttctcactcacactgccagcttct
cagaggatactgctggtccggtttcttctgtcatgcttttcagcatcagtcttaatctacctctggacaaaattatcatg
a
>gnl|bcl2dbcds|A0A8C4RFB4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Erpetoichthys calabaricus GN=MCL-1 (length=888 residues).
atgaatcctgcgcttgcaactatgaaccgcagccccgctaccagcctagtccagatgttatactgctctggaccgtcggg
tttgaatggcgtttttaagcacgatgccctgcatcttgcgaagggggctgactttacgggaagcacgcaaatgatgtcgg
tgcagctggatgaaggcgagctagacgattgtttggatgaggtcgattcagtctcgcagcttcacaagtcctcgtcgaag
aattgcttaaaaaatctcctgttctcggccgagagctcaaatgcagatggctctcttccagcatctccggagacgccttc
tagcccaatggacagcagtcagcccggatttacgcctgctgctgacgcccagctggcgcaggaaacagaggagcttattg
cggcctacttatttcgatcggccggattaccctgctcacgtatccgtaatggaaacaaatctttcgacacccttgtacgt
gttggggattctgtcatcgagaaacataaattcgcgtttaacggaatgctccggaagcttaatatctcccaggagggaga
catgggattcatgacccctgttgctgaaagcatcttcagcgatggagtgataaactggggacgtgttgtaagcttggtag
cgtttggggcagtggtagccaagcacctaaagcaagtcaacctagaacgctgcatcaggcctttggcagaccagatttct
actttcctgcttacacgccaaaaggattggattgtgaataacagagcttgggagggctttgtagagttctttcgcattga
agatccagaagcaggaatacgacaggccttgatcacctttgctggaatggcaggcattggagctggtattgcttatttga
tccgatga
>gnl|bcl2dbcds|A0A8C4STP1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BCL2L1 (length=675 residues).
atgccctacagcaacaaagagctagttgaagattttataagctataaattatctcagaaaaatttttcatgtaaccagta
tttcggagacagtaggactgccacaccagggacctccactcctgagaatgaacaagatgtgctacatgtcaatggctctg
tcagtggaacagaaaatggaggcagctcttctgcagaccactcgcctgatggtatcagagcagtaaaagaggcactccat
gactcgggggatgagtttgagttgaggtaccgggctgctttcagtgatctctcatcccagctgcacatcaccccagttac
cgcttaccaaagctttgagcaagttatcaacgaactcttccgagatggggtgaactggggacgtatagtggcactcttcg
catttggtggtgctctgtgtgtggaatgtgtggagaaggaaatgggttctttggtgaaacgcatagctgaatggatgacc
acctacttggacaataacctagatccctggatccagagacaaggaggatgggacacgttcgccaaaatctacgggagcaa
cgcggctgccgagtgccggaggtcccaggaacgtttcagtaggtggctgttggcaggaatgactctggctactggcctga
tgctgggctcctacttcttccacaaacgcttgtag
>gnl|bcl2dbcds|A0A8C4XBF6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BCL2L1 (length=597 residues).
atgtcttacagcaacagagagcttgttgaagattttatcagctacaaattatcgcagaaaaatgttttgaatagccagag
tgaactggatgtattacaggtcaatgggactggaataatcaatagcttcccagccactccagcatctaatggagttaaag
cagtaaaagaggcacttcgtggctcaggggacgagtttgagctgaggtaccgggctgctttcaatgaccttgcttcgcag
ctacatatcacccctgttacagcttaccagagcttcgaggaggttgttggcgaactcttcagagatggagtgaactgggg
acgcatagtggcactcttttcatttggtggtgcgctctgtgttgaatgtgtggagaaggaaatggttcctcttgtgagac
atatagcagactggatgaccacctacttggataataacattgatgcctggatcctgagtaatggaggatgggataccttt
gtcaggatctatggacgacacgcatcagccgagtatttcaagaagtggctggtggttggagtgactatgactgctggact
ggtgttggcctcctttattgcacacacccatctgtag
>gnl|bcl2dbcds|A0A3P8XFS0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Esox lucius GN=BCL2L1 (length=660 residues).
atgtcttacagtaatagggaactggtggtgttttttataaactataaactgtcccagaggaattattcctgttgtgaatt
ggagctggagggtgcaagtggacggactgagggagaagaggctactgcaaatgggtctgtggggaacggcaggaacagca
gacgcaatttgggaaagccctcaactccacaggggtgcatggaggcagtgaaagcagcactacgggactctgcagatgag
tttgagctgcgctacacccgtgccttcagtgatctctcctcccagctccacatcacccccgccacagcctaccacagttt
tgaaagtgtgatggacgaggtgttcagggatggggttaactggggtcgtgtggtgggcctgtttgctttcggcggggccc
tatgtgttgagtgtgttgagaaggatatgagcctcctagtggcacgtattgcagactggatgaccacctacctggacgaa
cacatccagccctggatccaaattcaaggaggatgggatcgttttgctgacatttttggcagagatgcagctgcagacat
ccgacgttcccaagaaagcttgaggaaatggctgctatttggggtgatgctgctttcaggagtgctggttggcactctcc
tcatgaagaaacgccagtaa
>gnl|bcl2dbcds|A0A3P8XFS0_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Esox lucius GN=BCL2L1 (length=627 residues).
atgtcttacagtaatagggaactggtggtgttttttataaactataaactgtcccagaggaattattcctgttgtgaatt
ggagctggagggtgcaagtggacggactgagggagaagaggctactgcaaatgggtctgtggggaacggcaggaacagca
gacgcaatttgggaaagccctcaactccacaggggtgcatggaggcagtgaaagcagcactacgggactctgcagatgag
tttgagctgcgctacacccgtgccttcagtgatctctcctcccagctccacatcacccccgccacagcctaccacagttt
tgaaagtgtgatggacgaggtgttcagggatggggttaactggggtcgtgtggtgggcctgtttgctttcggcggggccc
tatgtgttgagtgtgttgagaaggatatgagcctcctagtggcacgtattgcagactggatgaccacctacctggacgaa
cacatccagccctggatccaaattcaaggaggatgggatcgttttgctgacatttttggcagagatgcagctgcagacat
ccgacgttcccaagaaagcttgaggaaatggctgctatttgggatggaaaatgcgcaatggacctga
>gnl|bcl2dbcds|A0A3P8XYL5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Esox lucius GN=BCL2L1 (length=696 residues).
attatgacttacaacaacaaagaactggtggcatactatattacctataaactatcccagagaaactaccccatcaatca
cactgggctcacaggagcatttgatcggactgaggggggagaggtggaagaggtggcagcagtcaccatgcaccccaatg
gcacaatgaatgggacgagtcctgggactccaacacaacagtcccccccctcatctcctcggcggactgttggcctggat
gcagtgaaagaggcactgcgggactctgccaacgagtttgagctgcgttacgccctagcattcagtgacctgtcatccca
gctgcacctcacaccggctacagcctaccagagctttgcaagtgtgatggatgaggtgttccgggatggggtgaactggg
gaagggttgtgggcctgtttgcgttcggaggggccctctgtgtagagtgcgtggagaaggagatgagcccccttgtggga
cggattgctgactggatgaccgtctacctggataaccacatccagccctggatcgagagccaaggaggatgggaccgttt
tgcagagatctttgggaaggatgctgcagccaacagcaggaagtctcaggagagctttaagaagtggctgctggcaggaa
tgacgctggttacaggagttgtcgttgggtctcttattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=1056 residues).
ctctcttattcctacagacagaacatgtcaaaaagcgacccacgggacatcgacgaggatgccatcctcaaagggatgag
cgctgaggagttagatgcgctggagtatgagctgcaagagatggacccagagaatgccatgctgcctgcagggttccgcc
agcgtgatcagaccaagaagagcccgacaggggttttcgaccgtgacgccctgctggatcacttggagaaaactgctcta
gagcatgcggacagagaagacctagtgcccttcactggagagaagaaagggagagcgtttgttcctaaggagggccacgg
gcagatccccatcaatgagcagatcaccctggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgt
gtgacatagcagccatcctgggaatgtacacactgatgagcaacaagcagtactacgacgccctgggcaccactggtacc
atcgccaacacagagggcatcaacagcgtcgtaaaaccagatccattcaagatcttcccagacgagccgcccaaccctac
gaatgtggaggagacccttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaataacattaaggaca
ttcccatcccaacgctgaaagagatctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgccgccacc
cgtagcaatgaccctgtggcctttgctgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcgagtc
gaacttcatcaccagtgagggcatgacggccattgtcaaggccatggccaacaacaatacactgaccgagatcaagatcg
acaatcagagacagaagctcggggactcctgcgaaatggagattgccagcatgttggagaacaactccagcatcctaaag
atcggctaccacttcacccagcaagggcctcgtgccagagcagccatcgccatcaccaggaacaatgacctgattcgtca
acagaggctaagatga
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=1077 residues).
cttgcagacatgtcaaaaagcgacccacgggacatcgacgaggatgccatcctcaaagggatgagcgctgaggagttaga
tgcgctggagtatgagctgcaagagatggacccagagaatgccatgctgcctgcagggttccgccagcgtgatcagacca
agaagagcccgacaggggttttcgaccgtgacgccctgctggatcacttggagaaaactgctctagagcatgcggacaga
gaagacctagtgcccttcactggagagaagaaagggagagcgtttgttcctaaggagggccacgggcagatccccatcaa
tgagcagatcaccctggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgtgtgacatagcagcca
tcctgggaatgtacacactgatgagcaacaagcagtactacgacgccctgggcaccactggtaccatcgccaacacagag
ggcatcaacagcgtcgtaaaaccagatccattcaagatcttcccagacgagccgcccaaccctacgaatgtggaggagac
ccttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaataacattaaggacattcccatcccaacgc
tgaaagagatctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgccgccacccgtagcaatgaccct
gtggcctttgctgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcgagtcgaacttcatcaccag
tgagggcatgacggccattgtcaaggccatggccaacaacaatacactgaccgagatcaagatcgacaatcagagacaga
agctcggggactcctgcgaaatggagattgccagcatgttggagaacaactccagcatcctaaagatcggctaccacttc
acccagcaagggcctcgtgccagagcagccatcgccatcaccaggaacaatgacctgattgtctatggttttcctacatg
cgatgatctgtcacataggcgtttcagtttcacatga
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=1038 residues).
gaggcgtgtttgtacatgtcaaaaagcgacccacgggacatcgacgaggatgccatcctcaaagggatgagcgctgagga
gttagatgcgctggagtatgagctgcaagagatggacccagagaatgccatgctgcctgcagggttccgccagcgtgatc
agaccaagaagagcccgacaggggttttcgaccgtgacgccctgctggatcacttggagaaaactgctctagagcatgcg
gacagagaagacctagtgcccttcactggagagaagaaagggagagcgtttgttcctaaggagggccacgggcagatccc
catcaatgagcagatcaccctggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgtgtgacatag
cagccatcctgggaatgtacacactgatgagcaacaagcagtactacgacgccctgggcaccactggtaccatcgccaac
acagagggcatcaacagcgtcgtaaaaccagatccattcaagatcttcccagacgagccgcccaaccctacgaatgtgga
ggagacccttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaataacattaaggacattcccatcc
caacgctgaaagagatctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgccgccacccgtagcaat
gaccctgtggcctttgctgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcgagtcgaacttcat
caccagtgagggcatgacggccattgtcaaggccatggccaacaacaatacactgaccgagatcaagatcgacaatcaga
gacagaagctcggggactcctgcgaaatggagattgccagcatgttggagaacaactccagcatcctaaagatcggctac
cacttcacccagcaagggcctcgtgccagagcagccatcgccatcaccaggaacaatgacctgagtgagcatctatag
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=915 residues).
atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgttcaaaatggagtcgtgggatctttgtattc
tggtgcccctttgtgctattttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaaaatggacgttgatt
taggaaatgggactgctgatactcctgtccgacctacgaagttagaagtaaatatgacgaaacccaacgtattggatagt
cgtttgtcagacctggccgacgactccgacgactcattgccgtgcactcccctgatggttactgagtgtagtgcggggtt
atcacattgcccatcgggcaatgaggttttggacaacgataccagacaactcattgagaatttattaagggactacacag
gactgtctcaacctcgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggcgacgtaatagccaagcac
acatacgcatacaagggtatgatctccaaactttgcttggatgatcaaggggatgacatgggtttcatcacgtctgtggc
caagagtctgttcagtgatgggactacaaactggggtcgcattgccagcttggtgggctttggggcagtagtgagtcaac
acctgaaggagatgggcaagggaaactgcgttgagttggttggccaagaaatctccacatacctcctcactgaccaaagg
gcctggctcgtgaaaaacaacgcttgggatggatttgtagagttttttcatgtagaagatccagagtcctcagtaaggaa
cacccttatggcctttgcaggagttgctggaattggggcaacacttgccctgttaatcagacagagtcctgctcacccct
ggggttgtgaggcgtgtttgtgtgaccctagctag
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=864 residues).
atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgttcaaaatggagtcgtgggatctttgtattc
tggtgcccctttgtgctattttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaaaatggacgttgatt
taggaaatgggactgctgatactcctgtccgacctacgaagttagaagtaaatatgacgaaacccaacgtattggatagt
cgtttgtcagacctggccgacgactccgacgactcattgccgtgcactcccctgatggttactgagtgtagtgcggggtt
atcacattgcccatcgggcaatgaggttttggacaacgataccagacaactcattgagaatttattaagggactacacag
gactgtctcaacctcgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggcgacgtaatagccaagcac
acatacgcatacaagggtatgatctccaaactttgcttggatgatcaaggggatgacatgggtttcatcacgtctgtggc
caagagtctgttcagtgatgggactacaaactggggtcgcattgccagcttggtgggctttggggcagtagtgagtcaac
acctgaaggagatgggcaagggaaactgcgttgagttggttggccaagaaatctccacatacctcctcactgaccaaagg
gcctggctcgtgaaaaacaacgcttgggatggatttgtagagttttttcatgtagaagatccagagtcctcagtaaggaa
cacccttatggcctttgcaggagttgctggaattggggcaacacttgccctgttaatcaggtga
>gnl|bcl2dbcds|A0A6Q2XQM7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=603 residues).
atgagagtattttcaaaatcgaagatgtcgctaatctcccagggaaccggtgagtgtgttgacgaatgcagaaacagagc
ctcgctggacaccgagaccaggcaactcgtgaaatctttcctaggagactttactgaacatttgaaacctaggtggaacg
aaagcaaagctctgtcaacaatgaaacaagttgtcaccaaatcattggacaaacacagatactcatacaatggtatgctc
tacagactgtccttgggtgacagcccaggggattacgtgagattcgtgagtgtaatcgctaacaggctcttcgcagatgg
gaccacaaactggggccgcgttgtcagcctgctcgcgttcgggactgtggtgtgccggtacctcaaggataagggcaaag
acaactgtgtggaagcggtgggacaggagatctccatgtacctactgacagaccagagagactggctggtaaaaaacaac
tcctgggacggattcgtggagttctttcgggtagcagaggagtctacattgagaaacgtactcctaacatttgctggctt
cggggcagcgctggccatgttgaaaatggtcgggtaccaatag
>gnl|bcl2dbcds|A0A6Q2XQM7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=648 residues).
tgtctagagtgccacgtgccctatgctgtatacttattttcaaaatcgaagatgtcgctaatctcccagggaaccggtga
gtgtgttgacgaatgcagaaacagagcctcgctggacaccgagaccaggcaactcgtgaaatctttcctaggagacttta
ctgaacatttgaaacctaggtggaacgaaagcaaagctctgtcaacaatgaaacaagttgtcaccaaatcattggacaaa
cacagatactcatacaatggtatgctctacagactgtccttgggtgacagcccaggggattacgtgagattcgtgagtgt
aatcgctaacaggctcttcgcagatgggaccacaaactggggccgcgttgtcagcctgctcgcgttcgggactgtggtgt
gccggtacctcaaggataagggcaaagacaactgtgtggaagcggtgggacaggagatctccatgtacctactgacagac
cagagagactggctggtaaaaaacaactcctgggacggattcgtggagttctttcgggtagcagaggagtctacattgag
aaacgtactcctaacatttgctggcttcggggcagcgctggccatgttgaaaatgtatgtggtcactggaaagagtttgt
acatgtag
>gnl|bcl2dbcds|A0A6Q2XXK6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=759 residues).
atgagcggagtatatccccagggatctaactttaccagccgggtaaccgttacagttaaagggtttggcatatccgcact
aaagcgtagagaaagtggtcagtacgaatcacctgaggggttgaaatcccataccggacctgatgtcgacaccattcgaa
ttttagtattttcaaaacagaagatgtcgctaatctcccagggaaccggtgagtgtatttacgaacgcagaaacagagcc
tcgctggacacggagaccaggcaactcgtgaaatctttcctagaagagtttactggatgtttgaaacctaggtgtaacga
aagcaaagctctgtcaacaatgaaacgagttgtaaccgaaacattagacaaacacagatactcctacaatggtatgctct
acacactgtccttggatgacagcacagggcatgacgtgggattcgtgggtgtagttgctaacaggctcttcgcagatggg
gtcaccaactggggccgggttgtgagcctgctcgcattcggtgctgcggtgtgccggtacctcaaggataagggcaaaga
gaactgtgtggaagcggtgggacaagagatctccatgcacctactgaccgaccataaagactggctggtcaaaaacaact
catgggacggattcgtcgagttctttcgggtagcagaggagtctacattgagaaacgtactcgtaacatttgctgcattt
gctggcttttgggcagcgctggtcatgttggacatgtaa
>gnl|bcl2dbcds|A0A6Q2Y9Q3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=759 residues).
atgagcggagtatatccccagggatctaactttaccagccgggtaaccgttacagttaaagggtttggcatatccgcact
aaagcgtagagaaagtggtcagtacgaatcacctgaggggttgaaatcccataccggacctgatgtcgacaccattcgaa
ttttagtattttcaaaacagaagatgtcgctaatctcccagggaaccggtgagtgtatttacaaacgcagaaacagagcc
tcgctggacacggagaccaggcaactcgtgaaatctttcctagaagagtttactggatgtttgaaacctaggtgtaacga
aagcaaagctctgtcaacaatgaaacgagttgtaaccgaaacattagacaaacacagatactcctacaatggtatgctct
acacactgtccttggatgacagcacagggcatgacgtgggattcgtgggtgtagttgctaacaggctcttcgcagatggg
gtcaccaactggggccgggttgtgagcctgctcgcattcggtgctgcggtgtgccggtacctcaaggataagggcaaaga
gaactgtgtggaagcggtgggacaagagatctccatgcacctactgaccgaccataaagactggctggtcaaaaacaact
catgggacggattcgtcgagttctttcgggtagcagaggagtctacattgagaaacgtactcgtaacatttgctgcattt
gctgtgtcaatggtacactatattagggctgtgtactga
>gnl|bcl2dbcds|A0A6Q2YIU6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Esox lucius GN=BCL-2 (length=678 residues).
atggcagacgacgataaccgttttatagtggaaaagtacatttgtcacaaactcttaaaacggggatatgcatgggattt
cgaagatgcagaggaggaagatggtgctaataatgggtcgatgatttctcctccgccgggtttggtacggcggattcatg
gggccagtaaagccggacagggcagcgttccccatatttccaaatggctctcccaaccagacccgcatgcagctattcac
agagtgttgcgtgaggccggggacgaactcgaaagactgtaccaacccgactttttggagatgtcacaccagctgtatct
gacgtcctctgtggccgagaggagattcagagaggttatagacgagctgttcagagacggagttaactggggacgtatta
tcgctttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggaaatgacttcgcaggtggaccacattgcc
gggtggatgacagaatatctaaatggacccctgcacagctggattcaagaaaacgggggatgggaggcctttgtggagct
ctatgacagacagagggactctgtgttctgttcatggccctccatcaagactgtctttggcctggctgcactgggggctg
caagcctcaccattggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A8C4TWS5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Falco tinnunculus GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggtacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaatgggagcccctctt
ggcacccgcccgccagccacgtagtgaatggagctgccgtgcaccggagcagcctcgaagtccatgaaattgttcaagca
gccgatgtgaggcaggcgctgagggaggcaggggatgagtttgagttgaggtaccggcaggctttcagcgacctcacttc
ccagctccacatcacccccggcacagcgtatcagagctttgagcaggtagtgaatgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtagcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacaatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C4U2H6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Falco tinnunculus GN=MCL-1 (length=1539 residues).
atggtgcgggctgcgagggctgcgaggccggtgcccgggggcgcctgctttgccggggggagttggggcactgcagcacc
ccgtggtgatggggtgggagggggtggcacgcctgggtctgaccgggctgggaggcacaagcagggcagacacaaggcac
cgagcagggccaggccgggggaggcggcgtgtgcagcggggccgggggtgcccggtgtggggccgcaggaggcccggcgg
ggtgacgcctctccgcgggggcggcgggggctctttcgccctttttcaccccaaaaagccccggcctggcgaggcgtgac
acccaccccccccgggccgtgccggaagcggggccggaaacgcggccggaagtggaccggcgcggcctcgctccgccccc
gtcgtgccccgcgtcgcgtcccgtcacgtcaccgccgccatataagcggcagcgacgctcaccgccgcgcagctcgccgt
tcgtgcgcagtggccgccatgttcgctgtgaagcggaacgccgtcattagcttcaacctctactgcggtggcggcctggc
cctggcgcctgcctcgcccggggggggcccgacgccgccgccgcccgccgtcgtccccgccacggccgccgccgccgccg
aggtgccctgggccgccgccagtcgccccgaggtaccccgcacgctgattggccaggccgcagccccccgctcgctgatt
ggctgcggcgcggccccccgcgccgcgctgccccccggcgggcggccggccgcgctgtggagccccgaggaggagctgga
cggctgcgagcccgagcccgagcgcggcccggcgggggactcgctgcccggcccgcccgacgggctgcggcaggactcgc
tggagctcatcagccgctacctgcgggaggcggcgggcgagtccgagcccggcgccaagaagcttttcccggggctgctg
ggcgggcctggccggcccggcgatgccgtgatggagaaggcgctggagacgctgcggagagtcggcaacggagtgatgca
gaagcacgagctcaccttccagggaatgcttcagaagttggacatccagaaagaggaagatctgcagtcagtgtgtgaag
tggctgcccatgtgttcagtgatggagtaacaaactggggtcgagtggtgacgctaatctcatttggtgcctttgttgca
aaacacctgaaaagcataaaccaggagaagtgcatcagctcgctggcaaggatcatcacggatgctctcgtctcatctaa
gcgcgagtggcttatgagtcagggaggctgggatggctttgttgacttctttcgagttgaggacctagaaggcagcatca
gaaacatactgatggtgtttgcaggtgtggctggactgggagcaagcttggcctacatgatccgagctaatgatgcaaaa
aggaggatttttgaatgtggtagaactgcttatgggtgcactgtacttcattcctcatgtgaagtagcatttttgtggcg
aagccttctcctgccttga
>gnl|bcl2dbcds|A0A8C4U538_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Falco tinnunculus GN=BCL-2 (length=687 residues).
cagaggaacatatttatagtccaagctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatcca
ctataaactctcgcagcggggatacgactgggctgccggcgaggacagggcacccctgcctccaggtctctctcctcctg
ctgctgctgctgcggttgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgag
ccccccggctcggctgctgctagccacgtgcccccggctgaggggctgcgccccgcaccccaggttgtccacctcaccct
gcgccaggcgggggacgagttctcccgccgctaccagagggactttgcccaaatgtctggccagttgcacctgacgccct
tcacggccaggggccgcttcgtggcggtggtggaggagctcttccgagatggggttaactggggcaggattgtggccttc
ttcgagttcggcggcgtgatgtgcgtggagagtgtcaacagggagatgtctcccctcgtagacagcatcgctgcctggat
gaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgggtacgtcccccgattgctcgttccc
tctcctggctctggtgcacagccagtggggctccggggtgggcagta
>gnl|bcl2dbcds|A0A8C4U538_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Falco tinnunculus GN=BCL-2 (length=729 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagcgggg
atacgactgggctgccggcgaggacagggcacccctgcctccaggtctctctcctcctgctgctgctgctgcggttgctg
ctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgct
agccacgtgcccccggctgaggggctgcgccccgcaccccaggttgtccacctcaccctgcgccaggcgggggacgagtt
ctcccgccgctaccagagggactttgcccaaatgtctggccagttgcacctgacgcccttcacggccaggggccgcttcg
tggcggtggtggaggagctcttccgagatggggttaactggggcaggattgtggccttcttcgagttcggcggcgtgatg
tgcgtggagagtgtcaacagggagatgtctcccctcgtagacagcatcgctgcctggatgaccgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgtttg
atttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttgga
cataagtag
>gnl|bcl2dbcds|A0A8C4U5U5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Falco tinnunculus GN=BCL2A1 (length=525 residues).
atgggaactgcggagttctattacgtttattacttagctcaagattatctgcagtatgtgcttcaagaatcacatcttgg
accagcccaaaccagggttgctcatgtcttgcgaaatattgcatcttcgctgcaagatcaaaccgaggaggctctcaaac
cattcttagacaagattgatattacctctgtagctgttgccaagagaattttcaatggtgtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacgtttggaggtcttctcactaagaagcttcaagagcatgg
agttcagctcactggagaggagaaggagcagatttcttatttcatcacagagtacataataaacaacaaagctgaatgga
tagatgcgaacggtggctgggaaaatggcttcctaacgaagtttgaaagaagatcactactatctttctccaaaattaca
gccatgttcatagctgtttttagcttgttcagagagtactactaa
>gnl|bcl2dbcds|A0A2I2UAE3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Felis catus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagcaggccctggggagggcccagcagctgacccactgcaccaagccatgcgtgcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagttgcatgtgacccctgggtcagcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggattcacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A337RYG8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Felis catus GN=BCL2L10 (length=579 residues).
atggctgacgcgttgagggagcgcacggcgcagctactgactgactacctggagtactgcgcccgggagcccggcagccc
cgcgcggacgccgtccacgcccgaggccgcggtgctgcgctacctggccgcccagatacggcagcgccaccagcgtttct
tgtcggcttaccgcggctaccgcggaaaccgcgtggaactggtggcgcggttggagcaggatttactctccaacccccaa
accctcagttggggccatgtggtagcgctcttgaccttcgcggggacgctgctggagagaccgccgccggggacctactt
gaacctgacgccggaccagcaacaggagctggagtgggagaccaacgttggccaggactgccagcacctggtggctttgc
tctgcaatcggctcaccggacggcatcgcgcctggctggaggctcacgacggctgggatggcttttgtctcttcttctca
cccatgctgccatcttcttggagaagactgctggtccaggctcttctgtcatgctttacagtaatgatcttaatctactt
ctggagaagattattgtga
>gnl|bcl2dbcds|A0A337S3J9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=993 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggagataaggcttga
>gnl|bcl2dbcds|A0A337S3J9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=996 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctggggcaaggaggccccaacttctctc
tgcttggcccatttgctgtgttcagagcaggtgtag
>gnl|bcl2dbcds|A0A337S3J9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A337S3J9_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=594 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagcc
gaaaggcgttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgg
aaactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A5F5XYW0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=744 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggttgttattgagcaccaacggtgtgccaggctctgtgctccacagggtgcacacagcccagaacaaagcagcccat
ggagcacctcttctagagaaaggagacacgacggacaaggaaacaaacaagattgttccggggataaattgttctgcaac
caactaccccaaaacttaagctaa
>gnl|bcl2dbcds|A0A5F5XYW0_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=816 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcggccgagagccggaagggccaggtcagaacaaacgccgaaa
cagagctgccacagagagtttgtccggtcctggggacgacgccttgcctggatttcgctgggacgggaagggactgttgg
cctggaaggtggaggaaacctcctttgggcgggtctgaccactctgcacagctcccgtcccagggcagaagttcccggag
gagggggcggtgctga
>gnl|bcl2dbcds|A0A5F5XYW0_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=675 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggtctggactggcttattttaccctgagttcctggcacagggcctgaggttgggtaagggcttggccagcatctgct
caatgaacatgaggttattattagatgcaggttag
>gnl|bcl2dbcds|A0A5F5Y6Y3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Felis catus GN=BCL-2 (length=714 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgccgccgccgccgcg
ggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccg
ccgcgacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggagg
agctcttcagggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
aaccgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggat
ccaagacaacggaggctgggatgcctttgtggaactgtacggccccagcatgcagcctctgtttgatttctcctggctgt
ccctgaaggccctgctcagtctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A5F5Y6Y3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Felis catus GN=BCL-2 (length=675 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgccgccgccgccgcg
ggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccg
ccgcgacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggagg
agctcttcagggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
aaccgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggat
ccaagacaacggaggctggctaatcttgctgcctcgtacctcgtatgaattaaaaagctcccgggctctccgtgaagacg
taagaatttcaccctcttttctttttaaagactag
>gnl|bcl2dbcds|M3WHW2_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Felis catus GN=BCL2A1 (length=525 residues).
atggccgacggcgagtttgggtacgttctcacgctggcccgggactatacggagcacgttctgcaggggccccagcccgg
gtcccacccaagcagagtatcccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaagaagttgaagc
cgtgcctggacaagttccatgtggtgtcggtagacacggccaggacgatattccaccaagtgatggaaaaggaatttgaa
gacggcatcattaactggggcaggattgtgactatatttgcgtttgagggcatcctcatcaagaagcttctccaggagcg
gatcgtcccagacgcggatgcgtttaaggtttcctactttgtcgccgagttcatcacgaaacacacgggagaatggatcc
ggcaaaacggaggctgggaaaacggctttgtaaggaagttcgaacccaagtctggctggctgacctttctggaagttaca
ggaaagatctgtaaggtattgtctctcctgaagaactactactga
>gnl|bcl2dbcds|Q7YRZ9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|Q8I008_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Felis catus GN=BCL-2 (length=708 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactatgagctgccgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgctgccgcgggccct
gcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcga
cttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggaggagctct
tcagggatggcgtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagggcgtcaaccga
gagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccagga
taacggaggctgggatgcctttgtggaactgtacggccccagcatgcagcctctgtttgatttctcctggctgtccctga
aggccctgctcagtctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|Q8SQ42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcggtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtcaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgctccaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A803V184_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ficedula albicollis GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttagcccaggattatctgcagtatgtgctccaggaatcacacctcgg
accagcccagaccagggttgcccatgtcctgcgaaccatggcatcttccctgcaagaccaaaccgaggaggctctcaggc
cactcctggacaggattgacatcacctcagtagctgttgccaagagaattttcaatggagtcatggatgaaaagtttgct
gatggaaatactaactggggacgaattatgaccatatttacatttggaggtcttctcaccaagaagcttcaagagcatgg
ggttcagctgactgcagaggagaaggaggagatctcttatttcatcacagagtacatcatcaacaacaaatccgaatgga
ttgatgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtccttctccaaaattaca
gccctgttcatagctgttgtttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A803VLI1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ficedula albicollis GN=BCL2L1 (length=630 residues).
atgtacagcagtaatcgggagttagtgattgactttgtttcttacaagctctcacagaaaggctacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggcgtgctcaacggaagcccctcct
ggcacgcacccaccagccacatagtgaacggagcctccgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtggatcccagtcccgtggcagccactctctga
>gnl|bcl2dbcds|A0A803VR88_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ficedula albicollis GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgagcacagggcacccctgcctccaggtctctctgctcctgctgctgctgcggttgctgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccccgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtccacctggtcctgcgccaggcgggcgacgagttctcccggcg
ctaccagagggactttgcccaaatgtctggccagctgcacctgacgcccttcacggccaggagccgcttcgtggccgtgg
tggaggagctcttccgagacggggttaactggggcagaatcgtggccttcttcgagtttggcggcgtgatgtgcgtggag
agcgtcaacagggagatgtctccgctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A803VR88_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ficedula albicollis GN=BCL-2 (length=690 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgagcacagggcacccctgcctccaggtctctctgctcctgctgctgctgcggttgctgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccccgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtccacctggtcctgcgccaggcgggcgacgagttctcccggcg
ctaccagagggactttgcccaaatgtctggccagctgcacctgacgcccttcacggccaggagccgcttcgtggccgtgg
tggaggagctcttccgagacggggttaactggggcagaatcgtggccttcttcgagtttggcggcgtgatgtgcgtggag
agcgtcaacagggagatgtctccgctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggacagaagctgcttcgccaaatacttttttgtagctgcacagctatggataccag
ctttggataccaacacaagggctattcatgcttctccactggaaaaatga
>gnl|bcl2dbcds|A0A8C5B4N8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gadus morhua GN=BCL2L1 (length=684 residues).
atgagcattgacacaagcatgtcgatcagtaacagagaactggtgttcttcttcctaagccataaactgtctcagaggaa
ttacaggcctattcccttccagcccgagggggcagatgaggggactgatgaggacaagtccaacaggattggtaataatg
ggttacggttgaacgacggtaacggcaatggccagttggcgccatcacctactccacaaggcacggaggctgtgagggca
gcgcttctagaatcggtggaagagtttgagttgcgctacacgctggccttcagcgacctgtcgtcccagctgcccatcac
ccccgccacggcctacggtagcttcgaaagcgtgatggacgaggtgttcagggacagcatcaactggggacgcatagtgg
gcctgtttgccttcgggggggccctctgcgtggagtgtgtggagaaggagatgagccacatggtgccccgcgtggcagag
tggatgaccaggtacctggacgaccacattgaccactggatccagagcaacggaggatggaaacactttgctgcggtttt
tggaagcgacgcggcagcgggagcgaggcgtacccgggacagtcacaggagatggatgctggtgggcgcggtgctgctga
ctggggtgctgctcggggctctgctcgccaagaaacatgtctag
>gnl|bcl2dbcds|A0A8C5C4C3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gadus morhua GN=BCL-2 (length=717 residues).
atggcgaacgtgtgcaaccgcgatatcgtgcaaaagtacattttccataaactgtccaagcaggggtatatgtgggaatt
cgaggacgctgtggaggaagaagaagtggggaataataggtcgatcatcgctcctccaccgactttggtgaaacgatgtc
gaggagaagtgggggacgacaacgacgccaacaccgggccggagagcatcccccgtctttccaagcggatcacggcccgc
cacggggacccgcgcgcggcgacccaccgggtgctgcgcgaggcgggggacgaactcgagagactctaccaggcggactt
caccgagatgtcgcaccagctgtacctcacgtcgactacggcgcagaggcggttcagggaggtgatcgacgagctgttca
gggacggcgtgaactggggccggatcatcgcatttttcgagttcgggggtacagtgtgcgtggagtgcgccggcggccag
gaggaggagatggtggcgcaagtggagcacatcgccgagtggatgactgagtacatgaacgggcatctgaacaactggat
ccaggacaacgggggatgggagtccttcgtggagctgtacgacagacagcgggggtcggcgttcagctgtgcctggccct
ccatcaggaccgtgtttggtctggccgcgctgggcgccgccagcctcaccattggcgcgtacctcactcagaagtga
>gnl|bcl2dbcds|A0A8C5CE84_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=1638 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatggaat
gccatgctcccagcgggctaccggcagcgggaccagaccaagaagacccccacgggggactatgaccgcgacgccctgca
ggactacctggagaagagcgccctggagcacgaggacagggaagacctgatccccttcaccggggagaagaaagggaagg
cgtttgttcccacggcgaccgggcagatccccctaagcgagcagatcaccctggagccggagctggaagaggccctgaag
aacgccactgacgctgagatgtgcgacatcgcagctatccttggaatgtataccctgatgagcaacaagcagtactatga
tgctctgggttgcacggggaagatcgccaacacggagggcatcaacagtgttgtaaaacaagatcccttcaagatctttc
cggaagagcccccaaacaccaccaacgtggaggagaccgtggagaggatccacaacaacgacagtggtctgacggaggtc
aacctcaacaacatcaaggacattcccatccccacgctgaaggaggtgtttgaggccatgaagggaaactcttacgttga
gatcctgagcatcgcagccacacggagcaacgaccccgtcgccttcgcatgtgcggagatgctgcaggagaacaccagtc
tccagagtcttaacattgagtctaacttcatcaccgcagagggcatgaaggctgtagtcaaggccatggccagcaacgcc
acgctggtggagctcaagatcgacaaccagaggcacaccctgggagactcggtggagatggagatcgccgccatgctgga
gaacaactccagcatcctgaagttcggctaccacttcacccagcaggggccccgggcccgggccgccatggccgtcacca
ggaacaacgatatgcttcgccaacagaggctgagatga
>gnl|bcl2dbcds|A0A8C5CE84_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=834 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgaccgtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtga
>gnl|bcl2dbcds|A0A8C5CE84_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=885 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgaccgtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtcagagggccaagtctccagggagaagaacagaaatttaccccaacaga
cgtaa
>gnl|bcl2dbcds|A0A8C5CE84_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=1026 residues).
atgtcggaccccagggacatagacgaggatgccatcctcaaaggcctcagctctgcagagctggaacagctggagtgtga
gctccaggacctggaccccgagaatgccatgctcccagcgggctaccggcagcgggaccagaccaagaagacccccacgg
gggactatgaccgcgacgccctgcaggactacctggagaagagcgccctggagcacgaggacagggaagacctgatcccc
ttcaccggggagaagaaaggtaggaaggcgtttgttcccacggcgaccgggcagatccccctaagcgagcagatcaccct
ggagccggagctggaagaggccctgaagaacgccactgacgctgagatgtgcgacatcgcagctatccttggaatgtata
ccctgatgagcaacaagcagtactatgatgctctgggttgcacggggaagatcgccaacacggagggcatcaacagtgtt
gtaaaacaagatcccttcaagatctttccggaagagcccccaaacaccaccaacgtggaggagaccgtggagaggatcca
caacaacgacagtggtctgacggaggtcaacctcaacaacatcaaggacattcccatccccacgctgaaggaggtgtttg
aggccatgaagggaaactcttacgttgagatcctgagcatcgcagccacacggagcaacgaccccgtcgccttcgcatgt
gcggagatgctgcaggagaacaccagtctccagagtcttaacattgagtctaacttcatcaccgcagagggcatgaaggc
tgtagtcaaggccatggccagcaacgccacgctggtggagctcaagatcgacaaccagaggcacaccctgggagactcgg
tggagatggagatcgccgccatgctggagaacaactccagcatcctgaagttcggctaccacttcacccagcaggggccc
cgggcccgggccgccatggccgtcaccaggaacaacgatatgcttcgccaacagaggctgagatga
>gnl|bcl2dbcds|A0A8C5CY11_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Gadus morhua GN=BCL2L10 (length=639 residues).
atgatggccagttgtctaacctgcatcaaaatggccatctcttccagaaacatgtcgtgtaggctgtggaaagagaccct
ggccctgtcagaggactacctgttgtcctgcactgcaagcacaggcacagccccgccgcctcccagcgagtcagccgcgg
ccatgaggggactggcccaggacatggagcggcagcactacgctcgcttccaggctctggcccagagcttcctggcccag
tgcgaggccgacgcatgcgccggcctccgcaaggtgatggaggagctggtgggagacggacagttgaactgggggagggt
agtttccctcttcacctttaccggggtgctggccagacaactgcaggagaagaagggggtacaactggggcaggaccccg
ggacgggcagggcactgggacaggttcccggcgggagctgcagggggctggcggagacgatagcggactacctaggggag
gagaagagggactggctgctggagaacgggggctgggaagggttttgtaagttctccaggatcgcccgagaggtgaacca
agagtcttcgatgaagacggcgctgttcgcggccgccggggtgggcatcgcaggcctgacgttccttttggtgcgctag
>gnl|bcl2dbcds|A0A8C5FC81_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gadus morhua GN=BCL2L1 (length=759 residues).
atggcgcaactggaccccgcccgccccttggtttcccagaaccgcgagctggtgctgttctacatcacgcacaagctggc
ccagaagaacttccccctcaaccacctcacactggcggccacgcccccaaaccggactgaggtgggcggggccgcaccgg
gccccgcccgcgtccccgcgccgcacgccaacggcacgccgaacggcaccaccaccgccgccgccgccacgcccccccca
tcgcccccgcccaccgcgcctccgccccggcgccagtcgtccgcggagacggtcgccatggcggcggtgaaggaggcgct
gcgggacacggcgggcgagttcgagctgcgcttcacgcgggccttcagcgacctctcctcccagctgcacatcacgccgg
ccaccgcctaccagagcttcgagagcgtcatggacgaggtgttccgcgacggcgtcaactggggccgcgtggtgggcctg
tttgcctttggcggcgccctgtgcgtggagtgcgtggagaaggagatgagctccctggttgggcgcatcgccgagtggat
gacggtgtacctggacgtgcacatccagccctggatccaggcgcaggggggatgggagcgtttctccgaggtgtttggga
aggacgcggcggccgagagccggcgttcccaggagagcttcaggaagtggttcctggcggggatgaccctgttcacgggg
gtcgtggtggggtcactcttcgcccagaaacgcctctga
>gnl|bcl2dbcds|D2IT42_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Gadus morhua GN=BCL2L10 (length=588 residues).
atgtcgtgtaggctgtggaaagagaccctggccctgtcagaggactacctgttgtcctgcactgcaagcacaggcacagc
cccgccgcctcccagcgagtcagccgcggccatgaggggactggcccaggacatggagcggcagcactacgctcgcttcc
aggctctggcccagagcttcctggcccagtgcgaggccgacgcatgcgccggcctccgcaaggtgatggaggagctggtg
ggagacggacagttgaactgggggagggtagtttccctcttcacctttaccggggtgctggccagacaactgcaggagaa
gaagggggtacaactggggcaggaccccgggacgggcagggcactgggacaggttcccggcgggagctgcagggggctgg
cggagacgatagcggactacctaggggaggagaagagggactggctgctggagaacgggggctgggaagggttttgtaag
ttctccaggatcgcccgagaggtgaaccaagagtcttcgatgaagacggcgctgttcgcggccgccggggtgggcatcgc
aggcctgacgttccttttggtgcgctag
>gnl|bcl2dbcds|D2ITA2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gadus morhua GN=BCL2L1 (length=684 residues).
atgagcattgacacaagcatgtcgatcagtaacagagaactggtgttcttcttcctaagccataaactgtctcagaggaa
ttacaggcctattcccttccagcccgagggggcaggtgaggggactgatgaggacaagtccaacaggattggtaataatg
ggttacggttgaacgacggtaacggcaatggccagttggcgccatcacctactccacaaggcacggaggctgtgagggca
gcgcttctagaatcggtggaagagtttgagttgcgctacacgctggccttcagcgacctgtcgtcccagctgcccatcac
ccccgccacggcctacggtagcttcgaaagcgtgatggacgaggtgttcagggacagcatcaactggggacgcatagtgg
gcctgtttgccttcgggggggccctctgcgtggagtgtgtggagaaggagatgagccacatggtgccccgcgtggcagag
tggatgaccaggtacctggacgaccacattgaccactggatccagagcaacggaggatggaaacactttgctgcggtttt
tggaagcgacgcggcagcgggagcgaggcgtacccgggacagtcacaggagatggatgctggtgggcgcggcgctgctga
ctggggtgctgctcggggctctgctcgccaagaaacatgtctag
>gnl|bcl2dbcds|G3NJY1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=573 residues).
atgtctcaaaacagagaactggtggttttctacataaactataaactctcccagaggaacttacccctcaaccacatagg
gctgtccgagcctcccaacaggactggcgggggggtagaggcaggggcggctggtgggcagcggggagcgacgcactcca
acgggactttcaacggcacgagtcccgggaccccgccggcgtccccgctgctccagcaacggtcgccgtcgacggcgagc
ctggatgcggtgaaggaggccctgcgggactcggccaacgagttcgagctgcgatacgctcgggccttcagcgatctgca
caaccagctgcacatcacgccggccacggcctaccagagcttcgaggacgtgatggacgaggtgttccgggacggcgtca
actggggccgcatcgtggggctgttcgccttcggcggggcgctgtgcgtggagtgcgtggacaaggagatgagtccgctg
gtgggcaggatcgtcgagtggatgacgctctacctggacaaccacattcagccctggatccagaaccagggaggctggcg
ttcagacatttga
>gnl|bcl2dbcds|G3P7B4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=663 residues).
atggcgaacattaacagggagctggtggagttcttcctaagctacaagctgtctcagaagaaccacccaacctctctgtt
gaggccggaggatgccggcggaaggacggagggagacaaggccaactcggcgtccgttcctggacgcgggagcagcgccg
gccagccggggatgtcgtcgccaccgccgccaccgtccggtgacaccgaggccgtaaaggcagctcttcaggactctgcg
aatgagtttgagctgctcttcacgcaagcgttcagtgacctctccttgcagctagacgtcacccccgacacggcctacca
cagcttcaagagcgtgatggacgaggtgttcaaggatggcgtcaactggggccgcgtggtgggcctgtttgccttcggcg
gcgtgctctgcgtggagtgcgtagagaaggacatgaccgagctggtgtcccgcatcgcggactggatgaccacgtacctg
gacgagcacatcagtgcttggatccagagccagggaggatgggactgttttgctgacattttcgggcgggacggcgcggc
agcggcgaggagatctcaggagacgatgagaaggtggctgctcgtcggggtggcgctgctaatgggagtgctcgtcggta
tggtcatggtcaagaagcggtga
>gnl|bcl2dbcds|G3PJT0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=MCL-1 (length=957 residues).
atgaatataattcagagaccgaaactggccgcgttaaacatgaccggagtcatgagctgcattattctccctcaaaatgg
agtcgcgcccatgcgacagctcgcaatgggctcggcgaaggactcccacaacggcaacgcggggacaaacgacaccccga
agcggcccagcgccctcggggtgaactccgcgaacggctacccatcaaaaccgcagcgggaggacagcgaggacaccgac
aacgactcgctgccgtgcaccccggagtcggacagcgaaaccgacgtctccgactccccggcgggggccgcggctctgga
gagcgacacgaggcaactcctcggccgcttcctgagagaatttacgggactgtcgaaaacccagtggaacccgagcaggg
agctcaccaccatgaagagggtggtgggcgacgttttggagaagcacagatacgtattcaatggtatggtgaacaaattg
tcactggacgaccgaggcgacgacgccagtttcgtgcgggaggtcgccacgagcctcttcgcggacggcaccacgaactg
gggccgcatcgccagcctggtggccttcggggcggtggtgtgccaacacctggcggagcgaggccgggggaactgcgtgg
agctggtggggcaggagatctcggcctacctgctgtcggaccagcgggactggctgatcaaaaacaacgcctgggttggc
ttcgttgagttctttcgagtagcagacccagagtctgcggtgaggaacactctcatggctgtggctggattcgctagtat
tggggcgacactggccctgttgatcagtggaccttcaaaagtgcaaaggcagcttctcaccattgaattgttgcagatcg
tgcgctctcagaggggaggacaccggctgcagcgtgatgtgagcaccagaccttctccgacatccggctctggacta
>gnl|bcl2dbcds|A0A452I9V7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gopherus agassizii GN=BCL-2 (length=663 residues).
atgtatttaactgcatgtgtctgtacgttgcactggagggaaaagcacagtacttctgcaagagcttggagtcaaagagg
ctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagaggggatatgattgggctgccaatgaaa
acagaggaccagtttcaccaaatctctctccccctactgttactgggacctcatctgaccatgctgggctgatgtctctg
cctcctgagccccctggctcggctgctgctagtaacgtgccccttggtgatgggctgcgcccagcaccgcaggctgttct
cttggctctgtgccaagctggagatgaattttcccgtcgctaccacagagattttgcccagatgtctggccagctgcact
tgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgagatggggttaactggggaaggatc
gtggccttctttgaatttggtggtgtgatgtgtgtggagagcgttaatcgggagatgtcgcctcttgtggacagcattgc
tgtgtggatgactgaatacctgaacagacacctacacaactggatccaggacaacggaggctgggtatgtgtccagtatt
tctttctctttaaattacagtaa
>gnl|bcl2dbcds|A0A452J3N6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Gopherus agassizii GN=BCL2A1 (length=528 residues).
atggaaagctctgagtactgctatgtttactatttagtccaagattatctgaaatacgttcttcaggaaccacagcttgg
accagccccaagcagagttgctcatgtcttaagacacgctgcatcctttctgcaaaaggaaaatgaagagagtctgaaac
catgtttggacacatttgatattacctctgtagatgctgccagaagaattttcactcaagtcatggataaagaatttgct
gatggaaacactaactggggacggattttgacaatatttatgtttggaggaattctttctaagaagcttcaagaacacag
agttcagcttacaggagaaaataaaaagcagatttcttatttcatcacagagtacattataaacaccaaggctgagtgga
tagaggcaaatggaggttgggaaaatggcttcctaactatgtttgaggaaaaacgatcatggctgtccttattcaatatt
aaagcaaaaatcatggatgctttttccttcttcagtcagtactattga
>gnl|bcl2dbcds|A0A8C4VT25_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gopherus evgoodei GN=BCL-2 (length=702 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagagggg
atatgattgggctgccaatgaaaacagaggaccagtttcaccaaatctctctccccctactgctactgggacctcatctg
accatgctgggctgatgtctctgcctcctgagccccctggctcggctgctgctagtaacgtgccccttggtgatgggctg
cgcccagcaccgcaggctgttctcttggctctgtgccaagctggagatgaattttcccgtcgctaccacagagattttgc
ccagatgtctggccagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgag
atggggttaactggggaaggatcgtggccttctttgaatttggtggtgtgatgtgtgtggagagcgttaatcgggagatg
tcgcctcttgtggacagcattgctgtgtggatgactgaatacctgaacagacacctacacaactggatccaggacaacgg
aggctgggatgcctttgtggaattgtacggcaggaacatgaggcctgtgtttgatttctcctggatctctttgaagacta
tcctaagtctggctctggtgggagcttgcatcaccctgggcgcttatctgggacataagtga
>gnl|bcl2dbcds|A0A8C4W4P8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Gopherus evgoodei GN=BCL2A1 (length=513 residues).
atggaaagctctgagtactgctatgtttactatttagtccaagattatctgaaatacgttcttcaggaaccacagcttgg
accagccccaagcagagttgctcatgtcttaagacacgctgcatcctttctgcaaaaggaaaatgaagagagtctgaaac
catgtttggacacatttgatattacctctgtagatgctgccagaagaattttcactcaagtcatggataaagaatttgct
gatggaaacactaactggggacggattttgacaatatttatgtttggaggaattctttctaagaagcttcaagaacacag
agttcagcttacaggagaaaataaaaagcagatttcttatttcatcacagagtacattataaacaccaaggctgagtgga
tagaggcaaatggaggttgggtaagtttcagtgctgtattttataaccatttttcactgctatctagatcagaagaattt
tcattaataaatttttttaaaatgttcttttaa
>gnl|bcl2dbcds|A0A8C4W8N7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gopherus evgoodei GN=BCL2L1 (length=873 residues).
atgaaatttacaagagcaaagccttctcaacacacagttctcaattggagctcctcaggagaggatataagaactagccc
aagcctgtttgctttcagaagctggtccgataggggcggtgaactgagatttcccaggccagagctttctcccagcagct
actctagaggattgtctgctcagggttcagatgtttgccttgactccagaggagagcagagtctggacctgctatcgcag
aggggatacagctggagtcggttcgaaggggaggatgagatcaggactgattctgcagaagaggctgagatggcaagtgt
ccctaatgggagtccatcctggcatcagggtgccagccacatagtgaatggggctgctgggcacagtaacagccttgaag
cccatgaaagggttccagcaactggagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggtatcggagg
gctttcagtgacctcacttcccaactccacatcactcctggcacggcataccagagctttgagcaggtagtgaatgaact
cttccgggacggagtgaactgggggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagtgtcgaca
aggagatgcaggtgttggttggacgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaa
gagaatggcggttgggagcggtttgtggatctctatgggaatgacgctgctgccaagagcaggaaaggccaggagcagtt
caacaggtggcttctgaccggggcgactctggcaggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C4YAJ9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gopherus evgoodei GN=MCL-1 (length=954 residues).
atgttggcgctgaagcggaacgcggtgatcggcctcaacctgtactgcgggggcggcccgacgctgcccccctccgcgcc
ggcctcccccagcggcgcggggacccctcccgcccccgggcctgcggcggagggcgtccggccggcgacgctgattggcg
gagcctcttggggttccaacggtcattctgagggggcccgggcgctgattggctcccccgcagccgccccgtctctggtg
gccggggggccccggcccggcccgctgtggcggccggaagaggaactggacggctgcgaccccgacgccgagcggatggg
cccgccgggcgccgccggcggctccctgcccagcaccccgcccgcggaggacgacgacgagctggacgggctgtaccagg
actcgctggagctcatcagccgctacctgcgggaggccgcggagctcggcgggcccggcggcaagaagctcctcaagcgg
ctgctgagcgggccgcggggcgccggccccgccgccatggagaaggcgctggagacgctgcggagggtcggcgacggcgt
cattgagaagcaccagatcgccttccaagggatgcttcggaagctagacatcaagaatgaggatgatctgaagtcagtga
ctgccgttgcaacccatgttttcagtgatggagtaacaaactggggtagaattgtgacactcatctcttttggtgccttt
gttgcaaaacacctgaagagcataaaccaggagaattgcatcaacacactagcagggatcatcacagatgtgcttgtcac
aggcaaacgagattggctagttaaccaaagaggctgggagggatttgttgaattcttccgtgtagaggatctagaaggta
gcatcaggaatgttctggtggcttttgcaggctttgctggactgggagcaagcttggcctatatgatgcgatga
>gnl|bcl2dbcds|A0A2I2YJ87_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatgacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2I2YJ87_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatgacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I2YJ87_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I2YJV4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acgggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2I2YJV4_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2A1 (length=591 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acgggaaagatctcaatactgttgaccagaaaggacactccatattgtgaaaccggcctaatttttctgactgttatgga
aacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A2I2YJV4_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacacgcctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2I2YPX6_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcgacgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggttcgggagcccccggcagccaagaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggaccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccg
cgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2I2YPX6_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggaccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggttgactttaaggctatcatttgttcatctctgactcaggtgatcccaaaacgaaccaacagaccaggca
tcagcacaacagaccggggttttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
>gnl|bcl2dbcds|A0A2I2YPX6_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L2 (length=813 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcgacgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggaccaagaggaggaggaggagccgggactggtcgagggtgacccgggggacggcgccattgaggac
ccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaagctaaaggagctacagaacgaggt
agagaagcagatgaatatgagtccacctccaggcaatgctggaccagtgatcatgtccattgaggagaagatggaggctg
atgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaagctcactttcatggctgtggt
tcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
agagtcagtgaggacttccttggccttagatgagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaacca
acagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgcccggaccaccaactacaacagttcc
cgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggta
ttccccttactaa
>gnl|bcl2dbcds|A0A2I2YPX6_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|G3QES9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgagagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgtgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggaccgggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtctcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|G3QLU6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttagcaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A8C5D4L1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=774 residues).
atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgactggctcagagggactttcccacatccccgct
gaggctgcaggataccagggacaggacggtggtggagaaggaaaaggccagcccgactgccggtaacggcctccaggaca
gagacggggtgatcccacctcgccacggcgatgacgacgtggaggcggtgaagttggcgctcgtggagtcagccgacgag
tttgaactcctcttcacgcaagcgtttaacgacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgt
tgtgcttggagtgttcagagaaggacatgagcgagctggtgccccgcattgcagactggatgaccatgtacctggatgag
aacatcaacgagtggatagagagcgaaggaggaggatgggcttcctttgcccagatcttcggacaggacgcggctgccaa
ggcgaggaaagctcggaccagtatgaaacggtggttcttgtttggtgccgttgtgctcacaggagttctgtttctcgtct
gctacgtcaagagacgagaaccacacttatgggtcacatacctcacattgctgaacacagcgcctctgtcataccaggaa
atatttctgttggatggatgtaatataacctcctccagcatcccacattcctag
>gnl|bcl2dbcds|A0A8C5D4L1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=606 residues).
atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgactggctcagagggactttcccacatccccgct
gaggctgcaggataccagggacaggacggtggtggagaaggaaaaggccagcccgactgccggtaacggcctccaggaca
gagacggggtgatcccacctcgccacggcgatgacgacgtggaggcggtgaagttggcgctcgtggagtcagccgacgag
tttgaactcctcttcacgcaagcgtttaacgacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgt
tgtgcttggagtgttcagagaaggacatgagcgagctggtgccccgcattgcagactggatgaccatgtacctggatgag
aacatcaacgagtggatagagagcgaaggaggaggatggagaaccacacttatgggtcacatacctcacattgctgaaca
cagcgcctctgtcataccaggaaatatttctgttggatggatgtaa
>gnl|bcl2dbcds|A0A8C5D4L1_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=660 residues).
atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgactggctcagagggactttcccacatccccgct
gaggctgcaggataccagggacaggacggtggtggagaaggaaaaggccagcccgactgccggtaacggcctccaggaca
gagacggggtgatcccacctcgccacggcgatgacgacgtggaggcggtgaagttggcgctcgtggagtcagccgacgag
tttgaactcctcttcacgcaagcgtttaacgacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgt
tgtgcttggagtgttcagagaaggacatgagcgagctggtgccccgcattgcagactggatgaccatgtacctggatgag
aacatcaacgagtggatagagagcgaaggaggaggatgggcttcctttgcccagatcttcggacaggacgcggctgccaa
ggcgaggaaagctcggaccagtatgaaacggtggttcttgtttggtgccgttgtgctcacaggagttctgtttctcgtct
gctacgtcaagagacggtga
>gnl|bcl2dbcds|A0A8C5G971_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=675 residues).
atgactcagaacagagaactggttgtgttctacatcacatacaaactgtctcagaggaactaccctctggaccacatagt
gctcaatgagcctccacacaggaccgctgggtcggacgcagagcccgcagaggatgagcggacggacacgcagtccaatg
gaactttgaacgcgtctccggtgcagcagcagaggttgccgtcagcgacaagcctggatgcggtgaaggaagccctccga
gacacagccaacgagtttgagctgcgctactcgctggctttcagtgacctgcacagccagctgcacatcacgccggccac
ggcctaccagagctttgagaacgtgatggacgaggtgttccgggacggcgtcaactggggtcgcattgtggggctctttg
catttggtggagcactgtgtgtagagtgtgtggagaaggagatgagtcctttggtgggcaggattgtggagtggatgacg
gtctacctggacaaccacattcagccctggatccagagccaagggggatgggaacgctttgctgaggtcttcgggcagga
tgcggtggctgagatccggcggtccgaggaatcttttaaaaagtggctgctggtggggatgacggtggtgaccggggtgg
tggtgggttcgctcttcgcacaaaaacgtctgtga
>gnl|bcl2dbcds|A0A8C5H9Y5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gouania willdenowi GN=MCL-1 (length=984 residues).
atgaatatcgtgtcgacgaagtcaactagtttaatgaactgccttttagcaacacaaaatggaggcgtagaaggacgaat
caactaccagcagaaggatccgcctcgggatcaccacgccatagacacgtctctagactctctgaacggaaacattgcct
ccagtgagaccccgaaacgacccaaaaaccttagtgtggcttccaccttcgtgcctaaagctctgcgggaggacagcgag
gacatggaggacggatctctgccgtgcacaccggaggtgcattcggacactgaggccgaggtctcgaattgcagtggcgg
ggcggaggtgctggagaacgacaccaggcaactaatgtcccggttcttagccgactatacaggactttctaagcgcgatt
ggaatgaaagcaaagcactgtcgaccatgaagagagtggtggaggacgttctggagaagcacagatacgcgtacaatgga
atggtcaacaagttatcactggataactgtagtgatgatatgacatttgtcagcgctgtggcgaagagccttttcgcaga
ccaacgcaccaactggggtcgtattgctagcctagtggcctttggggctgttgtgtgtcaacacttgaaagaacggggca
ggtcaaactgcgtggagctggtggggcaggagatttccacataccttcttaccgagcagcgagaatggctggtgaaaaac
aattcatgggatggctttgtagactttttccgagtagcagacccagagtcaacagttaggaacacacttatggcttttgc
aggattcgctggcattggggctacactagcctttctgatcaggagggcatgtgggtgcctgaagaatgagaaggcgtgta
agcgtgggaggaggagacatcaaagaaaggggaaatcggatcccctcttcagacaaagcgagccaaggggttcagagaca
aaggaaacgagatccgccatgtga
>gnl|bcl2dbcds|A0A8C5H9Y5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gouania willdenowi GN=MCL-1 (length=846 residues).
atgaatatcgtgtcgacgaagtcaactagtttaatgaactgccttttagcaacacaaaatggaggcgtagaaggacgaat
caactaccagcagaaggatccgcctcgggatcaccacgccatagacacgtctctagactctctgaacggaaacattgcct
ccagtgagaccccgaaacgacccaaaaaccttagtgtggcttccaccttcgtgcctaaagctctgcgggaggacagcgag
gacatggaggacggatctctgccgtgcacaccggaggtgcattcggacactgaggccgaggtctcgaattgcagtggcgg
ggcggaggtgctggagaacgacaccaggcaactaatgtcccggttcttagccgactatacaggactttctaagcgcgatt
ggaatgaaagcaaagcactgtcgaccatgaagagagtggtggaggacgttctggagaagcacagatacgcgtacaatgga
atggtcaacaagttatcactggataactgtagtgatgatatgacatttgtcagcgctgtggcgaagagccttttcgcaga
ccaacgcaccaactggggtcgtattgctagcctagtggcctttggggctgttgtgtgtcaacacttgaaagaacggggca
ggtcaaactgcgtggagctggtggggcaggagatttccacataccttcttaccgagcagcgagaatggctggtgaaaaac
aattcatgggatggctttgtagactttttccgagtagcagacccagagtcaacagttaggaacacacttatggcttttgc
aggattcgctggcattggggctacactagcctttctgatcaggtga
>gnl|bcl2dbcds|A0A3Q2UUN9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL2L10 (length=822 residues).
atgatttatggattatttgtcacccttttttgtaccataccaaaccatgaccacacttccgctggttattccgtggcggt
ggtgtcttctttccacagtccacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcattctgcatcag
ctgaagggaagactcaactgtaccgacgctctccttccgccgtctgtatgtgcagagagcagtctgatatcgctgggagg
aaaatgaaattctgtgggctgtggaaagagaccctggttttggccgaggactacctgtccttttgctgcacgagtccaca
tcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc
gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaaggag
ctggttggagatggacacttgaactgggggagggttgtttctcttttcgcctttactggagtgctggccagaaagatcct
ggagcagaagccggggctggaccctcgtcaacagcaggaactgggacaggagcccatgagctgcagaaggctggcagaga
ccatagctgattacctgggagaagagaagaaagactggctgttggataatgatggatgggaaggcttctgtaagttctcc
cgcagtgccagagaagtgagccaggactcatccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct
taccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A3Q2UUN9_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL2L10 (length=816 residues).
atgatttatggattatttgtcacccttttttgtaccataccaaaccatgaccacacttccgctggttattccgtggcggt
ggtgtcttctttccacagtccacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcattctgcatcag
ctgaagggaagactcaactgtaccgacgctctccttccgccgtctgtatgtgcagagagcagtctgatatcgctgggagg
aaaatgaaattctgtgggctgtggaaagagaccctggttttggccgaggactacctgtccttttgctgcacgagtccaca
tcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc
gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaaggag
ctggttggagatggacacttgaactgggggagggttgtttctcttttcgcctttactggagtgctggccagaaagatcct
ggagcagaagccggggctggaccctcgtcaacagcaggaactgggacaggagcccatgagctgcagaaggctggcagaga
ccatagctgattacctgggagaagagaagaaagactggctgttggataatgatggatgggaaggcttctgtaagttctcc
cgcagtgccagagaagtgagccaggactcatccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct
taccttcctcttgtga
>gnl|bcl2dbcds|A0A3Q2UYW8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL-2 (length=687 residues).
atggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcgggggttcgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggtccaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctccgccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttattgctttcttcgagtttgggggcactgtgtgcgtggagtgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagttgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagcctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A3Q2VNL8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Haplochromis burtoni GN=MCL-1 (length=825 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaacgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacgtcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttactggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacgctcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagtggtttgtaa
>gnl|bcl2dbcds|A0A3Q2X557_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggctaacgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccaactgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A087WT64_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A087WT64_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=459 residues).
atgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacga
gacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatcc
atgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttg
aagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactg
gctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgc
tgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A087WT64_MCL1-06 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A087WT64_MCL1-07 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A087WT64_MCL1-09 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=159 residues).
atgaatcccagggttccaggccaggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcctg
gctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=618 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggtaggtgcacttggtgatgtgagtctgggctga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=597 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctggctttacatgtga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-07 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-08 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=807 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctggacagaaactcaggatctgttcaacagtaatgcctgttcccccacgcctgcagcct
tggcaaccaccatactactgcctgcctctatgaacttgactactctaggtacctcgcataagtggactcacacttgtgac
tggcttgttacactaagcatgatgtcttcaaggttcatccatgttttggcctgtgtcacagcttccttcattttgaaggc
tgaatga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-09 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=141 residues).
atggaggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcctggctgtctctgaagactct
gctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-10 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=618 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggtaggtgcacttggtgatgtgagtctgggctga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggatacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-05 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-06 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-07 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-08 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-09 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-10 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-11 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-12 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=603 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtgccagatgccagttttagattctggctccaccactga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-14 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggatacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-15 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=924 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctggctggattggtggtgcttctgctcagctcaccttagagtaatcatcactgacggaggagactggggaggtcccatcc
ttcccctgggctcagctgggtccccagacctacacctgaaccccacgcctgtctggtgtttacggattgaagctgccacc
ctttgggacctatcctgttttcatttctgctctcagctctctggtctctgtggacctcacttacaggatacttttgtgga
actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactg
tggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A9QXG9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacggggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgagccacaagtga
>gnl|bcl2dbcds|B4DG83_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=723 residues).
atggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcg
gccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcactaccctcgacgc
cgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggcc
accggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtga
aatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttctttt
ggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgt
tctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacc
tagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
tag
>gnl|bcl2dbcds|B4DLY8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=717 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatgg
cgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgt
tgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcc
tttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgt
aaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaag
gtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|B4DU51_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=840 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagatggaagccccggccgctgacgccatcatgtcgcccgaagagg
agctggacgggtacgagccggagcctctcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggt
aataacaccagtacggacgggtcactacccttgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtc
gctggagattatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcca
ccagcaggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatg
cttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgt
aacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
gctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggc
tgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgt
tgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|B4E1X9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Homo sapiens GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtgcgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacctataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacacacctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|B4E1X9_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Homo sapiens GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtgcgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacctataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|B4E1X9_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Homo sapiens GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtgcgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacctataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggtatgtgtgatggaaaaattcttcattgttctttcctgtgaaatagaaattgagaatttc
cttgctagttaa
>gnl|bcl2dbcds|B4E3L8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=723 residues).
atggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcg
gccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcactaccctcgacgc
cgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggcc
accggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtga
aatcgttgtctcgagtgatgatccatgttttcagcgacagcgtaacaaactggggcaggattgtgactctcatttctttt
ggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgt
tctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacc
tagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
tag
>gnl|bcl2dbcds|C8YZ26_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
agactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccaagtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaaaaagatag
>gnl|bcl2dbcds|G3V4B7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=155 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatga
>gnl|bcl2dbcds|G3V4B7_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|G3V4B7_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|G3V4B7_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=558 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
tggctgactggatccacagcagtgggggctgggtatggagcacactcttcaccctaccctctaccacaggacacatatcc
ctgttagcattccccgggacctttagccaagaggagctgcagggaccatggccaggttaccaaaatgccctgctctga
>gnl|bcl2dbcds|G3V4B7_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|G3V4B7_BCL2L2-06 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|G3V4B7_BCL2L2-07 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=507 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
tggctgactggatccacagcagtgggggctgggtaagaagcttctcaattgccgctctgcacatccttctgcaaagctgg
tctccagggggaagatgggggctctga
>gnl|bcl2dbcds|G3V4B7_BCL2L2-08 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|G3V4B7_BCL2L2-09 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=215 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgacccc
>gnl|bcl2dbcds|G3V4B7_BCL2L2-10 BCL2-like 2 gene OS=[Eukaryota] Homo sapiens GN=BCL2L2 (length=502 residues).
gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccgatg
aactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtgtc
aacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcagctggctgactggat
ccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcgggagg
ggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtatggagcacactcttcacccta
ccctctaccacaggacacatatccctgttagcattccccgggacctttagccaagaggagctgcagggaccatggccagg
ttaccaaaatgccctgctctga
>gnl|bcl2dbcds|Q9HD36_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Homo sapiens GN=BCL2L10 (length=615 residues).
atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagctgttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccggcgccatccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtcctttttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccactggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|Q9HD36_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Homo sapiens GN=BCL2L10 (length=726 residues).
atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagctgttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccggcgccatccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtcctttttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggtgagcacgcggcggacaccgggacacggggcgggacgggcagccgggaagcgcccacgaggctggcacgg
atggcttttgtcacttcttcaggaccccctttccactggctttttggagaaaacagctggtccaggcttttctgtcatgc
ttgttaacaacagccttcatttatctctggacacgattattatgagttttaaaacttttaacccgcttctacctgcccaa
ctgtga
>gnl|bcl2dbcds|A0A4W5JPK5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcagtt
ggggctggagggtgcaagtggacggactgagggagatgaggccattgcaaatgggtctgtggggaacaacaggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggaggcagtgaaagcagcactacgggactcagtggatgag
tttgagctgcgctacacccgtgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactggatgaccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcaaagatctttggcagagatgctgctgcagacgt
tcgacggtcccaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggttggcactctca
tcatgaagaaacgccagtga
>gnl|bcl2dbcds|A0A4W5KV00_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Hucho hucho GN=BCL-2 (length=681 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgctgaggaggaggaaggtgctgctaataatgagttgatgatttctcctcgcccgggtttggcacggcggtgcc
acggggccaataacgccggaccgggcagcgttcctcgtctttccaaatggctctcccaaccggacccacatgcagcaatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagccagacttcgcagagatgtcacaccagctgta
tctcacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacctcgcaagtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcaactggattcaggagaacgggggatgggaagcctttgttga
gctctatgacagacagagggactcggtgttctgttcgtggccgtccatcaagaccgtcttcggcctggctgcactggggg
ccgcaagccttaccattggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A4W5KYB3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=765 residues).
atgtaccacgttccacatacggttgacaaacacaaatgctggacgtgtaagctcgaaatcgacagctttgtggagaacga
taccctactgggtgagcacatctaccacgtatacaacacaggcggacactgcaggtacctcgcggacaggtacaccaatc
gagaagaggagataatgctcatactggggaaggaacggtacaggaagggaacagtcgcgttccctgaaaccatggaaacc
tgtgatgctctggacacagacaccaggcaacttatgacatgtgtcctaggacaatatacgggacttctgaaacgtgggtg
gaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggta
tgatcaacacactctacatggatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgagac
gggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggag
agacaactgtgtggaggcggtgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacaca
actcctggaacggtttcgtggagttcttttcagtagcagaaacggagtccagatcgaggaacatcatcgcgacccttgtc
ggattggctggtattggggcagcaatgaccttgttagctatgtga
>gnl|bcl2dbcds|A0A4W5LP06_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=879 residues).
atgagtctgtcggttacacgagccacaactacgatgtggcattatcaaaatggagtcttcggaccttcgtactctgctgg
tgctagccctttgtgctatttcgcgactggggccgtatgtcctggggcgtcaccgaagtcaaaagtggatactgacttgg
gtaatgggactggcgacactccaccacgacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggtaatcat
ttgtcagacctaagcaacaatgacgactctggcgattctttgccatgcactccagagatggcgtcagaatgtgggcctga
actatcgaattgtccatcggccgatgaagtattggaacatgataccagacaagtaattgaagacttattgggggactaca
caggactgtctcaacctcgttggaaggaaagcaaggctcttacgacgatgaagcgagtggtgaaggatgtaatagcaaag
caccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagcttcatcaaatctgt
ggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcattcggagcagtggtgagcc
agcaactgaaggagaggagcaggggacactgcattgggttggtgggccaagagatcgccacatacctcctctctgaccaa
agggactggctagtcaaaaacaatgcttggaatggttttgtagacttctttcatgtgcaagatccagagtcctctgtaag
gaacaccctcctagcctttgctggatttgctgggattggggcaacactcgccatgttgatcaggaattcagcagattag
>gnl|bcl2dbcds|A0A4W5LP06_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=1050 residues).
atgagtctgtcggttacacgagccacaactacgatgtggcattatcaaaatggagtcttcggaccttcgtactctgctgg
tgctagccctttgtgctatttcgcgactggggccgtatgtcctggggcgtcaccgaagtcaaaagtggatactgacttgg
gtaatgggactggcgacactccaccacgacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggtaatcat
ttgtcagacctaagcaacaatgacgactctggcgattctttgccatgcactccagagatggcgtcagaatgtgggcctga
actatcgaattgtccatcggccgatgaagtattggaacatgataccagacaagtaattgaagacttattgggggactaca
caggactgtctcaacctcgttggaaggaaagcaaggctcttacgacgatgaagcgagtggtgaaggatgtaatagcaaag
caccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagcttcatcaaatctgt
ggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcattcggagcagtggtgagcc
agcaactgaaggagaggagcaggggacactgcattgggttggtgggccaagagatcgccacatacctcctctctgaccaa
agggactggctagtcaaaaacaatgcttggaatggttttgtagacttctttcatgtgcaagatccagagtcctctgtaag
gaacaccctcctagcctttgctggatttgctgggattggggcaacactcgccatgttgatcagatcccaccatccctctc
tgctgtcctccgcagtttttgagctttctccattgataatgaatgaagaacggcggcttatttcatctgaggcacctctt
tcagatagttttccagatggaaatgcaatatatagatctgtactcgattctctattctacaaggcaaagggtcttggctg
ttgtaggtga
>gnl|bcl2dbcds|A0A4W5LYF9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcaatt
ggtgctggagggtgcaagtggacggactgagggggatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtaagccttcttctcctcaggggggcattgaggcagtgaaagcagcactacgggactccgttgatgag
tttgagctacgctacacccgcgccttcagtgatctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtaaactggggtcgtgtggtgggcctgtttgctttcggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccccctggtgatgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagtcaaggaggatgggaccgttttgcattgatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaagaaaatggctgctagttggggtcatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A4W5LZB2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=585 residues).
atgaataacacccatggagttgcatgtacgcacacaatgaagatatcacatcaggaaacctgtgatgctctggacacaga
caccaggcaacttatgacatgtgtcctaggacaatatacgggacttctgaaacgtgggtggaacgaaagcaaagctctgt
caacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggtatgatcaacacactctacatg
gatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgagacgggaccgtcaactggggccg
cgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggagagacaactgtgtggaggcgg
tgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacacaactcctggaacggtttcgtg
gagttcttttcagtagcagaaacggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggtattggggc
agcaatgaccttgttagctatgtga
>gnl|bcl2dbcds|A0A4W5MLY7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Hucho hucho GN=BCL2L10 (length=591 residues).
atgtcatgcgggctgtggaaagaaaccctggctatagcagaggactacctgtctgtctgcagtattatccctgccagtgg
gtcccggaaagccccgcccggtcctcctcccagcgactcagctgcagccatgcggtgccaggcccgggacatggaggcca
agcaccgggcccgcttccacgccctagcacacagcttcctgtgccaatgcgggccgaacccctgcgccagtctgaggagg
gtgatggaggagctggtgggagacggacagatgaactgggggagggtggtctctctgttcaccttcactggtgtgctggt
tagagaactacagggggaggacacggaccaggcgctggggaatggcatggggctgggggggaaggagagctgcagggcgc
tggctgagaccatagcagactacctaggagaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgt
aagttcttccacacagcaagagaggtgaaccaggactcgtccatgaagactgccctgtttgctgctgctggcgtgggcat
cgcagggttaaccttcctcctggtccgctaa
>gnl|bcl2dbcds|A0A4W5NQ40_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=699 residues).
atgatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagggactaccccttcaacca
cattgagctcacggaagcccagaatcggactgaggggggacaggtggaagggggtgcggcagtcatgacatatgtcaacg
gcacagtgaacgggacgagtcccgggactccaccaccacagcagtcgcccccctcctcccctcggcggacagcaggcctg
gacgcagtgaaagaggcgttgcgggactctgccaatgagtttgagctgcgttatgccagagcgttcagtgacctgtcctc
ccagctacacatcacgccgtccacagcctaccagagctttgagaacgtgatggacgaggtgttccgggacggtgtgaact
ggggacgggtggtgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtg
ggaaggatcacagactggatgactgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccg
gtttgcagagatctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggcgg
ggatgacgctggttacaggagtcgtcgtagggtcactctttgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A4W5NW18_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Hucho hucho GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttatgacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaaatgggatt
tgtatggaaatttcaagcagaaaacgattatccaaataatggctttggggacccctctgcaccgaacacccgcgaagttt
ttgcacggaggtcccagcccaccgccgcgggcgaggacaccgactctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctcaacagggtcctgcgcgaggcgggtgacgagattggaagaatttatcacccggactttgcagagatgtc
ggggcagttgcattttacgcccaacacggcacagagaaggtttacggctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacatcgcccgttggatgacggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggccgtacctaaagacagtgttcggcctggccgccc
tgggagccgccggagtcaccattggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A4W5Q5Q2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=606 residues).
gcagataaagtcacagttaaccgagcccgggcaggtgacaatggaaacagccaagcggaaaacatatcacatcaggaaac
ctgtgatgctctggacacagacaccaggcaacttattaaatgtgtcctaggacaatatacgggacttctgaaacgtgggt
ggaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggt
atgatcaacacactctacatgtatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgaga
cgggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgagggga
gagacaactgtgtggagttggtgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacac
aactcctggaacggtttcgtggagttcttttcagtagcagaaccggagtccagatcgaggaacatcatcgcgacccttgt
cggattggctggtattggggcagcaatgaccttgttagttatgtga
>gnl|bcl2dbcds|A0A4W5Q5Q2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=789 residues).
atggaaacagccaagcggaaaacgctcctgagtctcttcgacggcacaggcagtatttgcaagcccttcgttgaagctgg
ctggaccgtgcgaagactagacatcgacagtcgacacggtgctgatatcgttgtggacatacgaaagtgggaccctttgg
actctgtcagtgctagagctcggatgaataacacccatggagttgcatgtgtatataagtgccaacgctgtaaagggatc
ctgagtagttgtgagcttgaaacctgtgatgctctggacacagacaccaggcaacttattaaatgtgtcctaggacaata
tacgggacttctgaaacgtgggtggaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggaga
aacacagatacacatacaatggtatgatcaacacactctacatgtatgacagaggggatgatgtgaggtttgtcagtaca
ctagcccatatcatctttcgagacgggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtg
tcagtacttgaaagacgaggggagagacaactgtgtggagttggtgggagaggagatatcagcatacctggtcactcacc
acaaggactggctagtcaaacacaactcctggaacggtttcgtggagttcttttcagtagcagaaccggagtccagatcg
aggaacatcatcgcgacccttgtcggattggctggtattggggcagcaatgaccttgttagttatgtga
>gnl|bcl2dbcds|A0A4W5QGT1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=852 residues).
atgagtctgtcgaagtccattgcacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtaccttgctaa
tgatgctagccctttgtgctatttcaacggggctggggcgtcaccgacgtctaaagtggacttgggaaatgggactggcg
atactccaccacgacccacgacgttaggagtgagtgtcgtgaaaagcaacgtcctcgataatcatttgtcagaccgaagc
aacaatgacgactctgacgattctttgccgtgcactccccagatggcgtcagaatgtgggcctgagctatcgaattgtcc
atcgggcgatgaagtattggaacatgataccagacaactaattgaacattttttgagggactacacaggactgtctcagc
ctcgttggaagcaaagcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccgatacgcattc
aatggtatgatcgccaaacttgacttggatgatcgatgcgatgacatgcgcgtcatcaattctgtggccaagaccatgtt
cggtgatagggtcacgaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagcacctgaaggaga
atggcaggggacactgcgttgatttggtgggccaagagattgccacatacctcctctctgaccaaagggactggctggtc
aaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagtaaggaacaccctcctagc
ctttgctggagttgctgggattggggcaacacttgccatgttgatcaggtga
>gnl|bcl2dbcds|A0A4W5R2W6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=705 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactttcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgaggggggtgagaggggacaggtggaagggggggcggcagtcacgacac
accccaacggcacagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatg
ggcctggacgcagtgaaagaggcattgcgggactctgccaatgagtttgagctgcgttatgccagagcgtttagtgacct
gtcctcccagctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgatggtg
tgaactggggacgggtggtgggcctgtttgcctttggaggggccctctgtgtagagtgtgtggagaaggagatgagccca
ctagtgggacggattgcagactggatgacagtctacctggacaaccacatccagccctggatccagagccaaggaggatg
ggaccggtttgcagagatctttgggaaggacgctgcagccgagaacaggaagtctcaggagagctttaagaagtggttgc
tggcggggatgacgctggtcacaggagtcatcttagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A4W5R2W6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=702 residues).
atgtgtattaacctacctgaactggtggtatactatattacctataaactttcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgaggggggtgagaggggacaggtggaagggggggcggcagtcacgacacacc
ccaacggcacagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggc
ctggacgcagtgaaagaggcattgcgggactctgccaatgagtttgagctgcgttatgccagagcgtttagtgacctgtc
ctcccagctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgatggtgtga
actggggacgggtggtgggcctgtttgcctttggaggggccctctgtgtagagtgtgtggagaaggagatgagcccacta
gtgggacggattgcagactggatgacagtctacctggacaaccacatccagccctggatccagagccaaggaggatggga
ccggtttgcagagatctttgggaaggacgctgcagccgagaacaggaagtctcaggagagctttaagaagtggttgctgg
cggggatgacgctggtcacaggagtcatcttagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A287CZ07_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=675 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcgataaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgtggtactggcgggcattcagtga
cctgacgtcccagctccacatcaccctggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcacattgtggcctttctctcctttggcggggcactgtgcatggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatgccttggatccaagagaacggcggctgggacacttttgtggaactctacag
gaataatgcggcagcagagagccggaagggccaggagcgcttcaaccgttggttcctgacgggcatgactgtggccggtg
tggttctgctgggctcacttttcagtcggaaatga
>gnl|bcl2dbcds|A0A287D9B3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggccgactttgtaggctataagctgaggcagaagggtta
cgtctgtggagctggccctggggagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcagctcagctgcatgtgaccccgggttcagctcagcaacgcttcacc
caggtctctgacgaacttttccaagggggtcccaactggggtcgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A287D9B3_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L2 (length=507 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggccgactttgtaggctataagctgaggcagaagggtta
cgtctgtggagctggccctggggagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcagctcagctgcatgtgaccccgggttcagctcagcaacgcttcacc
caggtctctgacgaacttttccaagggggtcccaactggggtcgtcttgtggccttctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctggctgttctccagggggaatatgggggctctgattggaggctgggacagc
tgtgctgggaaggaggcatggggctga
>gnl|bcl2dbcds|A0A287DCH9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=MCL-1 (length=1002 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgggctgggggccagcggcggcgc
caccccgccgggagcgcagctcttagccgccgagaaggaggccgcggcccggcgagaggcagggggaggggaagccgccc
agccgcccagcgcccgcagggtcgcgcggccggtgcccattggcgccgaggtccccgacgtcaccgcgaccccggcgagg
cgactctttttcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgccgccgccatgtcgcccgaaga
ggagctggacggctacgagcccgagcccctcgggaagcggccggcggtcctgcccttgctggagctcgttggagaggccg
ccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagctgtaccggcag
tcgctggagatcatttcgcggtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtgggtcgggggc
cgccagcaggaaggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagacggccttccaaggca
tgcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgttttcagtgacgga
gtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaaga
aagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtcaaacaaagag
gctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttcgcaggt
gttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A287DCH9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=MCL-1 (length=852 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgaggtccccgacgtcaccgcgac
cccggcgaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgccgccgccatgt
cgcccgaagaggagctggacggctacgagcccgagcccctcgggaagcggccggcggtcctgcccttgctggagctcgtt
ggagaggccgccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagct
gtaccggcagtcgctggagatcatttcgcggtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtg
ggtcgggggccgccagcaggaaggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagacggcc
ttccaaggcatgcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgtttt
cagtgacggagtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagca
taaaccaagaaagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtc
aaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
tttcgcaggtgttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|I3MCZ7_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2A1 (length=528 residues).
atgaatgactgtgagttcaggttcatccacacgctggctcaggactacctgcagcacgtcctgcaggtaccgcaacgtgg
gtcaagccccagcaaaacgtccaaagtgttacaaaacgtggctttctcagtccaaaaagaagttgaaaagaatctgaaac
cattcttggacaattttgatgtggtgtctgctgatactgccagaacaatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcatgaactggggaaggattgtgaccatatttgccttcggaggagttctggtcaagaaacttctgcgagagcg
gattgcccctgctgtggattccgatgaggagatctcttactttgtggctgagttcattatgaataatgcaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggttgacttttctgggagtt
acagggcagatctgtgagatgctgtctctcctgaagcaatactattga
>gnl|bcl2dbcds|I3MVK9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL-2 (length=588 residues).
atggctcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcacagagggg
ctacgagtgggatgctggagacgtgggcgctgcgtccccaggagccgcccccgggccgggcatcttctcttcccaaccgg
ggagccataccccggccgccaggacctcgccaccgccacccccggctgcccccgctgccgccgcggggcccgtgctcagc
ccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctctcgtcgctatcgtcgcgacttcgccga
gatgtccagtcagctgcacctgacgcccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggtaggtgcacgtcgggttgaatga
>gnl|bcl2dbcds|A0A8C5JYS0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Jaculus jaculus GN=BCL-2 (length=711 residues).
atggcgcacgcggggaccaccgggtacgataaccgggaaatcgtgaggaactacatccactataagctgtcgcagagggg
ctacgcgtgggatgctggcgacgtgggctcggcgaccccgggagccacccccgcgccgggcatcttctcctcccagcctg
ggaacgacaccacatcggccgtgccccgggatccagcagccaggacctcgccgccgccggccgcggccgcccccgccggg
cctctgcctggcccggtcccacctgtggtccacctgaccctccgccaggccggcgatgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcgggggcgcttcgccacggtggtggaggagc
tgttccgggacggggtgaactgggggcggatcgtggccttctttgagttcggcggggtcatgtgtgtggagagcgtcaac
cgggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggacgcctttgtggagctgtacggccctggtgtacgacccctgtttgacttctcctggctgtctc
tgaagaccctgctgagcctggccctggtgggggcgtgtgtgactctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C5L5C6_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Jaculus jaculus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggctgactttgtaggctataagctgagacagaagggtta
tgtctgtggagctggccctggagagggcccagcagctgatccacttcaccaagccatgagggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgacctagctgctcagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgcctggtagccttctttgtctttggggctgctctgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtacaggagtggatggtggcctacctggagacgcgcc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C5L8K1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Jaculus jaculus GN=BCL2A1 (length=519 residues).
atgactgactgtgagtttgcatacgtccactcgctggctcaggactacctgcagtgcgtctggcaggagccctccctctg
tccggctcccagcaaggcatccaggctgctacagaaagttgcattctcagctcagaaagaagtcgagaagaatctgaaac
catacctggagaactttgaggtgacctccatcgatgatgccagaatcatcttcaatcaagtgatggaaaaggaatttgaa
gatgggatcattaactgggggcggatagtgaccatatttgcttttgggggtgttctcctgaagaaacttccacgacagca
gaccgaccttgatgtggacactaatgagcagatttcttcttttgtggctgaattcataacgaataacacaggagaatgga
tacggcagaacggaggctgggaaaacggctttataaagaagtttgaacccacctctggctggctggtgcttctggatgtt
gcaggacacatctgggaaatgctcttttacctgaagcaa
>gnl|bcl2dbcds|A0A8C5NZI4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Jaculus jaculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctcacctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaagggactgaatcagagatggagacccccagtgctatcaatggta
acccatcctggcacctggtggacagcccggctgtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
tctaacatcccagcttcatataaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggccttcttctccttcggcggggcactgtgtgtggaaagcgtagacaaggagatgcag
gtgttggtgagtcggattgcaagttggatgaccacgtacctgaatgaccacctggagccttggatccaggagaacggcgg
ctgggacacttttgtggagctctatgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=1014 residues).
atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtc
gctgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaattggaaaatgcattgctattgaatgctata
agcaaggtgctttcataacactgattgcaagggatgagaacaagctgttgcagacgaagaaggaaatagaaaagtactct
gttaatgacaagcaggttgtactctgtatttctgttgatgtgtctaaagactatgaacaagtggaaaatgttctaaaaca
ggctcaggagaagttggggccagttgatatgctcgtgaactgtgcaggaacatcagttacaggcaaatttgaggatattg
aagtgaattcttttgaaagattaatggcagtgaattacctgggcagtgtttacccaagccgagcagtaatcgctaccatg
aaggagcgcagaatgggaaggattgtcttcgtgtcgtctcaggctggccagctgggcctgtttggatatacagcttattc
tcccaccaagtttgctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacggtgg
cctatcctccagatactgatactcctggctttgcagaagaaagtaaaacaaagcccttagagacgaagctgatttctgaa
acctcatctgtttgccaagcagagcaagttgccagagttatagtgaaagatgccatacaagggaacttcaacagctcagt
tggatcagatggttacatgctgtcaatattgacaagtgggatgtcaccagtcacttctattactgaaggtcttcagcagg
atgcctttgtggagttgtatggcaatggaatgaggcctttgttcgatttctcctggatctctctgaagactatcctgagt
ctggttctggtgggagcttgcatcactcttggcgcttatctcggacataaatag
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=999 residues).
atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtc
gctgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaattggaaaatgcattgctattgaatgctata
agcaaggtgctttcataacactgattgcaagggatgagaacaagctgttgcagacgaagaaggaaatagaaaagtactct
gttaatgacaagcaggttgtactctgtatttctgttgatgtgtctaaagactatgaacaagtggaaaatgttctaaaaca
ggctcaggagaagttggggccagttgatatgctcgtgaactgtgcaggaacatcagttacaggcaaatttgaggatattg
aagtgaattcttttgaaagattaatggcagtgaattacctgggcagtgtttacccaagccgagcagtaatcgctaccatg
aaggagcgcagaatgggaaggattgtcttcgtgtcgtctcaggctggccagctgggcctgtttggatatacagcttattc
tcccaccaagtttgctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacggtgg
cctatcctccagatactgatactcctggctttgcagaagaaagtaaaacaaagcccttagagacgaagctgatttctgaa
acctcatctgtttgccaagcagagcaagttgccagagttatagtgaaagatgccatacaagggaacttcaacagctcagt
tggatcagatggttacatgctgtcaatattgacaagtgggatgtcaccagtcacttctattactgaaggtcttcagcagg
ttgtttgcatgggcatttttcgcatcattggcctattttacctaggaagttttgacagcatagttcgtcgctgcatgatg
caaagggaaaaatctgaaagtgcagataaaactgagtaa
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactggcctgccagcgaggacagggcatccctgtctccaggtctctctgctcctgctgctgctgctgcggttgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcgggggacgagttctcccgacg
ctaccagagggacttcgcccagatgtccggccagctgcacctgacgcccctcacggccaggagccgcttcgtggcggtgg
tggaggagctcttccgcgatggggttaactggggcaggattgtggccttcttcgagttcggcggtgtgatgtgcgtggag
agcgtcaaccgggagatgtctcacctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcagctgcacaa
ctggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaatggaatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataaatag
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=738 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactggcctgccagcgaggacagggcatccctgtctccaggtctctctgctcctgctgctgctgctgcggttgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcgggggacgagttctcccgacg
ctaccagagggacttcgcccagatgtccggccagctgcacctgacgcccctcacggccaggagccgcttcgtggcggtgg
tggaggagctcttccgcgatggggttaactggggcaggattgtggccttcttcgagttcggcggtgtgatgtgcgtggag
agcgtcaaccgggagatgtctcacctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcagctgcacaa
ctggatccaggacaacggaggctggagctacagaaggactggcttggcagtggcctgtcgcacttggcaactttttttga
cgttgacgtggggaacactgaagggatgcagttggtgtgggagaaacaactgtgtttgtcttgcagtgatgggttccctc
tttgggcacacaacctaa
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=726 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactggcctgccagcgaggacagggcatccctgtctccaggtctctctgctcctgctgctgctgctgcggttgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcgggggacgagttctcccgacg
ctaccagagggacttcgcccagatgtccggccagctgcacctgacgcccctcacggccaggagccgcttcgtggcggtgg
tggaggagctcttccgcgatggggttaactggggcaggattgtggccttcttcgagttcggcggtgtgatgtgcgtggag
agcgtcaaccgggagatgtctcacctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcagctgcacaa
ctggatccaggacaacggaggctggatttcaggatctgtcagtgtgaaaggatgctttaattcctgtgcccggtcttcaa
cttgcttcttgcaccataccccatatatgaaccttattaataaatggctcttccagagtggctttgtatgtggtcatgct
tggtag
>gnl|bcl2dbcds|A0A8C5J3C4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Junco hyemalis GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctactacgtttattacctggctcaggactatctacagtatgtgctccaggaatcacacctggg
accagcccagaccagggttgctcgtgtcctgagaaccatggcatcctctctgcaagaacaaaccgaggaggctctcaggc
cgctcctggacaggattgacatcacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaaagtttgct
gatggaaatactaactggggacgaattatgaccatatttacatttggaggtgtcctcaccaagaagcttcaagagcatgg
ggttcagctgactgcagaggagaaggagcagatctcttatttcatcacagagtacatcataaacaacaaagccgattgga
ttgatgcgaatggtggctgggaaaatggcttcctaacgaagtttgaaagaagatcactactgtccttctccaaaatcaca
gccctgctcatagctgttgtttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8C5JFI3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Junco hyemalis GN=BCL2L1 (length=1011 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcagccaccagccacatagtgaacggagccaccgtgcaccagagcagcctcgaagtgcacgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcaggggatgagttcgagctgaggtaccggcgggcgttcagcgacctcacctc
ccagctccacatcacccccagcacggcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccctgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagacccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgaggaaaggccaggagaccttcaacaaatggctcctgacgg
gggcgacagtggctgaggccaatgcagcacttcagccaccagctcccagcgctggggagatccaggcagctggcgggggg
cgcaggctagaaggtgtcccagccctgcagggttctccaaataatttggaagagaataaacagacttatttttgcatgtg
tgagtgcgtgcgtgtgtgtagatgtgtcactaatataaaagttccccagccagagcaagggtcaggctccgtgcccccgt
ctctggcacacacaggcaccagggagaggcaggagcttccctgcagcatccctatcctgtccttgcttctccagtcagag
ctcatccctgaggcagggggaggaagaggaggaggcagaggccagaggtga
>gnl|bcl2dbcds|A0A3Q3B0R2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL-2 (length=894 residues).
atggaggtgaatcgcttcattgtggaaaactatatttgccacaaactctccaagcgcggctacgcgtggggctccgaccg
cccccgccgcgtccgagacgatgctgccaacaacggctcggtggcgagccagtccccgaccctggtccggaggtgccgcg
gcgcacgaggagccccaggaggagcaggaacggcgccccctgacgcggagagcgaccccgaccccgtcctctgcgggcgg
atctccccgcacgagccgctcgcgcacatccacagggtgctgcgcgaggccggcgacgagctggagcgcctctaccagcc
ggacttcgtggagatgtcgcggcagctggggctcgccagcgccgcggccaaggcgcgcttcgccgaggtgatggacgagc
tgttccgggacggcgtcaactggggccgcatcattgccttcttcgagttcggcggcacggtgtgcgtggagtgcgcgtcc
agggaggagatgacgccgcaggtggaccacatcgcggagtggatgacggagtatttaaatggacctctgaacagctggat
agaggataacgggggatgggatgcgttcgtggaactgtacgacagacacaaggagtccgtcttcagctgctactggccgt
ccatcaagacagtcttcggcctggcggcgctcggggcggccagcatcaccatcggcgcgtacctcacgcaaaagatgccc
ctgacccctcagagacaaccttcagaccagatctggctctcttcaaagcctcgctcagagaactgctttcctcctcctgc
gcctccatgtcaaaacagacacaaatcaaaacagcagagggaaccagaggcacggcccagagagcaaaggatgtctgagg
tggaatcacactag
>gnl|bcl2dbcds|A0A3Q3B3X5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL2L1 (length=699 residues).
atgtctcaaaacaaagaactggtgcttttctatattatgtataaactgtcacagagaaactatcctgtcaatcacataat
actcagtgatcctccgaatagaactgatgcaggggatgcagggttggaggacgcagagatgacagagacacacgccaatg
ggacttttaacgggactagtcctgggaccccgccggcgtccccactgaggcagcaaccgctgccgacgacggcgaacatg
gacaaggtgaaggaagctctccgggacacggcaaacgagttcgagctgcggtacgcccgcgctttcagcgacctgcacag
ccagctgcacatcacgcccggcaccgtctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaact
ggggccgcattgtggggctctttgcattcggcggagcgctgtgcgtcgagtgcgtcgagaaggagatgagtcacctggtg
gccaggattgtggagtggatgaccgtctacctggacaaccacattcagccttggattcagagtcaagggggatgggagcg
ctttgctgaaatcttcggcgacaacgcggcggctgaaagcagaatctctcaggagggtttaaagaagtggctgctggtgg
ggatgacggtggtgaccgcggtggtggcgggttcgctcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3Q3B4P5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=MCL-1 (length=819 residues).
atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagtcgtggacggattacacagagacacctctcc
ccaggtctccattggcgcctcgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacgaccgaaggacc
tggtgatgcctccgctgaagggataccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccgagcacg
ccggaggtggacggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaacgacacgaagcatctgatcag
ccgtttcctacaagagtttactggactatcaaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgaggac
atgacgtttgtaacaaaaacagcccggagccttttcgcagacgggatcaccaactggggtcggatctccagcctggtggc
ctttggcgcagtggtggcggtgcacctgaaggagaaggggagggaggaatgcgtggagctggtgggccaggagatttcca
catacctgctgtctgagcagaaagactggctgctcaaaaataactcctggagtggctttgtggagttctttcgaataaca
gaccctgaatctacagtcaggaacacactgatggctgtagccggatttgctgggcttggggcaacactggccttattgat
aagtgtttgttggccttga
>gnl|bcl2dbcds|A0A3Q3B4P5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=MCL-1 (length=1047 residues).
atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagtcgtggacggattacacagagacacctctcc
ccaggtctccattggcgcctcgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacgaccgaaggacc
tggtgatgcctccgctgaagggataccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccgagcacg
ccggaggtggacggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaacgacacgaagcatctgatcag
ccgtttcctacaagagtttactggactatcaaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgaggac
atgacgtttgtaacaaaaacagcccggagccttttcgcagacgggatcaccaactggggtcggatctccagcctggtggc
ctttggcgcagtggtggcggtgcacctgaaggagaaggggagggaggaatgcgtggagctggtgggccaggagatttcca
catacctgctgtctgagcagaaagactggctgctcaaaaataactcctggagtggctttgtggagttctttcgaataaca
gaccctgaatctacagtcaggaacacactgatggctgtagccggatttgctgggcttggggcaacactggccttattgat
aagcacttggtcagcaaaatgtgagcacaggcctctggaaaatgaatcatgtgtatctctggcgcctgggatcagaagtt
gctacctaagcacaaccacacatttaagttgggcagcagaaatctgggctgcaggtgtggatcaacaggatgagtcaaac
cttaatattgggtggatcctgcctcttcacaatgactgctggagacaggcaccagctccctgcgtctctgcagggaaaag
ggagtaa
>gnl|bcl2dbcds|A0A3Q3BEB7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL2L1 (length=657 residues).
atgtcacacagcaacagagatctggtgcagttctacataagctataagttgtctcagaggaactgttcgaagtctctgct
gatgccggaggttgccggtgaaaggaccgagaaggccagctcggctcccagtaacggcttgctggtcaacagtagggacg
gccagtcggggaagaagatctggccccgccgcagcgacatagaggccgtaaaatcagctctgaaggactctgcggatgag
tttgagcgtctctacacgcaaagtttcagccacctgtccctgcagctcgacatcagccccgacacggtctaccacagctt
caagagcgtgctggacgagctgttcaaggacggggtgaactggggccgcgtggtgggcctgtttgccttcggcggcgtgc
tgtgcgttcagtgcgtcgagagggacatgagtgagctggtctcccgcattgcagactggatgaccgtttacctggatgag
cagatcggtccgtggatcgacagccagggaggatgggacagcttcgctgagatgtacgggcgagatgccgctgcagaagc
gaggaggtttcaggagtccctgaagaaatggctgctagctggagcggcgctgctggctgggctgcttctcggcgtgctcg
tggctaagaagcgttaa
>gnl|bcl2dbcds|A0A3Q3EZT5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L10 (length=621 residues).
atgtgcagagcgcagtctgatatcgctgggaggaaaatgtcgtgcgggctgtggaaagagaccctggctctggcagagga
ctacctgtccctgtgctgcacaagcccacggccagcccctccacctcccagcatgtcagccgctgctataaggcgcctgg
cccaggacatggagaagcagcaccaggcccgcttccaatccctggctcagaccttcctgaggcagtgcgggccggacccc
tgctccggtcttaggaaggtgatggaggaactggtgggagatggacacttgaactggggaagggttgtatcccttttcac
ctttactggggtgctggccagacaactgcaggagcaggaggatgtgaagctggggctggaccctgtgcaggggcagaaac
tgggacagggacccgggcactgcaggggactggcagagaccatagctgactacctgggagaggagaaaaaagagtggctt
ctggagaatgacggatgggagggattctgtgagttctcccgcagcgctagagagacgagccaggactcgtccatgaagac
ggcactgtttgctgcggctggtgtgggccttgctggactcactttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A3Q3EZT5_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L10 (length=630 residues).
atgtgcagagcgcagtctgatatcgctgggaggaaaatgtcgtgcgggctgtggaaagagaccctggctctggcagagga
ctacctgtccctgtgctgcacaagcccacggccagcccctccacctcccagcatgtcagccgctgctataaggcgcctgg
cccaggacatggagaagcagcaccaggcccgcttccaatccctggctcagaccttcctgaggcagtgcgggccggacccc
tgctccggtcttaggaaggtgatggaggaactggtgggagatggacacttgaactggggaagggttgtatcccttttcac
ctttactggggtgctggccagacaactgcaggagcaggaggatgtgaagctggggctggaccctgtgcaggggcagaaac
tgggacagggacccgggcactgcaggggactggcagagaccatagctgactacctgggagaggagaaaaaagagtggctt
ctggagaatgacggatgggagggattctgtgagttctcccgcagcgctagagagacgagccaggactcgtccatgaagac
ggcactgtttgctgcggctggtgtgggccttgctggactcactttcctcctgatccgagtgcaggcctga
>gnl|bcl2dbcds|A0A3Q3FUB6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=666 residues).
atgtcatacagtaacagagagctggtggagttcttcataagctacaaactgtctcagaggaactatccaacctatgtgct
gaggtcagaggatgctggtgaaaggactgagggagacatggaaaactctgctgccagtaatggctttttggtcaacagca
ggaaccgggccggccagtcagtgatgtcatcatccccacacaccgacatagaggctgtaaaggcagctcttctggactct
gcagatgagtttgagcttctctttacgcaggcctttagtgacctttcctcgcagcttgacattactcccaacacagccta
tcacagctttaagagtgtgatggacgaggttttcaaggatggagtcaactgggggcgtatagtaggcctgtttgcctttg
gcggtgtactgtgtgtggaatgcgtccagaaggatatgggtgaactggtttcccgcatcgcaggctggatgactacgtac
ctggatgagcacattagtgcatggatcgagagccagggaggatgggactgctttgttgaaattttcggacggggcgctgt
tggagaagtgaggagatctcgggaaactctcaccagatggctgctagttggaatggcgctgctaatgggagtcgtggttg
gtgtttacatcgctaagaaacattaa
>gnl|bcl2dbcds|A0A3Q3G1D7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Labrus bergylta GN=BCL-2 (length=690 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgtcataaactctccaaacggggctacgagtggggatt
cgaggatgagcaggatgaagatgctgctaataacgggtcattagttgcccctccgccgactttggttcgccggtgccgtg
aagcgagctccgggcctgaccgtgagagcatcccccacctctgcaaacggcccccccagtccgacccagcctacgcggat
atccacagagtcctgcgcgaggctggagatgaacttgaaagactttaccagccggacttcacggagatgtcgcggcagct
gtatctcacctccaccacggcgcagaggaggttcgccgaggtgatagacgaactgtttcgggacggggtgaactggggcc
ggattatcgcctttttcgagttcgggggcacggtgtgcgtggagtgcatgtccaaacaggagatgacatcgcaggtggac
aacatcgcagagtggatgacggagtatttgaatggacctctgaacagctggatacaagataacggtggatgggatgcctt
tgtggagctgtacgacagacagagagactcggccttctgctcctcctggccctccattaagacagtcttcggtctggcag
cactcggggcggctagcctcaccattggagcataccttacacagaaatga
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3GP42_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Labrus bergylta GN=MCL-1 (length=825 residues).
atggatatcattaatatgaagcgggcggcggtcagcgtatctgccggagtcatgagctttatgatgccacaaaatggagt
cgggaagggacagatgcactacggcccggaagcgtcctctccacaaatagcgatgggatcctctttagcctcacaaaatg
ggaatgtcgggtcgaatgaaaccaccaagcggcccaaggctctggttgttaactcgggaaacgacgatatcgaagacggc
tcgctgccgtgcaccccggagccggacagtgaaaccgaagtctccagctgtcccactgggggcgaagtcctggagagcga
caccaggcaactcatcagcgccttcctcagagagcatactgggctttcaaagcctggttggaatgagagtagtgcactat
cgacgatgaaaagagtcgtggaggacgtgctggcgaaacacagatacgcgtataatggtatgatcaacaaactgtcactg
gaagacagaggggacgatgcaagttttgtcagcgctgtggcaaagagcctttttgcggatggaacaacaaactggggcag
gatcgccagcctggtcgcttttggagcggctgtgtcacaatacctgaaggagaatggcagggggcactgtgtggagctgg
tggggcaggagatctccacgtacctgctgtctgaccaccgggactggctggtcaaaaacaacgcctgggacggctttgtc
gagttctttcgagtagcagacccagagtccacagtgaggacaacactcatggcttttgctgggttcgcaggaattggggc
cacgttggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A4W6BQD5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataaagtataaactctctcagagaaactatccactcaaccacatgga
actcaatgagcctccaaacaggactgatgggggggaggcagggtcaagtgaggaagagcggatagcaacacacgccaacg
gaacttttaacagcacgagtcctgggacccctccagcgtccccactgcggcagcaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttgcgatatgcccgcgccttcagcgatctgcacaa
ccagctgcacatcacgccggccacagcttaccaaagcttcgagaacgtgatggatgaagtgttccgggacggcgtcaact
ggggccgcatcatagggctttttgcgttcggcggggcgctgtgtgtcgagtgtgtggagaaggagatgagtccactggtg
ggcaggatcgtggagtggatgacagtttacctggacaaccacattcagccctggatccagagtcaaggaggatgggagcg
ctttgcagaaatctttgggcaggatgcagcagcagagagcaggaggtcccaggagagcttcaagaagtggctgctggcgg
ggatgaccctggtgaccggggtcgtggtgggctcactgattgctcagaagcgcctgtga
>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=888 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcaggtctttctgtgaatttgggtcagggctgaagtctttcatcctccccc
atggatga
>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=918 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcagatcctcccgttgtcttgggttacaggacaaacacaacactcatcgag
gtcttaggaggaaatggagtagagcctctccatggtga
>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=978 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcagcaattacccagcagcaagagtgtttgtatgcaaggccaaggcaggaa
gggagagctgcatttttccatgtcttgcagtcatgaagcccatttccatagagcccattgacaagcctcggatcatttgt
atggattcaactttgtga
>gnl|bcl2dbcds|A0A4W6DDI0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Lates calcarifer GN=BCL-2 (length=690 residues).
atggcgagcgagtgtaatcgcaatatcgtggaaaagtatatctgccataaactctccaaacggggctacgtgtggcggtg
tgacaacgtccgggatgaagatgctgctaataacgggtcgatagtttcccctccgccgactttggtacaccggtgccgcg
aagccagcgggcccgacgacaacgagagcgtccccaacctgcgcaggcggctcaaccctcagcccgacccgtacgccgcc
atccacagagtcctgcgcgaggctggagacgaacttgagagactgtaccagccggacttcacggagatgtcgcggcagct
gtacctcacctccaccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggcc
ggattatcgcattcttcgagttcgggggcaccgtgtgcgtggagtgcgcggccaaggaggacatgacgtcgcaggtggac
aacatcgcggagtggatgacggagtatttaaatggacctcttaacagctggataaaagataacgggggatgggatgcctt
tgtggagctgtacgacagacagagggagtccgtcttcagttgctcctggccctccatcaagacggtcttcggcctggccg
cgctcggggcggctagcctcaccatcggagcgtaccttacgcagaagtga
>gnl|bcl2dbcds|A0A4W6EST2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L1 (length=666 residues).
atgtcgtacagcaacagagagctagtggagttctttataagctacaagctttctcagaggaaccacccaacctctctgct
gaggccagaggatgctggtggaaggactgagggagataagaccaactcagctgccagtaacggcttgctggtcaacagca
gggacaggtgtggtcagcagggggcgccatcgcccctgcgtggtggcatagaggctgtaaaggcagctcttagggactct
gctgacgagtttgaactgctcttcacccaagcgttcagtgacctttcctcgcagcttgacatcactcctgacacagccta
ccacagctttaagagtgtgatggatgaggtgttcaaggatggtgtcaactggggacgtatagtgggtctgtttgcctttg
ggggtgtactgtgtgtggaatgtgtcgagaagaatatgagtgagctggtttcccgcattgcagactggatgaccatgtac
ctggatgagcgcatcagtccgtggattcagagccaaggaggctgggactgctttgctgagatttttgggcaagacgcagc
tgcagaagcgaggagatctcgggagactatgaggagatggctgctagttggagtggcgctgctaacaggagtgctggtcg
gtgtcctcgtcgctaagaaacagtga
>gnl|bcl2dbcds|A0A4W6FHH7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L10 (length=576 residues).
atgtcatgcgggctgtggaaagagaccctggttctggcagaggactacctgtgcctttgctgcacaagcccagggccagc
ccctccacctcccagcgagtcagccgctgccatgagacgcattgcccaggacatggagacacagcaccaggctcgtttcc
actcccttgctcagaccctgctgaggcagtgcgggccggacccctgctctagcctcaggaaggtgatggaggagctggtg
ggagacggacgcttgaactgggggagggttgtttcccttttcacctttactggggtgctggccagacagctgcaggagca
gaggctggggctggaccccaggcaggggcaggaactgggacaggagcccggaaactgcagggaactggcggagaccatag
ctgattaccttggagaggagaagaaagactggctgctggagaatgatggatgggaggggttctgtaagttctctcatgcc
gccagagaggtgaaccacgactcgtcgatgaagacggtgcttgttgccgctgctggcgtgggcctggctggactcacctt
cctcatggtgcgctag
>gnl|bcl2dbcds|A0A8C5RX62_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Laticauda laticaudata GN=BCL2L1 (length=684 residues).
atgtcgagcggcaaccggtccctggtggtggacttcattgcctacaagctggcgcagcggggccacagctggcgcgagat
cgagggtgacggcgaggagcggacagagctgtccggcgagatgggcggtagcagcggtgtcctgaatggtgggagcccct
cctggcaccccagccccagcccggtggtcaacggggcagccagcattcacccggctctgctggaagagctgagcgacggc
ccccaggcggcggtgaggcagacgctgcgggaagctggggacgagttcgaactgcgctaccggcgggcctttagcgacct
gacctcacagctccacatcaccctgggcacggcttaccagagcttcgagcaagtggtgaacgaacttttccgggacgggg
tgaactgggggcggattgtggcctttttctccttcggaggggccctgtgcgtggagagcgtcgacaaggaaatgcggggg
ctggtgggaaggatcgccacctggatggccacgtacctgacggagcacctggacccctggattcaagacaacggaggctg
ggtaagtctttggctaaacttgcagggtaagggtctccagagagtcttcagcctttggggtaaaaccctccgtctggcat
ttctgtcggggggggggagatgcagggagggcgtgtggggttga
>gnl|bcl2dbcds|A0A8C5S4J3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Laticauda laticaudata GN=BCL-2 (length=618 residues).
atggctcatcctgggataagagattacagtaaccgggagatagtgctgaggtacatccattacaagctgtcacagaaagg
atatgactgggttgccagtggagacagagaaaatgtttctcctgctgttgggacctttcctgcccttggaggactggtgc
ctctgccttctgctgctgttagtaacttggctgccactgaagaacatcctgtaccccaagttgtttattccacactatgc
caagctggtgatgagttttcccggagatatcaaagggactttacccaaatgtctggacaactgcacttgactccagtgac
tgccagaagtcatttcatggctgttgtagaagagctgttccgagatggagtaaattggggaaggattgtggcattctttg
aatttggtggcatgctgtgtgtggaaagtgtcagtcgggagatgtcacctctcgtggacagtattgctgaatggatgact
gaatacatgaacaggcacctgcataattggatccaggacaatggaggctgggtacgtggctggttgtgttctttcactgt
ctggggtgggcgtggcctgtatgtgggccaccagtttgacatccctgacttagactga
>gnl|bcl2dbcds|A0A8C5SDG4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Laticauda laticaudata GN=BCL2A1 (length=522 residues).
atggaaagctacaatttcctttatgtgaacaccttggtgcaagattacctgaaatacatttgtcaagaggctcagctggc
agcggccccaaacaaagtggctgaagtccttcgtaaagccggatcttctgctcagaaggaagttgaaggcaacctgaggc
cttacgtggactcactggggattcattccatagaagaagctggcaacattttcaatcaagtgatggaaaacgaatttgcg
gatgggaaaattaactggggacgcattctgacgatattcctgttcggtggaatcctggccaaaaaactccaaggaccttt
ggcaaaagaaaacttgaagcagatctcttatttcatcacagactatattgtgagcaccaaaggaaagtggatcagtgaga
atggaggatgggacaatggctttataacaaaatttgaggatagaaactcctgggtatccttatccactctgaagacaaag
atcttggctgttttttcagtcttcaatcaatatcactcataa
>gnl|bcl2dbcds|A0A8C5WWU9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Laticauda laticaudata GN=MCL-1 (length=978 residues).
atgttcaacaagaagacgatggttctctattgcggcggctcccccggattggcaccagccgcccctcagtcccccggcgg
cggcggcggcggcggcagcgagggcggcctggctctccttcccggcggcgttcgaggaggcctgggcgggggtctgtgct
ggcctcccgccggctgcgctgaggggcctcgagcgctgattggcggagggtcgcgcgcagggcccctctcgctgattggg
cccccggacgcggacgcgcgcgcgctgattggccaggcggcactgccgccggcgacccccgaagaggagctggatggctg
cgagcccgaggcggagaccggagtggagccttccgtcgcctcttcctccgccccgccgtcgcccggggacccgctgcgcc
aggtgacgctgcagctggtggcctcatacctgcgagaggcggccgaccaggagccctccaagcaggacggctgcggcggc
gggaagttcctgcagggcctgctgggccgcttcggtccctgccccgccgaggcggagacggcggctcgggccctggagac
gttgcggagggtctgtgacgacatcatggagaagcaccagctggccttccaaggaatgctgaggaaagtgcagattgaca
aagcggatgacttgaagcttatgtcggaagttgcaacgcaacttttcaacgatggcataacaaactgggggcgaattgtg
actctcatttcttttggtgcctttgttgccaaacacttgaagagcataaatcaggaaagcggcatcagcactttggcgga
gattatcacggaggtgctggtgacagagaagagagagtggctgctgcatcacaacgcctgggagggctttgttaaattct
tccatgtagaggacctggaaggcagcatcagaaacattctggtggcttttgcaagcgtggctggcctaggagcgagcttg
gcttacttgatccggtga
>gnl|bcl2dbcds|H3AAS7_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L2 (length=570 residues).
atggattcgctttacagtaacagaggagtggtggaggacttcatttattacaaactcggccagaaggggtactctcagca
gggtgccccaacggatccccccgccaacccactctaccgtgccatgcgggaggcgggggatgagtttgaggcccgcttcc
accgcaccttcaactccttgtcgtcacaccttcacatcacaccgggcacggcttaccggcgatttgctgagacggcagac
agcctcttccaggatggggtgaactggggccgggtggtggcgctgttcgtcttcagcgcagcactctgtgtggagagcgt
ggataaggaaatggcttcgctggtgggacggattattgactggacagtaacttatgtagagagcagccttcaggattgga
tcaaccacagtggaggatggagtgctttcgtgtgtctgtatgggaatggtgcagtgggcggagccaggaggtttcaggaa
ggctactggtcatccatgaagacggttgtgacgggggctgtggcgctaggggcggtgatgacggtcggagcgctttttgc
cagcagataa
>gnl|bcl2dbcds|H3AAS7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L2 (length=570 residues).
atggattcgctttacagtaacagaggagtggtggaggacttcatttattacaaactcggccagaaggggtactctcagca
gggtgccccaacggatccccccgccaacccactctaccgtgccatgcgggaggcgggggatgagtttgaggcccgcttcc
accgcaccttcaactccttgtcgtcacaccttcacatcacaccgggcacggcttaccggcgatttgctgagacggcagac
agcctcttccaggatggggtgaactggggccgggtggtggcgctgttcgtcttcagcgcagcactctgtgtggagagcgt
ggataaggaaatggcttcgctggtgggacggattattgactggacagtaacttatgtagagagcagccttcaggattgga
tcaaccacagtggaggatggagtgctttcgtgtgtctgtatgggaatggtgcagtgggcggagccaggaggtttcaggaa
ggctactggtcatccatgaagacggttgtgacgggggctgtggcgctaggggcggtgatgacggtcggagcgctttttgc
cagcagataa
>gnl|bcl2dbcds|H3ANS8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L1 (length=720 residues).
aaaatgtccttcaacaggttgctggtggtggaccatatatcccagaagctgatgcagcggggataccagtggagggaggt
tggtgagcaggaccacggtggtggaggagaccgcgcgagggaagcacagactcccgaggagggggccattccaggcatgg
acccacccaacggcagccaccctcatgcaggactcaatggtgcggttaacgggttgccggctggcagcagcagccgcctg
gaagcccaggcggtgtcggggcccgaagccgtgaaacggacattgcgagaggccggggaagagtttgagctgaggtatag
ccgagcattcagtgacctctcttcccagctccacatcacccccggcacagcctaccagagctttgaacaggtggtgaacg
aactcttccgggacggagtgaactgggggcgcgtggtggctttctttgcctttggaggggcgttgtgtgtggagagtatg
gacaaggagatgtcttcactagtagagcggatcgctgagtggatgacgacttacctagatgataacttaaacccttggat
tcaggaacaaggaggatgggcaaccataatacacattgacggggttgacgctatgcagcgctcaaacaccaggagtgaaa
aattgggttttgttgggttttttttttcctttcttctgcgtggggtggaaagaaacctcaaactctttttgcgcaaatga
>gnl|bcl2dbcds|H3AR18_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Latimeria chalumnae GN=MCL-1 (length=591 residues).
atggaattaccgggggacgggtgcccgcaggacggggacatggcggagtttcgcaaggagacgctgaagctgttgcggag
ttacttgtgcgaggtggcgggctgcgagagcacggagacggccttcaggttcggtctagatcagtggagcggtggcgaga
agccgctggacaccctccggcgggtcggggatagcatcatagacaaacaccgcatcgcctttaatggaatgcaacaaaag
ctaaacatccataaggaggacgacctccacattatacccgaaattggtaaccagatctttaaggacggtgcaacaaactg
gggtcgcattgttagtcttattgcttttggagcagtcgttgccaagaagctcaaaaagatgaacctggaagacagcattg
aacagttggcagtgtcgatcacagactttctggtgcagaataagggagactggatcctcaagaaccaaggctggaaagga
tttgttgactttttccatgtagaagatgcagagggtacaatcaaaaatgtattgatgacatttgcgggcgttgctggact
gggtgcaagtctggtctacttgatgagatga
>gnl|bcl2dbcds|H3AR18_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Latimeria chalumnae GN=MCL-1 (length=624 residues).
ggttacaacgccgacggctccgtgccgccttcgccgcccaccccgtcgacccccgaggacggggacggggacatggcgga
gtttcgcaaggagacgctgaagctgttgcggagttacttgtgcgaggtggcgggctgcgagagcacggagacggccttca
ggttcggtctagatcagtggagcggtggcgagaagccgctggacaccctccggcgggtcggggatagcatcatagacaaa
caccgcatcgcctttaatggaatgcaacaaaagctaaacatccataaggaggacgacctccacattatacccgaaattgg
taaccagatctttaaggacggtgcaacaaactggggtcgcattgttagtcttattgcttttggagcagtcgttgccaaga
agctcaaaaagatgaacctggaagacagcattgaacagttggcagtgtcgatcacagactttctggtgcagaataaggga
gactggatcctcaagaaccaaggctggaaaggatttgttgactttttccatgtagaagatgcagagggtacaatcaaaaa
tgtattgatgacatttgcgggcgttgctggactgggtgcaagtctggtctacttgatgagatga
>gnl|bcl2dbcds|E2IV76_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lemur catta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tatcgatgcagaagagaacaggactgaggccccagaagggactgaatcggagatggaaacccccagtgccattaatggca
acccatcctggcacctggcagacagccctccagcgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccctatggcagcagtgaagcaagcactgaaggaggcgggcgatgagtttgaacttcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccctagggacagcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctatgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|W5MG74_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=BCL2L1 (length=669 residues).
aagatgtcatacagcaacagagacctcgtcgtctactacatcaactataaactctcgcagaagaactactcctgggacca
gttcagcctggagggcaggaccggaggcgctgaggcggtgggttcggggagcccgaacgcagaggagcgtacgaacggcg
cggccaatggcgggggggggcccgtgtcgcgccagcccccccaggggatcgaggcggtgcagggggcgctgcgcgactcc
gccaacgagtttgagctccgctacggccgggcgttcagcgacctgtcctcccagctccacatcacgcccgccaccgccta
ccagagcttcgagcacgtcatggacgaggtcttccgggacggggtgaactgggggcgcatcgtggggctcttcgctttcg
ggggtgcgctgtgcgtggagtgcgtggagaaggagatgagcaacctggtgagccgcatagccgagtggatgaccgtctac
ctggacaacaacattcagccctggatccagagtcagggaggatgggacaggtttgcggagatctttggcaaggatgcggc
tgcggagtaccggagatcacaggagagcttcaagaagtggctgctggcgggcatgactctggttacggggctggtggtgg
gctcctacatcgccaagaaacgcttatag
>gnl|bcl2dbcds|W5MMB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=MCL-1 (length=882 residues).
atgagcctctcctcgctgaagcgcacctcggccagcgccgtgatacagctctattgccccaacgccaccaccattcaccc
cggcctcgccagcctggggccctgtccgggcgggtccgccgcccgcacggctgtcctggaccccatgctcaaggcggact
acgccgaggacgaactggacaactactcggcggagcccgtggcgaccagcgcctggatccccaagtcgccgcggtcgctg
cccgcggggctgaagctgggcggccacttcccggagagcggccacgccgacgggtccctgccctccaccccggacacccc
gctggactgcggcagcgtccccgagttcctctccgaggcccacgggcagctgaacgcggagacccgggagttaatcggga
cctttttgcagatgtacacggggttgccgcaccgccggagccgaggcaaggccctggagaccctgaagcgcgtcgtggac
agtgtggtggcgaagcatcagatcgcctaccacggcatgatcgcgaagctggagctggagaacaagggtgaggacgtgag
cttcgtgacgggcgtggccaaaagcttgttcagcgacgggaagaccaactggggccgcatcgccagcctggtgtcgttcg
gcgcggtggtggccaagcagatgaaggactcgggccgggagagctgcgtggaggcggtgggccaggcgatctccaactac
ctactgcaggaccagcgcgagtggcttctgaacaaccgaggctgggacggcttcgtggagttcttccgcgtggaggaccc
cgagtcgacgatcaggaacgccctgatggcgtttgccggggtggcggggctgggcgcggggctggccctgctgatcagat
ga
>gnl|bcl2dbcds|W5N4F7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Lepisosteus oculatus GN=BCL-2 (length=696 residues).
atggcaaataacgaagccccgtacgatactcggaatatcgtgacaaaatacatccatcacaaactcctgaagaagggcta
cgtgtgggaatcccgcgtgtccggcgagaccgatccccccaataacggattggtgggcccctccgcctcgggtccggggc
tgcaggcgcggcggctccaggctgccggggccgagcgcggagctgtcccggtcccccgccggacccccccgcccgacccc
cacgccgctctccacaaggtgctgcgggaggctggggacgagatcgagaggatgtaccaccgggacttcgcggagatgtc
ggatcagttgcacttcacccccaacaccgcccggaggaagttcaccgcggtggtggaggagctgtttcgggacggagtca
actgggggcggattgtcgctttcttcgagttcggcgggacgatgtgcgtggagagcgtgaaccgggagatgacgtcccag
gtggacaacattgccaactggatgacggagtatctcaacgggccccttcagaactggatccaggagaacggaggctggga
cgcctttgtggagctctatgggagacagagaggctccatgttcagctgttcatggccatctttgaagactttctttggtc
tagctgctctgggcgcagcaggcctgaccgttggagcctactttacacaaaaatga
>gnl|bcl2dbcds|A0A8C5MT36_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Leptobrachium leishanense GN=BCL-2 (length=891 residues).
atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaaatatattcattataagctatcacagagggg
ctatgaatgggaagatgggaggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataatcattctgatg
gtgacgaagtgtccgcttcacctggagatccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtca
aataatgcatcccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcagaggagctctgcttctgctgc
ttctaccgtcccttcaccacagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggttctccagactcttagccgagcaggcgatgag
ttttcccggctgtaccagcaagactttaggcagatatccgggctcctccacttaaccccatcaacagttcgtccacggtt
tgctgctgtggtggaggaactcttccatgatggggtgaactggggaaggattgtggctttctttgagtttggaggtgtca
tgtgcgtggagagtgtgaatcgggagatgtcaccactggtggactccatcgttggttggatgacagagtacctgaatagg
catctgcaaaactggatccaggaacaaggcggatgggagtcgtttgtggaattgtatgacagcagcgtcagacccccatt
tgaccccagttggatctccatcaagacaatactgagtcttgctgtggttggagcctgcatcaccataggagcataccttg
gtcacaagtga
>gnl|bcl2dbcds|A0A8C5MT36_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Leptobrachium leishanense GN=BCL-2 (length=822 residues).
atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaaatatattcattataagctatcacagagggg
ctatgaatgggaagatgggaggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataatcattctgatg
gtgacgaagtgtccgcttcacctggagatccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtca
aataatgcatcccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcagaggagctctgcttctgctgc
ttctaccgtcccttcaccacagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggttctccagactcttagccgagcaggcgatgag
ttttcccggctgtaccagcaagactttaggcagatatccgggctcctccacttaaccccatcaacagttcgtccacggtt
tgctgctgtggtggaggaactcttccatgatggggtgaactggggaaggattgtggctttctttgagtttggaggtgtca
tgtgcgtggagagtgtgaatcgggagatgtcaccactggtggactccatcgttggttggatgacagagtacctgaatagg
catctgcaaaactggatccaggaacaaggcggatgggtgtcatttttcaaccttttctacatacacttcctggtcgaggc
ctcatttatagatgctcaatga
>gnl|bcl2dbcds|A0A8C5MT36_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Leptobrachium leishanense GN=BCL-2 (length=888 residues).
atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaaatatattcattataagctatcacagagggg
ctatgaatgggaagatgggaggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataatcattctgatg
gtgacgaagtgtccgcttcacctggagatccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtca
aataatgcatcccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcagaggagctctgcttctgctgc
ttctaccgtcccttcaccacagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggttctccagactcttagccgagcaggcgatgag
ttttcccggctgtaccagcaagactttaggcagatatccgggctcctccacttaaccccatcaacagttcgtccacggtt
tgctgctgtggtggaggaactcttccatgatggggtgaactggggaaggattgtggctttctttgagtttggaggtgtca
tgtgcgtggagagtgtgaatcgggagatgtcaccactggtggactccatcgttggttggatgacagagtacctgaatagg
catctgcaaaactggatccaggaacaaggcggatggttaaacacattgcctgagattgagacgctgcagagtcttattcg
agaaacacagagatcattgcgtcagtcccacagaaagaatgaatgcacctggataaagagagcgcagaggattttgacac
attcttga
>gnl|bcl2dbcds|A0A8C5MT36_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Leptobrachium leishanense GN=BCL-2 (length=876 residues).
atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaaatatattcattataagctatcacagagggg
ctatgaatgggaagatgggaggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataatcattctgatg
gtgacgaagtgtccgcttcacctggagatccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtca
aataatgcatcccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcagaggagctctgcttctgctgc
ttctaccgtcccttcaccacagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggttctccagactcttagccgagcaggcgatgag
ttttcccggctgtaccagcaagactttaggcagatatccgggctcctccacttaaccccatcaacagttcgtccacggtt
tgctgctgtggtggaggaactcttccatgatggggtgaactggggaaggattgtggctttctttgagtttggaggtgtca
tgtgcgtggagagtgtgaatcgggagatgtcaccactggtggactccatcgttggttggatgacagagtacctgaatagg
catctgcaaaactggatccaggaacaaggcggatggtgctgggcttccttagagctggttcagacaggacatgcttcgac
tccctgtaagctgcagcatttgacatggccgtggcgaggcagccaatcaaattactctcaaggccgaacacattga
>gnl|bcl2dbcds|A0A8C5PJB3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Leptobrachium leishanense GN=BCL2L2 (length=576 residues).
ccggggctgccccgagcttcggacctaggctctcgtcccttggtggaggattttgttcggtataaattacaccagcgtgg
gttagtgtcagaacctgttggagccccatcatgcgcgctccattcagccatgcgtgccgctggagatgaatttgaagacc
gtttccgtcaggccttcagcgaaatatctactcagatccacgtcacgcctggcacggcatatgcgcgcttcgcagaggtg
gctggaggtcttttccaaggtggggtgaactggggccgcgtggtggcattctttgtgtttggagctgctctctgtgcgga
aagtgttaacaaggagatggctcgacttctaccgcagattcaggagtggatggtgacctatcttgaaacgcacctgagag
actggatgcagagcaatggtggatggaatggattcctggctctatatggcgatggtgctatagaagaggctcgaagacag
cgtgaagggaattgggcctcactgaagactgttctgacaggcgcagtcgccttgggtgctctgatgacagtgggagctct
gtttgccagcaagtga
>gnl|bcl2dbcds|A0A8C5PJK5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Leptobrachium leishanense GN=MCL-1 (length=1431 residues).
atgtgcacgtgcacgctaatggagaggggttcaaggtgggcagggccagaccagaggggctggcttaagcgcagggccgc
catgagagcgaagccaggcaccctccttcactcgctacgagaaggctatggatggattcccggccctgtgcttccccctg
atcacttcaataaagtttataaaaggcaaccaaacgccgtcttacggctgtctcaccaatgtcgtgaaagggcagctttt
acagcagcagagagagacgccgcacgctgcctctcgctttgcggccactccctcgcacgcccggccactcccccgcgctt
aaaactggttggcttgcagtttcccgcgctgtctgctcagatcattatcaagatggaggcaggaaaggtggctgttgcga
tggcactgagagaaaaagaggtgcaggaagatgccgcaggctacggggacacctgccgagccccggagagcatcatgcag
gcctcaaatgccgagaagaaggagagagaggaccacggggacacctaccaggcccaggagaactccatgcaatcctcaga
ggccgagagagagggtgaggagggccctgaaaccaccagagacacctgtcagacccaagagaaccccatgcaaccctcag
aggccgagagagaggagggccctgaaagcacctgtcaggcccagaagtgcttcttggagacctcagaggccctggaggag
agacaaggtgaggagagccctgaagacagcacagacacctgtcagtccctgcagaacttcttggagtcttcagaggccga
acaggaggaggaggatagagatgacaaaaagatggaggctgatgtcccggggcccagtcctccgcctgaggatccgcagt
gcagacaggacgagctcttcctttactcccgcctgctgctcctaaccttcttcagggagtatgccggtggaccagacccg
ggcccagtgagggctctcatccagctggccatgcccaacacggccctgcagaccctactgagggtggcgagagagaccat
agagaggaaccacgcatgcttccagaacaccctgaacaggctttgcattgagaggccagaacacctgcagaagctctccc
tggtaaccttcgcactgttcagtgatggtgccatcaactggggcagaatcgccaccctgttcagcttcaccgccctcgtg
gcccgacacctgaagaacctagggatgaatgacagcatctttacgctcgcagacggcgtcgcccgattcctcaccatcac
caagagaagctggttccaggaacatcaaggctgggacggttttgtggagttcttccttgtcagtcgctggcaaaccggca
tcaggattgccctgttggcactcgctatctttgcaggaatcgccacaagcctcctgtaccttatcatgtga
>gnl|bcl2dbcds|A0A8C5QRL7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Leptobrachium leishanense GN=MCL-1 (length=603 residues).
atgaatggggccgggcattttgtggtggccgggctgttttgtgatggcagagggacatgttgtttgagtggagctttatt
gcgtttctcctggatattccccatgttttgcagtatttgccccccctctcgtttccctggtggtctctcgtgccgtcgcg
tttcgctcaggcttgcacattacatgaagctgctgtacaagggccggcggtgtctgtgccgaccagctccgctacatggc
atgctgacgaagctgtctatccagcaagcggaggatctccagaagctctctgaggtgccttccttggtcttcaacgatgg
gatcacaaattggggcaggattgtgacattaattagctttggcgctttccttgcaaaacatttgcagagcataaaactgg
aggactgtatcgttccactggcagataatttcacggattaccttatgaccagcaaacgggaatggattatgcaacaaaaa
agctgggatggttttgtagagtttttccacgttgaggactatgaaagcggactcagaactgttctgatgacctttgccgg
agttgctggaatcggagcaagtcttgcctatatgatccggtga
>gnl|bcl2dbcds|A0A8C5WFB8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Leptobrachium leishanense GN=BCL2L1 (length=627 residues).
atggaaggtggaaataagaacctcgtgcaaaattttgtatgtaagaaattgtcccagagagatttcacatggaattgctg
cacagactcacattctgaggttctatctaatgggacatctcctggggagcagcctgccgcacgcgcaggaggacattctg
gaagcactgaaagtgaagctgtcctgcaagctctgctggacgcctcagaggagtttgagctgagatatcagcgggcgttt
agtgacctgacctcccagttgcacatcacccctgagacggcatatcagagcttcgagcaggtcgtgggggagctgtttag
agatgggacaaactgggggcgaatcgtagctttcttctcatttggaggggccctctgtgtcgaaagcgtccacaaggaga
tggaagatctgttgcctaggattgtccagtggatgaccacctatctggataatcagttggaagactggatccaaacgaac
gaaggctgggaagcattcgtgcgcctttacgggaatgatgcagctgccagcagcaggaaaagtcaggaacgcttcggccg
atggcttctgactggggtcacgctggctggaattatcctgcttatttcctacatggcccgcagatag
>gnl|bcl2dbcds|Q4U2V6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lonchura striata GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgatgtgaggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|G3SLZ1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL-2 (length=690 residues).
atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccactataagctgtcgcagcgggg
ctacgaatgggaggctggcgaagctagcgccgcgccccccggggccgctcccgcgccgggcgtcctctcttctccgcccg
cggcgccccggggcccggacaccaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcccggtgcca
cctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgcgacttcgccgagatgtcgag
ccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
gggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggaggatgggatgc
ctttgtggaactgtatggccccaacatgcgacctctgtttgatttctcctggctgtctctgaagacactgctcagtctgg
ccctggtgggagcttgcatcaccctgggtgcttacctggggcacaagtga
>gnl|bcl2dbcds|G3SLZ1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL-2 (length=504 residues).
atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccactataagctgtcgcagcgggg
ctacgaatgggaggctggcgaagctgacaccaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcc
cggtgccacctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgcgacttcgccgag
atgtcgagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggacgg
ggtgaactgggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
ccctggtggacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggagga
tgggtaggtgcatgtgtggttgaa
>gnl|bcl2dbcds|G3SPN0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagttggagtcagtt
tagtgatgtggaggagaataggactggggcctcggaaggcactgaatccgagatggagatccccagtgccatcaatggca
acccatcccggcacctggcagacagccctgcggtgaatggagctactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctctgagggaggcaggcgatgagttcgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaaggaccacgccccttttgtgcttcagtacctcagtgaaggaagacatagcctatgtgttcattcaggtcaaaa
cctatgcaagtgggaagttagtccagtgtttcctcaccctgacacaatggttcaccacccaa
>gnl|bcl2dbcds|G3T756_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Loxodonta africana GN=MCL-1 (length=1026 residues).
atgttcggcttcaagagaaacgcagtaatcggactcaacctttactgtgggggggccggcttgggggccggcggctgcgc
cacccctccgggagggcgacttccagctcctggaaaggaggccacggcccggcaagaggtagggggaggggacgccggcg
cgagccccccggccgctgtcgctccggacggccggagggtcgtgcggccggcgcccattggcgccgagggccccgacgtc
actgcgattcccgcgaggccgacgttctttgcgcccacccgccgcgcgtcgccgcctgtggagatggaggctctagccgc
cgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagccgctcgggaagcggccggctgtttttcccc
ggctggggctggtcggggaggccagtaatggccccggtaccgacgggtcactaccctcgacgccgcccctagcagaggag
gaggaggacgagttgtaccggcagtcgctagagattatctctcggtaccttcaggagcaggcaaccggcgccaaggacac
caagccaatgggcgggtctggggcggccagcaggaaggcgttagagaccctccggcgagtcgcggacggggtgcagcgca
accacgagacggccttccaaggaatgcttcggaaactggacatcaaaaacgaagatgatgtcaaatctttatctcgagta
atggcccatgttttcagtgacgggataacaaactggggcagaattgtgactctcatatcttttggtgcctttgtggccaa
acacttgaagagcgtaaaccaagaaagccgcatcgaaccattagcagaaagtatcacagatgttctcgtaaggacgaaaa
gggactggttagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaga
aatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G3T8E6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Loxodonta africana GN=BCL2A1 (length=528 residues).
atgactgactgtgagtttggatacatttacaagctggtccaggactatctgaagtacgtcctgcagataccacaacctgc
agctggttcaagcaaaacgtccagagtgttacaaaatgtggctttctcagttcaaaaagaagttgaaaagaatttgaaac
cctgcttggacaattttgttgtcatctccattgataccgcccaaacaatattcaagcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaagaattgtgaccatatttgcatttggaggtattctcatcaagaaacttctaagggagcg
aattgccccagatgtggatacttacaagaagatttcttcttttgttgctgagttcatagtggataacacagcagagtgga
taaggcaaaacggaggctgggaaaatggctttgtgaagaagtttgaacctaggtctggctggctgacttttctggaagtt
acaggaaagatttgtgaaatgttatttctcctgaagcaatactattga
>gnl|bcl2dbcds|G3TMU7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L2 (length=627 residues).
tatattcatgttagtctttcatccctgactcttgcagccgcccgcatggcgaccccagcctcagccccagacacacgggc
tctggtggcagactttgtgggctacaagctgaggcagaagggttatgtttgtggagctggccccggggagggcccagcag
ctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatctggca
gcccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctgatgaactcttccaagggggccccaa
ctggggccgccttgtggccttctttgtctttggggctgctctgtgtgctgagagtgtcaacaaggagatggagccactgg
tgggacaagtgcaggagtggatggtggtctacctggagacgcggctggctgactggatccacagcagtgggggctgggcg
gagttcacagctctatacggggacggggccctggaggaggcacggcgtctgcgggaggggaactgggcatcagtgaggac
agtgctgacgggggctgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|G3TVG9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Loxodonta africana GN=MCL-1 (length=723 residues).
ggagcccagggccccagcgtcaccgcgacccctgcgaggcccatgctctttgcatccatcccctgcacgtcgccgcctga
ggaggcgaatgcctcagttgcggaggccatcatgtcagctgaagaggagctgggcaggtacaagctggagacgctgggga
agcggccagctgcccttcccctgctggtgcttgtgggggaagccagtaactgccctggtacgcacggggcacttccctca
acgcagcccccagcagaggaagaagaagacaagttgtacccgcaatcgctggatattatctttcggtaccttcacgagca
ggccatcggcgccacccagggccgccagctggaaggggtgagaaacctgccgcgggtcgcagacggtgtgcagcgcaacg
aggagacggtctcccaaggcatgcttcggaaaccggacttcaaaaacgaaaatgatgtgaaatctttgtctggagcgatg
gtccatgttttcagtggtggaataacaaaatggggcagaattgtgactatatcttttggtgcctttgtggtcaaacactt
cgggagcataaaccaagaagctgcagcagaatgtatcacagatgttctcctaaggaaacggtactgcttagacaaacgaa
ggggcggggatgggcttgtggagttcgtccacgtaaaggacccacagggcgactgtagaaatgtgcagctggcttttgca
ggt
>gnl|bcl2dbcds|A0A667GHH0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Lynx canadensis GN=BCL-2 (length=696 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccggggccgcccccgcgccgggcatcttctcctcccagcccgggc
gcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgcgggccctgcgctcagcccc
gtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggagat
gtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatggag
tgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgagagatgtcgccc
ctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacgtggatccaagacaacggaggctg
ggatgcctttgtggaactgtacggccccagcatgcagcctctatttgatttctcctggctgtccctgaaggccctgctca
gtctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A667GW69_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Lynx canadensis GN=BCL2L10 (length=573 residues).
atggctgacgcgttgagggagcgccgcctattgactgactacctggagtactgcgcccgggaccccggcagccccgcgcg
gacgccgtccacgcccgaggccgcggtgctgcgctacctggccgcccagatacggcagcgccaccagcgtttcttgtcgg
cttaccgcggctaccgcggaaaccgcgtggaactggtggcgcggttggagcaggatttactctccaacccccaaaccctc
agctggggccatgtggtagcgctcttgaccttcgcggggacgctgctggagagaccgccgccggggacctacttgaacct
gacgccggcccagcaacaggagctggagtgggaggccaacgttggccaggactgccagcacctggtggctttgctctgca
atcggctcaccggacggcatcgcgcctggctggaggctcacgacggctgggatggcttttgtctcttcttctcacccatg
ctgccatcttcttggagaagactgctggtccaggctcttctgtcatgctttacagtaatgaccttaatctacttctggag
aagattattgtga
>gnl|bcl2dbcds|A0A667GXX5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lynx canadensis GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccac
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A667GXX5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lynx canadensis GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagcc
gaaaggcgttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccacgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A667HK09_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lynx canadensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcggccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A667HQV5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Lynx canadensis GN=BCL2A1 (length=525 residues).
atggcggacggcgagtttgggtacgttctcacgctgacccgggactatatgaagcacgttctgcaggggccccagcccgg
atcccacccaagcagagtatcccaagtgctacaagacatggccttctcggtccagggggaggtcgagaagaagttgaagc
cgtgcctggacaagttccacgtggtgtcggtagacacggccaggacgatattccaccaagtgatggaaaaggagtttgaa
gacggcatcattaactggggcaggattgtgactatatttgcgtttgagggcatcctcatcaagaagcttctccaggagcg
gatcgtcccagacgcggatgcgtttaaggtttcctactttgtcgccgagttcatcacgaaacacacgggagaatggatcc
ggcaaaacggaggctgggaaaacggctttgtaaggaagttcgaacccaagtctggctggctgacctttctggaagttaca
ggaaagatctgcaaggtgttgtctctcctgaagaactactactga
>gnl|bcl2dbcds|A0A667I624_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Lynx canadensis GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagcaggccctggggagggcccagcagctgacccactgcaccaagccatgcgtgcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagttgcatgtgacccctgggtcagcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggattcacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagcc
gagaagctaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactttgtgacaaatttagtggccatcctaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A667I624_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Lynx canadensis GN=BCL2L2 (length=918 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccgggccagaggaggaggaggagccgggactggtcgagggtga
cccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagccgaga
agctaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatcatg
tccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaagagct
ggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactttgtgacaaatttagtggccatcctaaagggt
ttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaagacaa
atcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgataccgtgc
ccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctacaggg
gccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5TKG9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L10 (length=570 residues).
actgtagagtccttgagaggccggaccatggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggg
gccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttcttctccgcct
accgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagccccggccccacc
tggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctggtggaagaa
gcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgctgagct
cgcggctcgcgggcagcaccgcgcctggcttcaggctcagggcggatggcttttgtcacttcttcaggagcccctttccg
ctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcggttatctctggacacg
attattatga
>gnl|bcl2dbcds|A0A2K5TMD1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K5TMD1_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2A1 (length=489 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaagaagaaaatg
gctttgtaa
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=1068 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagt
gaaattttaagcgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcaggga
gatggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggca
atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactat
ggtgcaacagcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatt
tagtggccatcccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagt
ccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttt
ccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
ccggggtcgtgtctacaggtcaggatag
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=1161 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaag
cgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcagggagatggaggaag
aagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccca
gtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatc
ccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttaga
ggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccg
ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtg
tctacaggggccgggctagagcgacatcatggtttctgtag
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=1167 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaag
cgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcagggagatggaggaag
aagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccca
gtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatc
ccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttaga
ggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccg
ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtg
tctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=1137 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaag
cgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcagggagatggaggaag
aagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccca
gtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatc
ccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttaga
ggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccg
ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtg
tctacaggtcaggatag
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-06 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=1041 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaagctaaa
ggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatcatgtccattg
aggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaagct
cactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcgta
tatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaaggcaaatcaagg
tgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgcccggacc
accaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctacaggtcaggata
g
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-07 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=789 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaag
cgactgtgactctgctccaagttccccagatctcgagtttgaagccgggcagtccgttcgggggcaaggttcacctgtca
cgaaacgagtgtcactccttcgaatctcgcgagccaatcagcatctgagactgggccactgcggtgaggcgatcggaaga
ttggtcctttccagtcgcctagctagggccaatcacggagcgtcctatacttcgcgggcccgcccgtag
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-08 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=552 residues).
atggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaa
tgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatg
gtgcaacagcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaattt
agtggccatcccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtc
cctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttc
cacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccc
cggggtcgtgtctacagggccgggctagagcgacatcatggtattccccttactaaaaaaagtgtgtattag
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-09 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=441 residues).
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
gatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccg
cgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggacacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5W0Y7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=1041 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacaccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccggca
cggtgattggcggaagcgccggcgcaagcccccgggccctcacgccagacgcccggagggtcgcgcggccgccgcccatt
ggcgcggaggtccccgacgtcaccgcgagccccgcgaggttctttgcgcccacccgccgcgcggggccgcttgaggagat
ggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggc
cggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcactaccctcgacgccg
ccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggccac
cggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgacgggttgggg
atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaa
tctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttgg
tgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc
tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggaccta
gaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagata
g
>gnl|bcl2dbcds|A0A2K5W0Y7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=591 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacaccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcagga
aggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
ctggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactg
gggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcg
aaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatggg
tttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagt
aggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5W0Y7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=804 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacaccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccggca
cggtgattggcggaagcgccggcgcaagcccccgggccctcacgccagacgcccggagggtcgcgcggccgccgcccatt
ggcgcggaggtccccgacgtcaccgcgagccccgcgaggttctttgcgcccacccgccgcgcggggccgcttgaggagat
ggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggc
cggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcactaccctcgacgccg
ccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggccac
cggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgacgggttgggg
atggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagaggacctagaaggtgg
catcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatagccttact
gtaa
>gnl|bcl2dbcds|A0A7N9CNB8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgccgcc
gccgtcgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|I7G687_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcagcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgtttttagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|I7GKS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=447 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctggcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtc
gcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcgg
atcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgt
ggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatga
ctgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|Q2PFS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=570 residues).
atggagacccccagtgccatcaatggcaacccatcctggcacctggtggacagccccgcggtgaatggagccactggcca
cagcagcagtttggatgcccgggaggtgatccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttg
aactgcggtaccggcgggcgttcagtgacctgacatcccagctccacatcaccccagggacagcatatcagagctttgaa
caagtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtg
cgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacc
tagagccttggatccaggagaacggcggctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccga
aagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcag
tcggaaatga
>gnl|bcl2dbcds|A0A5F7ZJK5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A5F7ZJK5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A5F7ZJK5_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A5F7ZJK5_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A5F7ZJK5_BCL2L1-05 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=666 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctggagtcttgctgtgtcgcccaggctgaagttcagtggcgcaatctcagctcactacaagctccgcctcccgtgttcac
gccattctcctgcctcagcctcctga
>gnl|bcl2dbcds|A0A5F7ZZ15_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL-2 (length=726 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgccgccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctc
ccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgcca
cggtggtggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgt
gtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacct
gcacacctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatt
tctcctggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccac
aagtga
>gnl|bcl2dbcds|F7E8V5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|F7G4L5_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|F7G4L5_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|F7G4L5_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggttcgggagcccccggcagccaagaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
gatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccg
cgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|F7H6U5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|F7HUE9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca mulatta GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcgtcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6B2D9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaagaccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K6CIX3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca nemestrina GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6DS18_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctctctcttctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K6DS18_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtacgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaagaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K6EA59_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggttcgggagcccccggcagccaagaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
gatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccg
cgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K6EA59_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K6EA59_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L2 (length=813 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggaccaagaggaggaggaggagccgggactggtcgagggtgacccgggggacggcgccattgaggac
ccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaagctaaaggagctacagaacgaggt
agagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
atgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaagctcactttcatggctgtgga
tcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcgtatatagagttctcagacaa
agagtcagtgaggacttccttggccttagatgagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaacca
acagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgcccggaccaccaactacaacagttcc
cgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctacaggggccgggctagagcgacatcatggta
ttccccttactaa
>gnl|bcl2dbcds|A0A2K6EA59_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K6ECQ5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6ECQ5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K6ECQ5_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C5TLV4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Malurus cyaneus samueli GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccagcgaggacagggcacccctgcctccaggtctctctgctcctgctgctgctgcggttgctgctg
ctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagccacacg
cccccggccgaggggctgcgccccgcaccccaggttgtccacctcgtcctgcgccaggcgggagacgagttctcccgacg
ctaccagagggactttgcccaaatgtctggccagctgcacctcacgcccttcacggccaggagccgcttcgtggcggtgg
tggaggagctcttccgagatggggttaactggggcagaattgtggccttctttgagttcggcggtgtgatgtgcgtggag
agcgtcaaccgggagatgtctcccctcgtagacaacatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaatggaggctgggatgcctttgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcatatcttggacataagtag
>gnl|bcl2dbcds|A0A8C5U1E1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Malurus cyaneus samueli GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgacatggacggtgtcctcaatgggagcccctcct
ggcacgcacccaccagccacatagtgaacggagccaccgtgcaccggagcagcctcgaagtccatgagatccgtcgagca
gccgacgtgaggcaggcactgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctcttttggtggagccttgtgcgtggagagtgttgtcaaggagatgcgggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctgacag
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C5X4L3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Malurus cyaneus samueli GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacctcgctcaagattacctgcagtatgtgctccaggaatcccacctcgc
accagcccagaccagggttgctcacgtcttgagaagcatcgcatcttccctgcaagagcaaaccgaggaggctctcaggc
cactcctggacaccattgacatcacctctgtagctgctgccaagagaattttcaacggagtcatggaagaaaagtttgct
gatggaaatactaactggggacgaattatgaccatatttacatttggaggtcttctcaccaagaagcttcaagagcacgg
ggttcagctgactgcagaggagaaggaggagatctcttatttcatcacagagtacatcataaacaacaaagctgaatgga
ttgatgcgaacggtggctgggaaaacggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gccctgtttatagctgttgtctccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A2K5XRD4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggtcgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccactgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K5XSB2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5XSB2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K5XSB2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggacacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6AD27_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtatgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacactggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctctctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2K6AD27_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctagctcaggactatttgcagtatgttctgcagataccacaacctgg
atcgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcgtattttgttgctgagttcataatgaataacactggagaatgga
taaggcaaaacggaggctgggggaaatggcacaatcacatgcctatgctagtagagtcagtggcccacaggaagaagaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K6AI25_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K6AI25_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
ggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K6AI25_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L2 (length=537 residues).
atggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaa
tgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatg
gtgcaacagcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaattt
agtggccatcccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtc
cctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttc
cacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccc
cggggtcgtgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8C5YJP3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Marmota marmota marmota GN=BCL2A1 (length=528 residues).
atgaatgactgtgagttcaggttcatccacatgctggctcaggactacctgcagcacgtcctgcaggtaccgcaacgtgg
gtcaagtcccaacaaaacgtccaaagtgttacaaaacgtggctttctcagtccaaaaagaagttgaaaagaatctgaaac
catacttggacaattttgatgtggtgtctgctgatactgccagaacaatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcatgaactggggaaggattgtgaccatatttgccttcggaggagttctggtcaagaaacttctgcgagagcg
gattgcccctgctgtggattccgacgtggagatctcttactttgtggctgagttcattatgaataatgcaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggttgacttttctgggagtt
acagggcagatctgtgagatgctgtctctcctgaagcaatactattga
>gnl|bcl2dbcds|A0A8C5YLY6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Marmota marmota marmota GN=BCL2L1 (length=606 residues).
atagagagttgtggtaggacaggaaggaacctggaactagtgatggactttctgtcctacaagctttcccagaaaggata
ccgctggagccagtttagccgtgaggaagagaaccgcgttcaagccccagaaagggctgaatcagaagaggggcccagca
atgccaccagcggcaacccatcccggcatcagggggacagtcccatggtgagtggagccgctggccataacaggagtttg
gatgcccccgacgtggtccccatggtagcagtgaagcaagcgatgagggaggcaggcgacaactttgaagggcggtaccg
gcaggcattccatgacctgacagcagagctccgcctcaccccggagacagcacatcacacttttgaacaggtagtggacg
aactcttccgggatgaggtaagctggggtcgcattgtggcctttttcttctttggaggagcactgtgcttggaaagcata
gacaaggagatgaaggtgttggtgtgtcagatcgcaagttggatgaccacttacctgaatgatcacctagatacttggat
ccaggaccacggcggctgggacacttttctggcttgtcttatctga
>gnl|bcl2dbcds|A0A8C5YTS1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Marmota marmota marmota GN=BCL-2 (length=687 residues).
atggctcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcacagagggg
ctacgagtgggatgctggagacgtgggcgctgcgtccccaggagccgcccccgggccgggcatcttctcttcccaaccgg
gnnnnnnnccggccgccaggacctcgcccccccggccccccgctgccgccgcggggcccgtgctcagcccggtgccacct
gtggtccacctgaccctccgccaggccggcgatgacttctctcgtcgctatcgtcgcgacttcgccgagatgtccagtca
gctgcacctgacccccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatggggtgaactggg
ggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggac
aacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctt
tgtggagctgtatggccccagcgtgcggcccctgtacgacttctcctggctgtctctgaagactctgctcagcctggccc
tggtgggagcctgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A8C6EVC2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Marmota marmota marmota GN=BCL2L10 (length=552 residues).
atggcagacctgctgcaggagcgcaccgccgagctgctgaccgactacctggagtactgtgcccgggagccgggcacccc
cgagccgccgccgtccactcccgaggccgccctgctgcgctccgcggccgcccggttacaacagcaatacgagcccttct
tctccctctaccgcgggcacccaggtaaccgtgtcgagctgatggcacagatggcagaggctgttctttccgacaaccag
gccctcaactggggccgtgtggtgatgcttgtgaccttcgcagggacgctgctggagagaaagcctcaggacacccacgg
gccgcacacccgggaccaagctgccctggactgtcagcgtctcgtggacttgctctgtgctcagctcgtggggcggcacc
gcgcctggctggaggctcaaggcggctgggatggcttttgtgacttctttaggacacccttgccactaacgttttggaga
aatcttctggtccagatttttatgtcgtgccttttagcaactatcttcatctatttctgcaaacgattttaa
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgccataaactctccaaacgcggctacgtgtggggatt
tcataacgtccaggatgaagatgctgctaataatggctctgtagttgcccctccgccgactgtggtccgccggtgccgtg
acgcgagcaccgggcccgacagcgagagcatcccccagctctgcagagggctccctcagtccgacccacaagccgccatt
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtatcagccggactttacggagatgtcgcgacagctgta
tctcacctccaccacggcgcagaggcgattcgccgaggtgatagatgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggcggcaccgtgtgcgtggagtgcgcggccaaggaggagatgacatcgcaagtggacaac
atcgcggagtggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcctttgt
ggagatgtatgacaggcagagggagtctgtcttcagttgttcctggccctccatcaaaacagtcttcggcctggctgcac
ttggggcagctagcattactatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=1017 residues).
atgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctaca
ggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgcc
attaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaaca
ggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtgg
aggtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccatg
aaggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatactc
cccatccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtgg
cctacccgccagacacagacactccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctgaa
acatctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaacagttccgt
gggacctgatggttacatgctctctgccctcacctgtggaatgtcacctgtcacgtccatcacagaagctctccagcagg
atgcctttgtggagatgtatgacaggcagagggagtctgtcttcagttgttcctggccctccatcaaaacagtcttcggc
ctggctgcacttggggcagctagcattactatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=1080 residues).
atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcatcaactcctggtggctccttcttcccttcat
catgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctac
aggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgc
cattaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaac
aggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtg
gaggtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccat
gaaggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatact
ccccatccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtg
gcctacccgccagacacagacactccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctga
aacatctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaacagttccg
tgggacctgatggttacatgctctctgccctcacctgtggaatgtcacctgtcacgtccatcacagaagctctccagcag
attattaccatggggttatttcggaccatcgccctcttctacctggggagttttgacagcattgtacgccgctgcatgat
tcagagggagcagtcaaaatcagctgacaagagggagtaa
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=1077 residues).
atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcatcaactcctggtggctccttcttcccttcat
catgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctac
aggcaaggagcgttcatcactctggtggcacgagatgagccgatgccatttaacttaaggtttcataagactgtgtacaa
tttcttaattcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaacagg
ctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtggag
gtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccatgaa
ggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatactccc
catccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtggcc
tacccgccagacacagacactccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctgaaac
atctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaacagttccgtgg
gacctgatggttacatgctctctgccctcacctgtggaatgtcacctgtcacgtccatcacagaagctctccagcagatt
attaccatggggttatttcggaccatcgccctcttctacctggggagttttgacagcattgtacgccgctgcatgattca
gagggagcagtcaaaatcagctgacaagagggagtaa
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=1059 residues).
atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcatcaactcctggtggctccttcttcccttcat
catgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctac
aggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgc
cattaatgacaagcaggtatgggtttatttgagtagaagtgacttttttgctgttgtgcaggctcaagaaaagctgggac
ctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtggaggtggaccgttttaaaaaa
ctgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccatgaaggaacgcagaatgggccg
catcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatactccccatccaagtttgccctgc
gaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtggcctacccgccagacacagac
actccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctgaaacatctggcgtttgtcaacc
agagcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaacagttccgtgggacctgatggttacatgc
tctctgccctcacctgtggaatgtcacctgtcacgtccatcacagaagctctccagcagattattaccatggggttattt
cggaccatcgccctcttctacctggggagttttgacagcattgtacgccgctgcatgattcagagggagcagtcaaaatc
agctgacaagagggagtaa
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=807 residues).
atgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctaca
ggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgcc
attaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaaca
ggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtgg
aggtggaccgttttaaaataaagccgtacaacatctatgtgaccgtggcctacccgccagacacagacactccaggattg
gctgaggaaaataagacaaagcctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccagagcaagtggc
caaaattgttgtgcgagatgcagtacaggggaacttcaacagttccgtgggacctgatggttacatgctctctgccctca
cctgtggaatgtcacctgtcacgtccatcacagaagctctccagcagattattaccatggggttatttcggaccatcgcc
ctcttctacctggggagttttgacagcattgtacgccgctgcatgattcagagggagcagtcaaaatcagctgacaagag
ggagtaa
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-07 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=990 residues).
atgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctaca
ggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgcc
attaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaaca
ggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtgg
aggtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccatg
aaggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatactc
cccatccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtgg
cctacccgccagacacagacactccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctgaa
acatctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaacagttccgt
gggacctgatggttacatgctctctgccctcacctgtggaatgtcacctgtcacgtccatcacagaagctctccagcaga
ttattaccatggggttatttcggaccatcgccctcttctacctggggagttttgacagcattgtacgccgctgcatgatt
cagagggagcatgacacagctcttccgtag
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-08 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=936 residues).
actcatctattggacctttgggtttatgatctcctgactcttttgaactttcaggtgacaggaggctcaagtggaattgg
gaagtgcatcgcgatcgagtgctacaggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaag
caaaaaaagaggtggagaaatttgccattaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattat
aatcaggtggaaagtgtgataaaacaggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatc
tgtttctggaaagtttgaggaagtggaggtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatc
caactcgggccgtcataaccaccatgaaggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagatt
ggcctgtttggatacactgcatactccccatccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaa
gccgtacaacatctatgtgaccgtggcctacccgccagacacagacactccaggattggctgaggaaaataagacaaagc
ctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgca
gtacaggggaacttcaacagttccgtgggacctgatggttacatgctctctgccctcacctgtggaatgtcacctgtcac
gtccatcacagaagctctccagcagattattaccatggggttatttcggaccatcgccctcttctacctggggagttttg
acagcattgtacgccgctgcatgattcagagggagcatgacacagctcttccgtag
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-09 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=894 residues).
atgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctaca
ggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgcc
attaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaaca
ggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtgg
aggtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccatg
aaggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatactc
cccatccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtgg
cctacccgccagacacagacactccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctgaa
acatctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgcaattattaccatggggttatttcggac
catcgccctcttctacctggggagttttgacagcattgtacgccgctgcatgattcagagggagcagtcaaaatcagctg
acaagagggagtaa
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-10 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=525 residues).
atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcatcaactcctggtggctccttcttcccttcat
catgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctac
aggcaaggagcgttcatcactctggtggcacgagatgagcctggttgtctttatagccaggtgaaaaacgctcaagaaaa
gctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtggaggtggaccgtt
ttaaaattattaccatggggttatttcggaccatcgccctcttctacctggggagttttgacagcattgtacgccgctgc
atgattcagagggagcagtcaaaatcagctgacaagagggagtaa
>gnl|bcl2dbcds|A0A3Q3MX20_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagggaactggtggttttctacataaaatataaactctcccagagaaactatcctctcatctacataga
actcaatgagcaacagaacaggactgatgggggagaggctgagtcaggtgaggaacagcggatagcaacgcatgccaacg
ggacttttaatggcacaagtcctgggacccccccagcgtccccgctgcgacaagaacatttgcagtccacggcaagcctg
gatgcagtgaaagaggccctccgggactcagccaacgagtttgagctacgatacgcccgtgctttcagcgatctgcacaa
ccagctgcatatcacgccagccacggcctaccaaagcttcgagagtgtgatggatgaagtgttccgggacggtgtcaact
ggggtcgcatcatagggctttttgcattcggcggggctctgtgtgtcgagtgtgtggagaaggagatgagtccactggtg
ggcaggattgtggagtggatgaccctctacctggacaaccacattgagccctggatccaaagccagggaggatgggagca
ctttgctgaaatctttgggcaggatgcagcagcagagagcaggaggtcccaagagaatttcaagaagtggctgctggcag
ggatgacgctggtgactggggtcgtggtgggttcacttattgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q3NFM4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL2L1 (length=666 residues).
atgtcgtacagtaacagagagctggtggagttctttattagctacaagctgtctcagaagaactacccgacctctctgct
gaggccagaagatgctggtggaaggacagagggagacatgaccggtgcagctgccaccaacggcttgctggtcaacagca
ggtatgtcagcggccggccggggatgtcatcatccccacatggaggcgtagaggctgtaaaggcagctcttagggactcc
gctgaagagtttgaactgctcttcactcaggcgtttagtgacctttcctcacagcttgacatcactcctgacacagctta
ccacagctttaaaagcgtgatggatgaggtgttcaaggatggagtcaactggggacgcatagtgggcctgtttgctttcg
gtggtgtactgtgtgtggaatgcattgagaagaacatgagtgcgctggtgtcccgcatcgcagattggatgaccatgtat
ctggatgagcacatcagtccgtggatcgagagccaaggaggctgggactgctttgctgagatttttgggcgagatgcagc
tgcagaagcaaggagatcacaggaaaccctgaggaggtggctgctagttggagtggcgctgctaacgggagtgctgatag
gtgtgctcatcgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q3S6A5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mastacembelus armatus GN=MCL-1 (length=891 residues).
atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcatgatcgtccttccccaagatggagtcctgga
gggacccgtgcactacgactccagagatccctccacacagtttaccttggactctcgcaacgggaacggcgggacggcta
atccgaaaagacccaagaacctggaagtcagctccacaaacgggtacgcgacaaaatccatcgtggccgacacggacgac
atagaggacgggtcgttaccctgcaccccggagctgcagtcggacagcgaagcccccagctgcccggccggggacgaggt
cctggagaacgacaccaggcagctcatctgtcaatacctgaaagacgtttctggactttctaaaccccggtggcacgact
ccaaagcactgtcgacaatgaaacgagttgtggaagaccttttggaaaaatacagatacacatacaatggtatgatcaac
aaactgtccttggacgacagaggtgatgatgtgagattcgtcagcactgtagccaagagcctgtttgctgatgggaccac
caactggggtcggatcgccagcctggtggccttcggggccgtggtgtgtcagtacctgaaggagaaaggcaggggggact
gtgtggagctggtggggcaggagatctccacctacctgctgtcagaccagcgggactggctggtcaaaaacaactcctgg
gatggctttgtagagttttttcgagtagcagacccagagtccacggtgaggcacacactgatggctgttgctggtgttgc
tggtcttggggcaactctggccctgttgatcagcagaaataataaaatgctgacttctcaaagtgccatcagcgcgcctg
tctcagcatag
>gnl|bcl2dbcds|A0A3Q3S6A5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mastacembelus armatus GN=MCL-1 (length=852 residues).
atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcatgatcgtccttccccaagatggagtcctgga
gggacccgtgcactacgactccagagatccctccacacagtttaccttggactctcgcaacgggaacggcgggacggcta
atccgaaaagacccaagaacctggaagtcagctccacaaacgggtacgcgacaaaatccatcgtggccgacacggacgac
atagaggacgggtcgttaccctgcaccccggagctgcagtcggacagcgaagcccccagctgcccggccggggacgaggt
cctggagaacgacaccaggcagctcatctgtcaatacctgaaagacgtttctggactttctaaaccccggtggcacgact
ccaaagcactgtcgacaatgaaacgagttgtggaagaccttttggaaaaatacagatacacatacaatggtatgatcaac
aaactgtccttggacgacagaggtgatgatgtgagattcgtcagcactgtagccaagagcctgtttgctgatgggaccac
caactggggtcggatcgccagcctggtggccttcggggccgtggtgtgtcagtacctgaaggagaaaggcaggggggact
gtgtggagctggtggggcaggagatctccacctacctgctgtcagaccagcgggactggctggtcaaaaacaactcctgg
gatggctttgtagagttttttcgagtagcagacccagagtccacggtgaggcacacactgatggctgttgctggtgttgc
tggtcttggggcaactctggccctgttgatcagttactgtggtgtaatgtga
>gnl|bcl2dbcds|A0A7N8WMH7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL2L10 (length=585 residues).
atgtcgtgtgggctgtggaaagagaccctggctctggcagaggattacctgtccctgtgctgcacaagcccacagtcagt
ccctccacctcccagcgagtcagctgctgccatgagatgtctggcccagaaaatggagaggcagcaccaggctcgcttcc
actccctcactcagactttcctgaagcagtgcgggccggacccctgctccagcctcaggaaggttatagaggagctggtg
gcagatggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctgtccagacagctgatggagca
gaagggcatgaagccagggctggactctggaaaggggcaggaattgggacaggggcctgagagctgcaggggactggcag
agaccatagctgattacctgggagaggagaagaaagactggctgcaagagaatgacggatgggaagggttctgcaagttc
tcccacagcgccagagaggtcagccacgactcatccatgaagacagcgctgtttgctgctgctggagtgggtcttgctgg
actcaccttccttctggtgcgttag
>gnl|bcl2dbcds|A0A3P9BLI0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Maylandia zebra GN=BCL2L10 (length=822 residues).
atgatttatggattatttgtcacccttttttgtaccataccaaaccatgaccacacttccgctggttattccgtggcggt
ggtgtcttctttccacagtccacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcattctgcatcag
ctgaagggaagactcaactgtaccgacgctctccttccgccgtctgtatgtgcagagagcagtctgatatcgctgggagg
aaaatgaaattctgtgggctgtggaaagagaccctggttttggccgaggactacctgtccttttgctgcacgagtccaca
tcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc
gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaaggag
ctggttggagatggacacttgaactgggggagggttgtttctcttttcgcctttactggagtgctggccagaaagatcct
ggagcagaagccggggctggaccctcgtcaacagcaggaactgggacaggagcccatgagctgcagaaggctggcagaga
ccatagctgattacctgggagaagagaagaaagactggctgttggataatgatggatgggaaggcttctgtaagttctcc
cgcagtgccagagaagtgagccaggactcatccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct
taccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A3P9BVM3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Maylandia zebra GN=MCL-1 (length=837 residues).
atggccaactatatgatgttgaaaaggaaccagtgtaccctaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatctggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccagagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcttttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaattacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagttgctgggatgcattattgtga
>gnl|bcl2dbcds|A0A3P9D632_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Maylandia zebra GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3P9D632_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Maylandia zebra GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3P9DIG5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Maylandia zebra GN=BCL-2 (length=687 residues).
atggagaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcgggggttcgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggtccaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctcctccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttattgctttcttcgagtttgggggcactgtgtgcgtggagtgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagttgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagcctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|G1MPY7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Meleagris gallopavo GN=MCL-1 (length=519 residues).
atggaggtggggtccctgctctgctcattctgtggcagggcctgcagcagcagctgctctgtcacagctttcagacccca
ggtacagaggctgtgtcctctcactggtggcttggcatggctcagcccgtctctaagctggaatctcttttcaggaatgc
ttcggaagctggaaatcaaaaaagaagaagatctgcaggcggtgtgtgaggtggctgctcacgttttcagtgatggagta
acaaactggggccgagttgtcacactcatctcatttggtgccttcgttgcaaaacacctgaaaagcatcaaccaagagaa
atgcatcagctcgctggcggggatcatcacagacgctttggtctcatccaagcgcgagtggctgatgagccagggaggct
gggagggctttgtcgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtg
gccggcctgggggcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|G1MZW1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL-2 (length=660 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccacccgtgcccccggccctggctcccactgctgctcccgctccccccggct
cggctgctgctagtgaggtgcccccagctgaggggctgcgccccgcacctcccggcgtccacctcgccctgcgccaggcc
ggggatgagttctcgcgccgctaccagagggactttgcccagatgtcgggccagctgcacctgacgcccttcacagccca
cggccgcttcgtggccgtggtggaggagcttttccgtgatggggtcaattggggccggatcgtcgccttctttgagttcg
gcggcgtgatgtgcgtcgagagcgtcaaccgggagatgtcgccgctggtggacaacattgccacctggatgaccgaatac
ctgaacaggcacctgcacaactggatccaggacaacggaggatgggatgccttcgtggaattgtacggcaccagtatgag
gcctttgtttgatttctcctggatctctctgaagaccatcctgagcctggttctggtgggagcttgcatcactcttggcg
cttatcttggacataagtag
>gnl|bcl2dbcds|G1N5N5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagcagaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccgcctgccggccacgtagtgaatggagccgccgtgcacaggagcagcctggaagttcatgaaattgttcgagcatct
gacgtgaggcagacgctgagagatgcaggggatgagtttgagctgaggtaccggagggctttcagcgatctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaacgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagacccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|G1N8C5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattatgtttattatttagctcaagattatctgcaatatgtccttcaggaatcacgtcttgg
accagcccaaaccagagttgctcatgtcttgcgaaatattgcatcctcactccaagatcagacagaggaggcactcagac
ccttcttggacaggatcgatatcacctctgtagatgttgccaagagaattttcaatggagtcatggaagaaaaatttgct
gacggaaatactaactggggacgaattatgaccatatttacttttggaggtcttctcaccaagaagcttcaagagcaggg
agttcagctcactggagaggagaaggagcagatttcttatttcatcacagagtacatcataaataacaaagccgcatgga
tagatgcaaacggtggctgggaaaatggtttcctaacaaagtttgaaagaagatcaccactatctttctctacaattaca
gacatatttgcagctgttttttccttgttcagagactactactga
>gnl|bcl2dbcds|A0A8B7FJ73_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctggggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagccccgggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgggtcagggagatggaggaagaagctg
agaagctaaaagagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatt
atgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgctaccg
tgcccggactaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgagtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8B7FJ73_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaaaggtta
tgtctgtggagctggcccaggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgtaccttctctgatctggcagctcagctgcatgtgaccccaggctcagcccagcagcgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgggtcagggagatggaggaagaagct
gagaagctaaaagagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
tatgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgctacc
gtgcccggactaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgagtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8B7FJ73_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L2 (length=813 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctggggaccaggaggaggaggaggagccgggactggtcgagggtgacccgggggacggcgccattgaggac
ccggagctggaagctatcaaagctcgggtcagggagatggaggaagaagctgagaagctaaaagagctacagaacgaggt
agagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgattatgtccattgaagagaaaatggaggctg
atgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaagctcactttcatggctgtggt
tcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
agagtcagtgaggacttccctggccttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaacgaacca
acagaccaggcatcagcacaacagaccggggtttcccacgagcccgctaccgtgcccggactaccaactacaacagttcc
cgctctcgattctacagtggttttaacagcaggccccggggtcgagtctacaggggccgggctagagcgacatcatggta
ttccccttactaa
>gnl|bcl2dbcds|A0A8B7FJ73_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaaaggtta
tgtctgtggagctggcccaggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgtaccttctctgatctggcagctcagctgcatgtgaccccaggctcagcccagcagcgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggcctttttcgctagcaagtga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tattgatgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcactctagcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tattgatgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcactctagcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tattgatgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcactctagcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=438 residues).
atgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggcaaccca
tcctgcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacactttcgtggaactcta
cgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggttcctgacaggcatgactgtggctg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccactgcccggcgagaggtagggggaggggaagccg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagacgcccggagggtcgcgcggccggcg
cccattggtgccgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgcccacccgccgcgcggtgcc
gcctgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccggcacggaagggtcacta
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccactgcccggcgagaggtagggggaggggaagccg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagacgcccggagggtcgcgcggccggcg
cccattggtgccgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgcccacccgccgcgcggtgcc
gcctgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccggcacggaagggtcacta
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaatcaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgagattggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagca
ggaaggcgctagagaccttacgacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaa
ctggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaatcaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagattggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8B7H1C6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Microcebus murinus GN=BCL-2 (length=711 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagaagcgagcgctgcgcccccgggggccgtccccgcacctggcatcttctcttcccagcccg
ggggcaccccccctcccgctgcgcctcgggacccggccgccaggacctcgcccccggccgcccacgccgctgccgcgggg
cctgcgctcagcccagtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggacgccttcgtggaattgtatggccccaacatgcggcctctgtttgatttctcctggctgtctc
tgaagactctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaaatga
>gnl|bcl2dbcds|A0A8C5VB12_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2A1 (length=561 residues).
atgaagcagctccagaccctgctccccgccgggcggaagatgacgggctgcgagttcgaattcacccgagagctggccca
ggactacctgcagcatgtcctgcgggcgccgcagcccgggtccagccccagcgaggcgtcccgggtgctgcggagcgtgg
cctcctccgtccaaaacgaagtggaaaggagactggaaccgtgcctggacaatttcaacgtcgcctccgtagagacggcc
agagccatcttcagtcgcgtgatggagcaggagttcggggacggcgtcgtcaactggggaagggtcgtgaccgtgtttgc
gttcggaggcgtcctcaccaagagactcctgcgggagcgggcggccctggacccggacgcgtgcaagcagatttctcacc
tcatcgccgagttcgtagtgagccacacgggagagtggattcggcagaacggaggctgggagcacggcttcgtgaagaag
tttgaacccaggcctgcctggctgacttttctggaagtcttggggaaggtctgtggcgtgctgtctctcctccactactg
a
>gnl|bcl2dbcds|A0A8C5VC33_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=426 residues).
ctctgtgtcttatatctcagttgtgggaaaaaggatcccatgtgtttcttcctatgtctggttagaaacgatgtcaaatc
tttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactctaatttcttttggtg
cctttgtggccaaacacctgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctt
gtaaggacaaaacgagattggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctcga
aggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtagcagctggtttggcatatctaatagatagcc
ttgtatgtgcagtaatgggcttctaa
>gnl|bcl2dbcds|A0A8C5XEX1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L10 (length=579 residues).
atgggcgacctgttcagggagcgcacggagcggctgctggccgactacctggagtactgcgccagggagccgggcacccc
ggggctgccgccgtcctcgctggaggcggccgcgctgcgcctcgcagccaccaagattcggcagaagcacgcgtctttct
tctcggcctacgtgggctacccggggaaccgcgtctccctgatggagcggatggcggaggccgtgctctccgacagcctc
agctggggccgcgtggtgatgctcctgaccttcgcggggacgcttctagagagagggccgcgggtgaccgcctggtggag
gaagtgggacctcaagccgcagctgaaggagggggatcccgaagtcgcccgggactgccagcgcctggtggccctgctga
gcgcttggctcgcggggcagcaccgcgcctggctgcaggcgcaaggtggctgggatggcttttgtgacttattcaggaaa
cccttaccactagctgtttggaggagactgctggcccaggttcttttgtcatgctttttagcaacgaccgtcatctattt
ctggacacgattattatga
>gnl|bcl2dbcds|A0A8F0MQ26_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Miichthys miiuy GN=BCL2L1 (length=699 residues).
atgactcaaaacagagaactggtgattttctatataaactataaactctcccagaggaactatcctctcaactacatggg
actcagagagcctccgaacaggactgatgaaggggaggctggggtgggtgaggaacagcgggtagcaacgcacgccaacg
ggacttttaacggcacgagtcccggtacccctccaggatccccgccgcggcagcaacagccggcgtcagcgacgagcatg
gacgcggtgaaagaagccctccgggaatcggccaacgagttcgagctgcgatacgcccgcgccttcaacgacctgcacaa
ccagctccacatcacgccggctacagcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggagtcaact
ggggccgcatcgtggggctgttcgctttcggcggggcgctgtgcgtcgagtgcgtggagaaggagatgagcccgctggtc
agcaggattatcgagtggatgacggtctacctagacatccgcattcagccgtggatccagagccaaggaggatgggagcg
cttcgccgaaatcttcgggcaggacgcggcggcggagggcaggaggtctcaggagagcttcaagaagtggctgctggcgg
ggatgaccctggtgaccggggtcgtggtgggctcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q3VI28_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mola mola GN=BCL2L10 (length=591 residues).
atgtcgtgcgggctgtggaaagagaccctggctctcgcacaggactacctgtccttgtgctgcacaagccagcggccagc
ccctccacctcccagcgagtcagccgctgccatgagggacctggctcaggacatggagaagcaacaccaggctcgcttcc
actccctggctcagaccttcttgaggcagtgcgggacggacccatgctccagcctcaggaacgtgatggaggagctggtg
ggagacggacacttgaactgggggagggttgtttccattttcacctttactggggtgctggccagacaactgctcgaaca
gaagagcacaaagccggggctggaacccaggcaggaccaggaccaggaactgggacaagtgcctggtaattgcagtgaac
tggccgagaccatagcagactacctgggagaggagaagaaagcctggctcctggagaacgacggatgggaggggttctgt
aagttctctcactctgccagagaggcaaggctggactcatcgatgaagacggccttgtttgctgctgctggtgtgggtct
cgccggtctcaccttcctgctggtgcgctag
>gnl|bcl2dbcds|A0A3Q3VP02_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mola mola GN=MCL-1 (length=789 residues).
atgaacgtgttgtttcaaaatggagtcgtgtcgggaccgacgcgttcctcgcaaatcgggatgggctcctgtctagactc
tcacaacggtaatgtcgctttaaacgatacctccaaacggcctaatttactagtagtgaacccaacgaaggaatatatgg
gaaaacccatccgaaaagacagcaccgacaccgacgacgacggttcgctgccgtacacgccggatatgtccccggacagt
gaactcaacgtctccggttgtttggcgggggatgaactgttggagaaggacacgaggcagctcattagccgcgtcttgat
ggaactttctggacacggaagagcacgatggactgaaagcagaacactatcaacgatgaaaagagtcgtggccgagcttt
tggaaaaacacagatacgtatacaatggtatgacaaaaagactgtcattggctgacacacaggacaatgtgagttttgtc
agcactgtatccagagatctgttttcagatggagcaacgaactggggccgtattgccagcctggttgcctttggggtcgt
ggtgtcccagtgcctgaaggagaacggcaagagtgaccgtgtggagctggtggctcatgagatctccacatacctgttga
cagaccagcgggactggatgtgtgtgggcggtgatggctttgtcgagttctttcgagtagcagacccagaatccacggtg
aggaacgcgctcatgaccattgctggagttgctggtattggggcgacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3Q3WIW8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mola mola GN=BCL2L1 (length=693 residues).
atgtctgtaaacagagaactggtggcttactacataaactataaactctcccatagaggctgtcctctcaaccacatggg
actcatagagcctcccaacaggactgagggggggcaggcagtgtcagatgaggaacagcgggtagcgacacacgccaatg
ggacttttaacggtacgagtcccgggacccctccaaggtccccgctgcggctgcaaccgtcgacaacaagtctggacgca
gtaaaagatgccctgcgggactctgccaacgagttcgagctgcggtatgcccgcgccttcagtgacctgcacaaccagct
ccacatcacaccggccaccgcctaccaaagctttgagaacgtgatggacgaggtgttcagggacggtgtcaactggggac
gcatagtcggactcttcgctttcggcggtgcactgtgcgtagagtgcgttgagaaggagatgagtccactggtgggcagg
atcatcgagtggatgacggtctatctggacaaccaaatccagccctggatcgagagccagggaggatggcaacgctttgc
cgaaatcttcggacaggacgcggctgctgagagcaggaggtctcaggagagcttcaagaagtggctgctggccgggatga
ccctggtgaccggagtcgtggttggctcgctcattgtccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q3X5M5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mola mola GN=BCL2L1 (length=657 residues).
atgtcgcacagtaacagagagctggtggagttctttataagctacaaactgactcaaaagaactacccaacctctctgtt
aaggccagaagataccggtgggaggactgaaggagacaaggccagctctgctgccagaaatggcttgctggtcaacagca
gtagtaggggtggactgtctccttccacaggtgctgacatggaggctgttaagtcggcgcttagggactcagccaatgag
tttgagcagctcttcacacaagcgttcagtgacctctcctcgcagcttgacatcacccctgacacagcctatcacagttt
taagagcgtgatggacgaggtgttcaaggacggggtcaactggggacgtatagtgggactgtttgcctttggaggtgttc
tatgtgtggaatgtgctgagaaggatacaggtgagcttgtttgccgcattgcagactggatgaccacttacctggatgag
catattaatccgtggatccagagtcaaggtggatggggctgctttgctgaggtttttgggcacaacgccgctgcagaagc
aaggagatctcaggagactctgaatagatggctcctagtcggggtggcgctgctaatgggagttatggtcggtgtgttca
ttgctaagaaacagtaa
>gnl|bcl2dbcds|A0A5F8GAQ2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodelphis domestica GN=MCL-1 (length=1191 residues).
atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggcagggatgggcgccggcggcgg
cgccagcggtcccccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccgccgcagcgcg
atggaggggaagtggaaacagggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtcaccaccgatccgatgccgag
cctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg
aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaactatacgggca
gtccttggagctcatcagccggtaccttcgcgagcaggcggttggcacgaaggaggccaagcccctacgcagcggcaagg
ccttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg
caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttgaagagcataaaccaggaaagttgcatagacc
cgctagcagaaagcataacagatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctggaaaggcctc
cttgctcaagacacggaagaagccacccgaaccggcgatccctgcgccccctcctcggcatacctcctcctctgcgcaga
acccttgttctggtggtgccagctcacagcatcgggctgtcatgttccggataagcccaggaatgtgcttactgaggaga
gaaaatgggctgcctcgctgcaacgttctcacaacaaattctccacttcaatgataactcatggactctag
>gnl|bcl2dbcds|A0A5F8GAQ2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodelphis domestica GN=MCL-1 (length=1002 residues).
atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggcagggatgggcgccggcggcgg
cgccagcggtcccccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccgccgcagcgcg
atggaggggaagtggaaacagggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtcaccaccgatccgatgccgag
cctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg
aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaactatacgggca
gtccttggagctcatcagccggtaccttcgcgagcaggcggttggcacgaaggaggccaagcccctacgcagcggcaagg
ccttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg
caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttgaagagcataaaccaggaaagttgcatagacc
cgctagcagaaagcataacagatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctggtcagggaag
gagagagtggatccaagaggccttgtctcaggaggaaactga
>gnl|bcl2dbcds|A0A5F8GAQ2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodelphis domestica GN=MCL-1 (length=1068 residues).
atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggcagggatgggcgccggcggcgg
cgccagcggtcccccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccgccgcagcgcg
atggaggggaagtggaaacagggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtcaccaccgatccgatgccgag
cctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg
aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaactatacgggca
gtccttggagctcatcagccggtaccttcgcgagcaggcggttggcacgaaggaggccaagcccctacgcagcggcaagg
ccttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg
caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttgaagagcataaaccaggaaagttgcatagacc
cgctagcagaaagcataacagatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctgggagggattt
gtggaattctttcatgtacaggacctagaaggtggcatcagaaatgtgctgctcgcctttgccggtgttgctggagtagg
agctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A5F8HG85_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L2 (length=996 residues).
atggcgactccagcctcagccccagatactcgagccctggtggcagattttgtgggttacaagctgaggcagaagggcta
tgcctgtggaactggcccaggagagggccctacaacagagcccttgcaccgggccatgcgtgctgctggagacgagtttg
agtcccgctttcgacgcacattttctgatctggccgctcagttgcatgtgactcctggctcggctcagcagcgctttacc
caggtctcagatgagctcttccaaggggggcccaactggggccgtcttgtggcattcttcgtctttggggcagcgctctg
tgcagagagtgtcaacaaagagatggagccactggtgggacaggtgcaggactggatggtgacctacctagagacacagc
tggcagactggatccacagcagtgggggctgggagctggaggccatcaaagcccgagtaagggagatggaggaagaggca
gagaaattgaaggagcttcagaacgaggtggagaaacagatgaacatgagtccacccccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgatccatctatgtaggcaatgtggactatggtgcaacagcagaag
agctggaggcacacttccatggttgtggttcagttaatcgagttaccatcctttgtgacaagttcagtggccatcctaag
gggtttgcatatatagaattttcagataaagattcagtcaggacgtcgatggccttggatgattctcttttcagaggaag
acagatcaaagtgataccaaaacggaccaataggccggggatcagcaccacagatcggggttttccacgtgcccgatatc
gtgccagggctactaactacagtagttcacgctctcgattctatagcggcttcaacagcagaccccggggccgagtctac
aggggccgggctagagcgacgtcatggtttctgtag
>gnl|bcl2dbcds|A0A5F8HG85_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L2 (length=1002 residues).
atggcgactccagcctcagccccagatactcgagccctggtggcagattttgtgggttacaagctgaggcagaagggcta
tgcctgtggaactggcccaggagagggccctacaacagagcccttgcaccgggccatgcgtgctgctggagacgagtttg
agtcccgctttcgacgcacattttctgatctggccgctcagttgcatgtgactcctggctcggctcagcagcgctttacc
caggtctcagatgagctcttccaaggggggcccaactggggccgtcttgtggcattcttcgtctttggggcagcgctctg
tgcagagagtgtcaacaaagagatggagccactggtgggacaggtgcaggactggatggtgacctacctagagacacagc
tggcagactggatccacagcagtgggggctgggagctggaggccatcaaagcccgagtaagggagatggaggaagaggca
gagaaattgaaggagcttcagaacgaggtggagaaacagatgaacatgagtccacccccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgatccatctatgtaggcaatgtggactatggtgcaacagcagaag
agctggaggcacacttccatggttgtggttcagttaatcgagttaccatcctttgtgacaagttcagtggccatcctaag
gggtttgcatatatagaattttcagataaagattcagtcaggacgtcgatggccttggatgattctcttttcagaggaag
acagatcaaagtgataccaaaacggaccaataggccggggatcagcaccacagatcggggttttccacgtgcccgatatc
gtgccagggctactaactacagtagttcacgctctcgattctatagcggcttcaacagcagaccccggggccgagtctac
aggggccgggctagagcgacgtcatggtattccccttactaa
>gnl|bcl2dbcds|A0A5F8HG85_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcgaggctccgggccggggcggcggcgccatct
tgtgcccggggccgggggggagcccggggagggggccccgggcggcgcgggggactacgggaacgggctggaggcggagg
agctggagcctgaggaattgctgctagagccagagcccgagcccgagcccgaggaggagccgccccggccccgtgccccc
ccgggagcctccggccctgggcccggcgcaggagcccccggcagtcaggaggaggaggaagagccgggcctggtcgaggg
cgacccgggggacggcgctatcgaggacccggagctggaggccatcaaagcccgagtaagggagatggaggaagaggcag
agaaattgaaggagcttcagaacgaggtggagaaacagatgaacatgagtccacccccaggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgatccatctatgtaggcaatgtggactatggtgcaacagcagaaga
gctggaggcacacttccatggttgtggttcagttaatcgagttaccatcctttgtgacaagttcagtggccatcctaagg
ggtttgcatatatagaattttcagataaagattcagtcaggacgtcgatggccttggatgattctcttttcagaggaaga
cagatcaaagtgataccaaaacggaccaataggccggggatcagcaccacagatcggggttttccacgtgcccgatatcg
tgccagggctactaactacagtagttcacgctctcgattctatagcggcttcaacagcagaccccggggccgagtctaca
ggggccgggctagagcgacgtcatggtattccccttactaa
>gnl|bcl2dbcds|F6SFL4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2A1 (length=519 residues).
atggatgattacgagttccattatgttcacatgttagctcgggactacttgaagcatgttcaacagacaccaccactggg
atcatgtctaaataagacatctcaaatactacaaaaggttgctttctctgtccaacaagaagtagaaaaggatatggaaa
catgcttgagcactttggacatcgtttctgtagagtctgccagaagaattttcaatagtgttatgaagaaggaatttgag
gatggcgtcattaactggggacggattgtcaccatatttgcttttgggggaattctcatcaagaagcttctgagacatag
agctccactgactatgggcactcaggaagaaatttctcattttattgccgagttcataatgaacaatatagcagagtgga
taagacaaaatggaggatgggaaaatggctttgtaaagaactttgaacctaatacagtgtggccgaacttcacagatatt
tcaacaaagatctggggcatattttcctttctgaagtaa
>gnl|bcl2dbcds|F6VJQ0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L10 (length=570 residues).
atggattacaagtgtgctcttagggaagagacggcgcggctggtaactgactacctggaatattgttgccggagggaagg
cgtccaggagctgccggcccctacccctgctgcagctacactgcgtttggtgtcgagcgagctccgccagatttaccagg
acttcttcgagtgcgccctgaatcagctactcgaccgggaacctgagcaagtaatcgtcaacgtagcggagctcatggac
cgaggcgagttcaactggggccgggtggcggtgctagtggtttttgccggggcgctgctggagatggaggaactactgaa
agaggagcaggtactgcagcttcggagggaaacgagccggcgtctgaccgaaaaactctgcaactatctggtggagagga
agggcgcgtggctgcatgagaacggaggctggactggctttcaccaccacttcgaaaaaaggcaatctcctccaccaagt
gactcaagtaataatacactgtgctgcataatggcagcagcagcaggatttggactagtgggattagctcttttattagt
cgtacgataa
>gnl|bcl2dbcds|F6WA14_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L1 (length=684 residues).
atgtcgcacagtaaccgggagctggtgattgactttctttcttacaagctctcacagaaaggatacaattggagtcagtt
tgaagatgagaacaggactgaggttctagaaggggcagagatacctagtactgtgaatggcagtccctcttggcaccctg
ctgacagccgtgctgtgagtggggccacagggcacagcagcagcctggatgcccatgagacaataccagtggctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaacttcggtacaggcgggcattcagtgacctgacatcccagctcca
catcacgccaggaacagcttatcagagctttgagcaggtagtgaatgaactcttccgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaggagatggaagtcttggtaggacgcatc
acctcctggatggccacttacttggatgaccacctagacccttggatccaagaaaatggcggctgggacacctttgtgga
actttatgggaatgatgcagctgcagagagccggaagggccaggaacgcttcaaccgatggctgctgactggcatgacag
tggccggtgtagtcctgctggggtccctattcagccggaagtga
>gnl|bcl2dbcds|F6YNL8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Monodelphis domestica GN=BCL-2 (length=567 residues).
atgatggctcaccctggaagaagaggatatgataaccgggagatagtgatgaaatacattcattataaactgtcacagag
ggggtacgagtgggatgctggagatctgagggcaccagcctctccaagtcttcctcctgttgttgcttctgcccctgctg
ttggaatcttctctacccagccacgaaacacaccattgcctgctgctgctgctgctggacctaccgtcagtccagtgcca
cctgtggtccacctgactcttcgtcaagctggagatgatttctctagaaggtaccggagagactttgatgaaatgtcagg
tcaactgcacctgacccctgttactgctaggggacgctttgccacagtggtagaggagctgttcagggatggggtgaact
gggggaggatcgtggccttctttgagtttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcattgccctatggatgactgagtacctgaaccggcacctgcacacttggatccaggataacggaggatgggtagg
tgcctag
>gnl|bcl2dbcds|A0A4V5P8C2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodon monoceros GN=MCL-1 (length=1056 residues).
atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggggccggattgggaccggatagcggcag
cggcgcctccgctccgggaaggcggcttttggctgcaggaaaggaggccacggccgggcgagaggtagggggaggggaag
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggtctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccggagc
ctctagggaagcggccgtccgtcctgcctttgctggaattggtcggcgaggccagtaacagcccgggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgccagccggaaagcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggacttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggc
gtatctaataagatag
>gnl|bcl2dbcds|A0A4V5P8C2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodon monoceros GN=MCL-1 (length=597 residues).
atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggggccggattgggaccggatagcggcag
cggcgcctccgctccgggaaggcggcttttggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgcca
gccggaaagcgttagagaccctgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaac
aaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
cggagtaggagctggtttggcgtatctaataagatag
>gnl|bcl2dbcds|A0A8C6AXM8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Monodon monoceros GN=BCL-2 (length=702 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagacgcgggcgccacgtccccgggggccgcccccgcgccgggcatcttctcctcccagcctg
ggagcaccccagcgccatccaggacctccccgccgccgccccagaccgctcccgccgcccccgccagggggcctgcgctc
agccccgtgccacctgtggtccacctgaccctgcgccaggccggtgatgatttttctcgtcgctaccgccgcgacttcgc
cgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
atggagtaaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatg
tcccccctggtggacaacatcgccctgtggatgactgagtacctgaaccgacacctgcacacctggatccaggataacgg
aggctgggatgcctttgtggagctgtacggtcccagcatgcggcctctgtttgatttctcctggctgtctctgaaggcac
tgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C6BK57_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Monodon monoceros GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcggatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaaggggggcccaactggggccgccttgtggctttctttgtctttggagccgcgctgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagcgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C6F2V6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Monodon monoceros GN=BCL2L1 (length=702 residues).
atgtctcagagcaatcgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggacgagaacagaactgaggccccagaagggactgaatcagacatggaaacccccagtgccatcaatggca
acccgtcctggcacctggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacggcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctatgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C6FDW6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Monodon monoceros GN=BCL2A1 (length=528 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgccttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggaaaatggctttgtaaagaagtttgaacccaagtctggctggctgacttttctggaagtt
acaggaaagatctgtgaaatattatgtctcctgaagcagtactattga
>gnl|bcl2dbcds|A0A8C6CUC2_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgatccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagttgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgcgac
tggctgactggatccacagcagcgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtgaccgtagg
ggcctttttcgctagcaagtga
>gnl|bcl2dbcds|A0A8C6CUJ2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Moschus moschiferus GN=BCL-2 (length=687 residues).
atggcgcacgcggcgggcacaggctacgataaccgcgagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggacgccggggacgcgggcgccgcgccccccggggccgcccccgcgccgggcaccctgtccgccgcgccgg
gccgcgcgcccgcgcccgccaggacctccccgccgccgccggccgccgccgccgggcccgcgcccagcccggtgccacct
gtggtccacctgaccctgcgccaggccggcgacgacttctcccggcgctaccgccgcgacttcgccgagatgtccagcca
gctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggcgtgaactggg
ggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggac
agcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgcctt
tgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctggccc
tggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C6DX24_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagaaaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcctggcacctggcggatagccctgcggtgaatggagccactggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggtgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaacgcagcagctgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgcttggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C6E5E6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Moschus moschiferus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccggactaggacagggcagcggcgc
ctcctctccgggggggcggcttttggttgcggggaaggaggccgcggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgggcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctcccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccggcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctccg
ggaacaggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
gccgagttggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgtgtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtcctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C6E5E6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Moschus moschiferus GN=MCL-1 (length=591 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccggactaggacagggcagcggcgc
ctcctctccgggggggcggcttttggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccgga
aggcgttggagaccctgcgccgagttggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaa
ctggacatcaaaaacgaagacgatgtcaaatctttgtctcgtgtgatggttcatgttttcagtgacggagtaacaaactg
gggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcg
aaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatggg
tttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtcctgctggcttttgcaggtgttgccggagt
aggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C6FJ57_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L10 (length=558 residues).
atggtggacccgtttagggagcgcaccgcccggctgctgctggactacctggagttctgcgcccgggagcccggcgcgcc
agcccctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcccgtgtccaggaagcaaatcgaaacgtct
tgcccctctaccgccgctaccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctgctcgacgaagaccct
ggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctagagaggcctccgcagacgacccgacg
gctggagaagagagacgacggcggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcgaaa
ggcaccgcgcctggctgctggcgaacggcggctgggatggattttgtctctccttcagccactcattgcagccatcttgg
gaaagacagctggtctggtttttcttctcatactggacagcaataatcataatctacttctggataaaattatcatga
>gnl|bcl2dbcds|A0A8C6FN58_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L1 (length=738 residues).
atgtctcagagcaactgggaactagtggttgactttctctcttacaagctttcccagaaaggatacatctggagtcagtt
tagtgatatggaagagaacagaactgagaccacagaagggacagaatcagatatggaaaccctaaaagccatcaatggca
acccatcctggcacctagcagatagccctgcagtgaagggagccactggccacagcagaagcttggacgcccggaaaatg
atccctgtgacaacagtaaagcaagccctggggcaggcaagcaatgagtttgaactgaggtaccaacagacattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtaataaatgaactcctccgggacg
gggtgagctggagtcgcattgtggcctttttctccttcggtggggcattatgcatgaaaagcatagacaaggagatgcag
gtattggtgagtcaggtcacaacttggatggccacttacctaaatgaccacctagagccttggatccaggagaatggcga
ctgggacacttttgtggaactctacgaaaacaatacagcaaccgagagccagaagggccaagagcgcttcagctgctggt
ccctgatggacatgactgtgtggtatggttctgctgggcttgcttttcaactcataataactattccttttgttatagtc
attcaaattttatactag
>gnl|bcl2dbcds|A0A8C6MJ03_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2A1 (length=621 residues).
atgtttcgccaggctccacaagcttgtgcttcagactgtcttggtcagttgcaggtgagcaggctcaagactctgctccc
cagcaaggagaagatgactgagactgagtttggctacgttcacaggctggccgaggactatctgaaatatgtgttgcaga
tacagcaaactggatccaggccaagcaaaacatccagggtgttacaagacgtggcttcctctgtccagaacgaagtggaa
aggactttgaagcagtgcttggataagtttgatgtggtgtccgtagacactgccagaacaatattcaaccaagtgatgga
aaaggaatttgaagatggcgttgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttatcaagaaac
ttcagggcaagtgtattgccccagacatggacatgtgcaaggacatttcttactttgtggcagagttcatcaccgaaaac
acaggagagtggataaggcaaaatggaggctgggaaaatggttttgtaaagaagtttgaaatcaaatctggctggctgac
ttttctggaagttacaggaaagatctgtgaaacattatgtcgcctgaagcaatactattga
>gnl|bcl2dbcds|D3Z5F7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggagctagaagcgatcaaagctcgagtcagggagatggaggaagaggct
gagaagctaaaggagctacaaaacgaggtagagaagcagatgaatatgagtccacccccaggcaatgctggcccagtgat
catgtctcttgaggagaagatggaggctgatgcccgctctatctacgttggcaatgtggactatggtgcaacagcagaag
agctggaagcccattttcatggctgtggttcagtcaaccgtgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcggacaaagagtcagtgaggacgtccctggccttagatgagtccctgttcagaggaag
acaaatcaaggtgattcccaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccgcgctcccgatacc
gtgcccggactaccaactacaacagctcccgatctcgattctacagtggttttaacagcaggccccggggtcgaatctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|O35843_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=708 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgttgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctggggtgtgagtggaggtacacccctcagatctgtcttcagaaggcttgttcaagtgccaggagtggcggagcacgttt
gtgatcccagcctttgggaggtggaaacagaaggatcggaagttcaaggccctcctcagctattatag
>gnl|bcl2dbcds|O55177_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atggctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagttctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|O55178_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=387 residues).
atggctgagtacgagctcatgcatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcattcagagtgctacaaagagttgctttctccgttcagaaggaagttggaaagaacctaaagt
catacttggatgactttcacgtggaatccatagataccaccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaattggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaaacttccacaagagc
agattgccctggatgtacgtgcttacaaacaagtttccagttttggggcagaattcataatgaataa
>gnl|bcl2dbcds|O55179_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atgtctgagtacgagttcatgtatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccacaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatgaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagatctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|Q0P538_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=387 residues).
atggctgagtacgagctcatgcatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcattcagagtgctacaaagagttgctttctccgttcagaaggaagttggaaagaacctaaagt
catacttggatgactttcacgtggaatccatagataccaccagaataatattcaaccaagtgatggaaaaagagtttgaa
aatggcatcattaattggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaaacttccacaagagc
agattgccctggatgtacgtgcttacaaacaagtttccagttttggggcagaattcatcatgaataa
>gnl|bcl2dbcds|Q497M6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atggctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagcaaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagttctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|Q4FK02_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atgtctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagcaaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagttctgggaaatgctctttctcctcaagtag
>gnl|bcl2dbcds|Q5HZH3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|Q6NTH7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mus musculus GN=BCL-2 (length=600 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggtaggtgcatgtctggttgaatga
>gnl|bcl2dbcds|Q8K164_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atggctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagatctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|A0A8C6G6C7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus spicilegus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagacactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgccgtgaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggactgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|A0A8C6GJU8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus spicilegus GN=MCL-1 (length=954 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggaggaact
ggacggctgcgagccggaggcgatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggc
ctccatggttaaaggttcagccccacttcacagtgacatgttcatataaaggaagccaatcacccaactgctga
>gnl|bcl2dbcds|A0A8C6GJU8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus spicilegus GN=MCL-1 (length=996 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggaggaact
ggacggctgcgagccggaggcgatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggg
atgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgct
ggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C6GJU8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus spicilegus GN=MCL-1 (length=933 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggaggaact
ggacggctgcgagccggaggcgatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggg
ttgtacttctaattcagttggataatcttcagagcagtggattcaaaccgtga
>gnl|bcl2dbcds|A0A8C6GN16_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus spicilegus GN=BCL2A1 (length=618 residues).
atgagtgagtatgagttcacgtatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatacagactgctgcaaagagttgctttctctgttcagaaggaagttggaaagaacctgaagt
catacttggatgactttcacgtggaatccatagatactgccagaataatattcaaccaagtgatgaaaaaagagtttgaa
gatggcatcattaattggggaaagattgtgactatatttacctttgggggtgttctcctcaaaaaacttccacaagattt
tctggcagaattcataatgaataacacaggagaatggatatggcaggatggagactgggtatctttcaaaaaatccagag
gttttaaatttttttggattatcggtgtactatgtgccagtctgctttgtaaggctataatatctcacacagtaaattat
aagaaaaaaaaaaaaaaaaagaagacgacgtttagggagtctgagagtgctggcatccaaggcaccagcattgatgggct
gcatctgttaagagccctcttgctgaaatatgggagaattacccaggaaatgaggtag
>gnl|bcl2dbcds|A0A8C6H5H7_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus spicilegus GN=BCL2A1 (length=519 residues).
atgactgagtccgagctcatgcatatccactccctggctgagcactactttcagtatgtcctacaggtacctgcctttga
gtcggctccaagcaaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccacaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatgaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagatctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|A0A8C6H5J8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mus spicilegus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctactctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|A0A8C6IEV0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mus spicilegus GN=BCL2L10 (length=576 residues).
atggccgactcgcaggacccactgcatgaacgcactagacggctgctgtctgactacatattcttctgcgcacgggagcc
ggacaccccagaaccaccgcccacgtctgtcgaggcggctttgcttcgctctgtgactaggcagatccagcaggagcacc
aagaatttttttcctccttctgcgaaagccggggcaaccgcctggaactggtgaaacacatggcggataagttgctctcc
aaagaccaagacttcaactggagccaactggtgatgctcctggccttcgcggggacgcttatgaatcaaggcccttacat
ggctgtcaagcagagaggggatctgaggaatcgtctcatagtgacccgagactgctgtctcatagtgaactttctgtata
atctgctcatggggcgtcggcaccgctccaggctggaggctctcggcggctgggatggcttttgccgcttcttcaagaac
cctttaccgctcggcttctggagaagattgctgattcaggcttttctgtcaggcttctttgcaacagccatcttttttat
ctggaaacgtttataa
>gnl|bcl2dbcds|M3XZZ5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mustela putorius furo GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcaccggggg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagtaccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccaacgtcaccgcgacccccccgaggctgctgttcttcgagcctacccaccgcgcgtcgcc
gcctgaagagatggaaggcccagctgccgacgccatcatgtcgcccgaagaggagctggatgggtacgagccggaacctt
tggggaagaggcctgctgtcctgcctttgctggagttggtgggggaggccagcagtggcccctgcacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtctctggagattatttctcggtacctgcg
ggagcaggcaacgggcgccaaggacgcgaaaccactgggcgggcctggggctgccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtgcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|M3Y5X5_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L2 (length=660 residues).
aagcctgaagcaccccttctggctttccaaccatatattcacgccagcctttcatccttgactcttacagccgcccggat
ggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggttatg
tttgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttgag
acccgcttccggcgtaccttctctgatttggcagcccagctgcatgtgaccccaggctcggcccagcagcgcttcaccca
ggtctctgacgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcactgtgtg
ctgagagtgtcaacaaagagatggagccacttgtgggccaagtgcaagagtggatggtggcctacctggagacgcggctg
gccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcg
tctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagggg
ccttttttgctagcaagtga
>gnl|bcl2dbcds|M3Y8D1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L10 (length=681 residues).
atgggtgtggcggcccctccctgggcggaggcgcagcgggacctagaaaaccgggtcgggtcgggcagcgcggggagagg
tcgggccatggcggacgctttgagggagcgcacggcgcagctgctgaccgactacctggagtactgcgcccgcggccccg
gcacccccgcgcggtcgccgtctacgcgcgaggccgcggtgctgcgctcggtggccgccgtcgtgcggcagcgtcacgag
cgcttcttgtcggattaccgcggctacggcggcaaccgcgtcgagctggtggctcagttggagcgggagatactcgccca
cccccaagccctaagctggggccgtgtggtggcgctcgtgaccttcgcgggaacgctgctggagcgcccgccgtcggggg
cctgctcgaacttggggccggacccggaactggaactggagctgggggagtgggaggccagcgttcgccaagactgccgg
cgcctggtggacttcctctgcggtcggctcacagggcagcaccgcgcctggctggaggcgcacggcggctgggatggctt
ttgtctcttcttcacacccgcgctgctgtcttggaaaagactgctggtccaggctcttctgtcatgctttacggcagtga
tcttaatctacttctggaaaagattaccatttattgggtga
>gnl|bcl2dbcds|M3YVH4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2A1 (length=525 residues).
atgacagacagtgagttcgggtacacgctgtcgctggcccaggactacgtgaggcatgtcctgcagatcccgcagcccag
cccggccgccagcagagtgtcccgggtcctgcgggacgtggcctcctccgtgcagggggaggtggaacagaacttgagac
catgcttggacagctttgatgtggggtccatcgacactgccagaaccatcttcaatcaagtcatggaaaaggaatttgaa
gacggcatcattaactgggggaggattgtgaccgtgtttgcctttgaaggcattctctccaagaagctcctccgggagcg
aatttccccggacgtggatgcttccagggtttcttactttgtggcagagttcatcacgacaaacatgagggagtggataa
gacagaacggaggctgggaggatggctttgtaaagaagttcgagcccaagtccggctggctgacctttctggaagttata
ggaaagatctgtgaaatgttctctctcctgaagcaatactactga
>gnl|bcl2dbcds|M3YYK3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mustela putorius furo GN=BCL-2 (length=621 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
aagaccagtgatgaaactcgtgtacttacccaccgccccccccccaccccccctctcccgccaccgccgcccgcagctca
cctccccggccaccgccctcgccgccgctgccgccgcgggccctgcgctcagccccgtgccacctgtggtccacctgacc
ctgcgccaggccggcgacgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagctgcacctgacgcc
cttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggaggattgtggcct
tctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctatgg
atgactgagtacctgaaccggcacttgcacacctggatccaggacaacggaggctggcctgcccccgccccccatgaagg
tccagctgccagacctattgttgatgattcctactggcccaaagtgttttccttgcttgcc
>gnl|bcl2dbcds|M3Z2H9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgcagaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtaaagcaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatctcagcttcacatcaccccagggacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctgtgtgtggagagcgtagacaaggagatgcag
gcattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|G1P3J2_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L2 (length=660 residues).
cctgaaatgctccattctgtgtctctgactaaatatactcatgccagtcttttatccttgacctttacagccgcccggat
ggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggctacaagctgaggcagaagggttatg
tttgtggagcgggtcccggagagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgag
acccgtttccgtcgcaccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccagcaacgcttcaccca
ggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggagctgctctgtgtg
ctgagagtgtcaacaaggagatggagccacttgtgggacaagtacaggagtggatggtggcctacctggagacgcggctg
gccgactggatccacagtagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggctcgacg
cctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactaggggccttggtaactgtaggag
cattttttgctagcaagtga
>gnl|bcl2dbcds|G1P9D2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggaactggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccctgcggtgaatggagccactggccacagcagtagcttggatgcccgggaggtg
attcccatggcagcggtgaagcaagcgctgagggaggcaggcgacgagtttgaactgaggtaccggcgggcgttcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaagtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctcgttcggtggggcattgtgcgtggaaagtgtggacaaggagatgcag
gtattggtgagtcggattgcaacgtggatggccacttacctgaatgaccacctagagccttggatccaggagaacggagg
ctgggacacttttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggaacgcttcaatcgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|G1PZ39_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=795 residues).
gccccgccctctcccattagcggccgagggccccgacgtcatcgggacccttcgcgcggcggctgtttgcgccccttggc
tgtgcggggctgcccgcggagatggaaagccgcggccgccgacgccatcatgtcgccggaagaggagctggacgggtacg
agccggagcctctcgggaagcggccggccgtcctgcccttggtgcagctggtcggggaggccagcggcggccccggcgcg
gggggctcgctgccctccacgccgccccccgcggaggaggaggaggacgagctgttccggcagtcgctggagatcatctc
tcggtaccgggagcaggcgaccggcgccaaggacgccaagcccctgggcgggcccgcggcctccagccggaaggcgctgg
agaccctgcggcgggtcggggacggcgtgcagcggaaccacgagatggccttccaaggtgagcgggggccgcgcgccctc
tgtcttgtccgcgatcgctgggctcccgtgggtggaaaccgagacgagcccgggctggaagggctctccgcccgtttccg
aaaccagcatattctggccatgagtcattgtttccgcccacccgattccttgggaaccgctctccgctcaaaggccggaa
aggtgtgggagacctccaacacttgccatggcttcaaggatgggtttgtggaattcttccatgtagaggacctagaaggc
ggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G1Q051_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L2 (length=621 residues).
atgaatgaattttctctagacaactttatgctctatagttttgattctgttgatattaggcccaaagtgctgggtcctaa
gagctcccagcctcaggccccagacacacaggctctggtggcagactttgtaggctacaagctgaggcagaagggttatg
tttgtggagcgggtcccggagagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttgag
acccatttccgatgcaccttctctgatctggtggctcagctgcatgtgaccccaggttcagcccagcaatgtttcaccca
ggtctctgatgaactcttccaggggggccccaactggggttaccttgtggccttctttgtctttggagctgctctgtgtg
ttgagagtgtcaacaaggagatggagccacttgtgggacaagtacaggagtggacggtggcctacctggagatgcggctg
gctgactggatccacagtattgggggctgggcagagttcacagctctatacgggaactgggcctcagtgaggacagtgct
gacgggggccctggcactaagggccttgttaactgtaggagcattttttgctagcatgtga
>gnl|bcl2dbcds|G1QAV8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=975 residues).
atgtttggccccaaaagaaatgcattcatcggactcaacctccactgcgggggggcagttgggggcctgtggcggcagcg
aagcctacatctccttcaggaaggaggtccctgcccccaagagtcaggggcggggagggaaacgggcacggtgattggct
ggagcgctggcgcgagcccccaagccactctcgcgagggatcctgggagggtcgctcgcccctcgcccatgggcacggag
ggtcccgatggcaccgcggcccctgccaggtggctgttctcgcccatcagccggaattgccctgaagagctgggagctct
ggcagccgacgccatcatgtcgcccggagaggagctgggcaggtatgagccggagccgaagcagccggctgtcctgccct
tgctccagctggtcggggaggccagcgaaggccccgcaggtggctcactgccctcgaccccgccccctgctgaggaggag
gaggaattgtcactgctggagatgatccctcagcaccttagggaacgggctggcgccagggaccaaagccagggcccgcg
ggtcggcggggtgcagcggcgtgcagcagggtgcagcggggtgcggcaggagactgccttcctaggtatgcttgaactgg
acaccgaaaacgaagacaacgtcaaatcttcgtctcaagcgatggttcatgcttttagggacggagtgacaaacggcagg
attgtgactcatttcttttggtgcctttgtagccacttgaagagcataaaccaagaaagctgcattgaaccgttagcaga
agacatcacagatgttctcgtagggacagaacgaggctggctagtcaaacagagaggctgggatgggtttgtggaattct
tccaggtggaggacctagaaggcggcgtcagaaatgtgctgctggcttttgcaggtgctggagtaggagctggtttgcca
tatctaataaggtag
>gnl|bcl2dbcds|G1QEX2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L10 (length=537 residues).
gacgagttgaagttgcgcacccgacggctgctgaccgagttcctggaacaccgcacccgaaggcgcggcactgccccgca
gcagccgtccacgcccgaggccaccgtgatgcgctccctggctgctcattcgtggctgggtaccccgcactcctggtccc
ggaggcagagaaaccgactcgagcagatggtcgaccagatagagtcgctagttccagacggcacagaccccaactggttg
agcgtggtggcgctcgtgtccttcgcgggggccctgctggagagaccgccgccaggccactcgcaggcacgcagggaatg
ggatgccaccgttgaccaggactgccagcgcctggtcaccttcctgtgcagttggctcacggagacgcaccgcacctgga
tggaggcgcaaggtggctgggatggcttttgtcacaacttcatgcctgcaccgccgcctggggacagactgctggctccg
cttctgagggcatgccttgtactcataatcttaatctgcttgtggataaaaatcatg
>gnl|bcl2dbcds|A0A667Y1V0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Myripristis murdjan GN=BCL2L1 (length=669 residues).
atgtcatacagtaacagagaactggtggttttctttataaactataaactgtctcagaggaactatcccacttgtcagct
ggggctggaggaggccagcgaaaggactgagggagacgacgccgacgccgtcatctctaatggctcactggccaacagca
ggaccggcgccggccagccggggacgccgtcgcctccgtacggcggcatagaggtcgttaaggctgcgcttcaggaatcg
gcggatgagtttgaactgcgctacacgcaggcgttcagcagcctctcctcccagctccacatcacccccgccacagccta
ccacagctttgagagcgtaatggacgaggtgtttcggaacggagtcaactgggggcgggtggtgggcctgtttgccttcg
ggggcgccctctgtgtggagtgtgtggagagggatatgaaccagctggtgccccgcattgcagactggatgaccacgtac
cttgataaccacattgagccatggatccagagggaaggaggctgggaccgcttcgctgagatttacgggcgagacgccgc
tgcagaggcgaggagagctcaggagagtctaaggagatggctgctggttggcgtggtgctgctcacaggcgtgctgctcg
gcgctctcatcgcaaagaaacatccctga
>gnl|bcl2dbcds|A0A667YZT5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myripristis murdjan GN=MCL-1 (length=840 residues).
atgaacatcgtttcgaagcgggcaaccattggagcaattggaagttgttttatttttcctcaaaatggagtcgtcgaggg
acaaatgtactacggctctggagattcctcccctcagatagcaatggcctccaccctggaaaacgggaatgccgtctcca
gcgacacgccgaagcggccgaaaaacctaggagttaacgggtttacagcgaaaaacagccgggacgatagcaccgacaac
gacgacgggtctttgccgtgcacgccggagctgcagtcggacagcgaggccgacgtgtccggcagcccggcgggggaggc
ggtggtggacaatgacacaaggcatctggtggagactttcttaagagactatagtgggctttccaggccgcggtggaggg
aggacaaggcactagaaaccatgaaaagagtcgtggaggatgttcttgagaaacaccgatacgcttacaatggtatggtg
aggaaagtcgcgctggacgagaggggagacgacatgagtttcgtcacgtccgtggccaagagcctcttcggggacggaac
caccaactgggggcgcatcgccagcctggtggccttcggggccgttgtgtgtcagcacctacgggaaaaaggcagggatc
actgcgtgagctcagtgagccgagaaatctctacatacctgctgtcggatcaacgggagtggctgatcaggaacaattca
tgggatggttttgtggagttctttcgagtagcagacccagaatccacggtgaggaacacactcatggcctttgctggatt
tgctggcatcggggcaacgctggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A667YZT5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myripristis murdjan GN=MCL-1 (length=843 residues).
atgaacatcgtttcgaagcgggcaaccattggagcaattggaagttgttttatttttcctcaaaatggagtcgtcgaggg
acaaatgtactacggctctggagattcctcccctcagatagcaatggcctccaccctggaaaacgggaatgccgtctcca
gcgacacgccgaagcggccgaaaaacctaggagttaacgggtttacagcgaaaaacagccgggacgatagcaccgacaac
gacgacgggtctttgccgtgcacgccggagctgcagtcggacagcgaggccgacgtgtccggcagcccggcgggggaggc
ggtggtggacaatgacacaaggcatctggtggagactttcttaagagactatagtgggctttccaggccgcggtggaggg
aggacaaggcactagaaaccatgaaaagagtcgtggaggatgttcttgagaaacaccgatacgcttacaatggtatggtg
aggaaagtcgcgctggacgagaggggagacgacatgagtttcgtcacgtccgtggccaagagcctcttcggggacggaac
caccaactgggggcgcatcgccagcctggtggccttcggggccgttgtgtgtcagcacctacgggaaaaaggcagggatc
actgcgtgagctcagtgagccgagaaatctctacatacctgctgtcggatcaacgggagtggctgatcaggaacaattca
tgggatggttttgtggagttctttcgagtagcagacccagaatccacggtgaggaacacactcatggcctttgctggatt
tgctggcatcggggcaacgctggccctgctgatcaggttctga
>gnl|bcl2dbcds|A0A667ZHE8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Myripristis murdjan GN=BCL2L1 (length=699 residues).
atgtcccaaaacagagaactggtggttttctacataacctataaactctcccagaggaactatcctttcaaccacatcgg
gctcatagagtccccaaacaggactgatggggggcaggcaggggcggccgaggaacagcgggtagcgacacatgccaacg
ggacactcaacggcacgagtccgggcaccccgccggcatcgcccttgcggcgggagcggtcggcgtccacgacgagcctg
gacgcggtgaaggaggccctgcgggactcggccaacgagttcgagctgcgttacgcccgcgccttcaacgacttgcacga
ccagctgcacatcacgccggccacggcctaccagagcttcgagagcgtgatggatgaggtgttccgggacggcgtcaact
ggggacgcgtggtcgggctgttcgcgttcggcggcgcgctgtgcgtcgagtgcgtggagaaggagatgagtccgctggtg
tcaaggatcgccgagtggatgacagtctacctggacaaccacatccagccctggatccacagccaaggaggatgggaacg
ctttgccgagatctacgggcaggacgcggcggcagagggcaggagggctcaggagagcttcaggaagtggctgctggccg
ggatgaccctggtcaccggagtcgtcgtggggtcgcttatcgcccagaagcgcctgtga
>gnl|bcl2dbcds|R4JQR8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mytilus galloprovincialis GN=BCL2L1 (length=558 residues).
atgaaccagtttagttcaagatatttagtggcagactttattaatgaccgacttcgaaaacatggaatgcgatgggacaa
ctgtcctacgttagacttgccaccatcacaaattcagcttaaattacgttcacttggagatgaattccaagaaagatttc
agactcagtttgacgatatggtcaatcagttacacataactgaggctactgcatatccaacgtttcaaagagttgttcag
gaattatttattgatggaaatattaactggggaaggattgtggctcttttcggttttggtgggtctttgtcagtgaaatg
tgtacaaagaggaatgccacaacttgtggattcaattgttgactgggtatctacctatttgtgtaatagtttagagcaat
ggattacagataacggtggttggcaaggatttgtggaagcctataaccaaggacagaatcataatgacagtccgtgggat
gtgaaaggacttgttaaatacggagcaataggtgtaataggcgcaatggcgttaagtgcttttctacatagaacgtga
>gnl|bcl2dbcds|A0A8C6V6T2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Naja naja GN=BCL2L1 (length=1068 residues).
atgacaaggaggatcagccagtgcctggaacgctttgcctgcctgcctgcctcctccacattctcaacatttgctccgcc
gcgcacagctccctctgctgagatctcttccccctgcttgaagccaactaactgctccttttccagggcgccattcccgg
ggaggttggtgcctgtagccgggacgggcagggggttccatgcatcgcctgcccccttcttggaatgcgactcaccggat
gactcatcgccgagtttccgcgcctggcgctgggatggccgtgcccgaagcggaagggcaccgcgtcctcctacggtaag
caggacggctgaggctgcagaccatggactcactgagacgggcagaggtgtgaaaatgtcgagcggcaaccggtccctgg
tggtggacttcattgcctacaagctggcgcagcggggccacagctggcgcgagatccagggcgacagcgaggagcggacg
gagctgtccggcgagatgggcagcggcgtcctgaacggcgggagcccctcctggcaccccagccccagcccggtggtcaa
cggggcagccggcattcacccggctctcctggaagagctgggcgacggcccccaggcggcggtgaggcagacgctgcggg
aagccggggacgagttcgaactgcgctaccggcgggcctttagcgacctgacctcacagctccacatcacccccggcacg
gcttaccagagcttcgagcaggtggtgaacgaacttttccgggacggggtgaactgggggcggattgtggcctttttctc
cttcggaggggccctgtgcgtggaaagcgtcgacaaggaaatgcacggcttggtggagaggatcgccacctggatggcca
cgtacctgacggaacacctggacccctggattcaagacaacggaggctgggagcgttttgtggatctctacgggaacgac
gcggccgccaagagccggaagggccaggagcgcttcaacaagtggctgtggacgggggccaccgtggccggcgtggtcct
cctgggctccctgctgagccgcaaatag
>gnl|bcl2dbcds|A0A8C6VLE3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Naja naja GN=MCL-1 (length=1080 residues).
cgtcaccgcgcgggggcatttataacgggcgctccgggcgcgcgccactcccctcctcagaaccaagccgtgctcgaggc
cggtcgccatgttcaacaagaagacgatggttctgtattgcggcggctccccggattggcaccggccgcccctcagtccc
ccggaggcggcggaggcggcagcggcgagggcggcctggctctccttcccggcggcgttcgaggaggcctgggcgggggg
ctctgctggcctcccgccggctgcgctgaggggcctcgagcgctgattggcggagggccgcgcgcagggcccctctcgct
gattgggaccagggacgcggccgcgcgcgcactgattggtcaggcatcggcggcgacgacccccgaagaggagctggacg
gctgcgagcccgaggcggagaccggagcggagtcttccgccgcctcttcctcttcttcttcccccgccccgccgggagaa
gccggggacccgctgcgccaggtgacgctgcagctggtggcctcatacctgcgggaggcggccgaccaggagccccccaa
gcaggacgactgcggcggcggcgggaagttcctgcagggcctgctgggccgcttcgggccctgccccgccgaggcggaga
cggcggctcgggccctggagacgctgcggagggtctgcgacgacatcatggagaagcaccagctggccttccaaggaatg
ctgaggaaagtgcagatcgacaaagctgatgacttgaagcttatgtcggaagttgcaacacaagttttcaacgatggcat
aacaaactgggggcgaattgtgactctcatttcttttggtgcctttgttgccaaacacttgaagagcataaatcaggaaa
gcggcatcagcactttggcagagatcatcacggaggtgctggtgacagagaagagagagtggctgctgcatcacaatgcc
tggacgggctcgattaaattgcaaaaaagaaaaggaacattttgcatgccggaaaaaaagaaaacattcaaaaagaaaag
aaaagcctctggagatgattgggaccctccgaagagttaa
>gnl|bcl2dbcds|A0A8C6VLE3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Naja naja GN=MCL-1 (length=1080 residues).
cgtcaccgcgcgggggcatttataacgggcgctccgggcgcgcgccactcccctcctcagaaccaagccgtgctcgaggc
cggtcgccatgttcaacaagaagacgatggttctgtattgcggcggctccccggattggcaccggccgcccctcagtccc
ccggaggcggcggaggcggcagcggcgagggcggcctggctctccttcccggcggcgttcgaggaggcctgggcgggggg
ctctgctggcctcccgccggctgcgctgaggggcctcgagcgctgattggcggagggccgcgcgcagggcccctctcgct
gattgggaccagggacgcggccgcgcgcgcactgattggtcaggcatcggcggcgacgacccccgaagaggagctggacg
gctgcgagcccgaggcggagaccggagcggagtcttccgccgcctcttcctcttcttcttcccccgccccgccgggagaa
gccggggacccgctgcgccaggtgacgctgcagctggtggcctcatacctgcgggaggcggccgaccaggagccccccaa
gcaggacgactgcggcggcggcgggaagttcctgcagggcctgctgggccgcttcgggccctgccccgccgaggcggaga
cggcggctcgggccctggagacgctgcggagggtctgcgacgacatcatggagaagcaccagctggccttccaaggaatg
ctgaggaaagtgcagatcgacaaagctgatgacttgaagcttatgtcggaagttgcaacacaagttttcaacgatggcat
aacaaactgggggcgaattgtgactctcatttcttttggtgcctttgttgccaaacacttgaagagcataaatcaggaaa
gcggcatcagcactttggcagagatcatcacggaggtgctggtgacagagaagagagagtggctgctgcatcacaatgcc
tgggagggctttgttaaattcttccatgtagaggacctggagggcagcatcagaaacattctggtggcttttgcaagtgt
ggctggcctaggtgcgagcttggcttacttgatccggtga
>gnl|bcl2dbcds|A0A8C6VPU0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Naja naja GN=BCL2A1 (length=522 residues).
atggaaagctacaatttcctttatgtgaacactttggtgcaagattacctgaaatacatttgtcaagaggctcagctggc
agcggccccaaacaaagtggctgaagtccttcgtaaagccggatattctgctcagaaagaagttgaaagcaacctgaggc
cttacatggactcactggggattcattccgtagaagaagccggcaacattttcaatcaagtgatggaaaacgaatttgcg
gatgggaaaattaactggggacgcattctgacgatattcctgttcggtggaatcctggctaaaaaactccaaggaccttt
ggcaaaagaaaacttgaaacagatctcttatttcgtcacagactacattgtgagcaccaaaggaaagtggatcagtgaga
atggaggatgggacaatggctttataacaaaatttgaggataggagctcctgggtatccttatccactctgaagacaaag
atcttggctgttttttccatcttcaatcaatatcactcataa
>gnl|bcl2dbcds|A0A8C6QA84_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nannospalax galili GN=MCL-1 (length=1023 residues).
atgtttggcctgagaaggaacgcggtaatcggcctcaacctgtactgcgggggcgccagcctcgcggcaggcggcagttc
tccggcgggagcgcgcctggtggccgaggaggccaaggcacggtgcgaggggggaggggaggccggcgcgggctcgggcg
gaagtgtgagcggccctgcagccctgctgccagacgcgcggagggtcgcgcggccgccgcccattggcgccgaagtcccc
gacgtcaccgcgacccccgagaagctgatgctcttcccagcgggtcgtgcgtcgccgcctgaggacatggccgcgccggc
cgccgccatcatgtctcctgaggaggagttggacggctacgaacccgagccgctcgggaagcggccggccgtgctacccc
tgcgggggctggtcggcgaggcggcgaagagctcgggcactgacggctcgctgccctccacgccgccgccggtcgaggag
gacgacgagctgtaccgccagtcgctggcgatcatctcccggtacctgcgcgagcaggccacaggcgccaaggacgcgaa
gcctctgggcggggcgggggcggcgggccggagggcgttggagacccttcggcgagtgggcgacggtgtgcagcgcaacc
acgaaacggccttccaaggcatgcttcggaaactggacattaaaaatgaagatgatgtcaaatctttgtctcgagtgatg
gtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactctgatttcttttggtgcctttgtggccaaaca
cttgaagagcataaaccaagaaagttgcatcgacccattagcagaaagtatcacagatgttcttgtaaggacaaaacgag
actggctagtcaaacaaaaaggctgggatgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaat
gtgctgctggcttttgcaggtgttgctggagtaggggctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C6QF32_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Nannospalax galili GN=BCL2A1 (length=528 residues).
atgactgactgtgaattcacatctgtctactctttggctgaggactatcttcagtatgtcctacaagttcccttgtttga
atcggctccaagcaaaacgtccagagtgctacaaaaagttgctttctcagtccaaaaagaagttgaaaagaatctgaaac
catacttggacaattttgatgtggtatccatagatacagctagaacaatattcaatcaagtgatggaaaaagaatttgaa
gatggtattattaactgggggaggattgtgaccatatttgcttttgggggtgttctcctcaagaaacttccacaagagca
gatggacttggatgtggatacttacaagcaagtttcttattttgtggctgaattcataatgaataacacaggagaatgga
tacgtcaaaatggaggttgggaagatggcttcataaggaaatttgaacctaagtctggctggctgacttttctggaagtc
atgggacagatctgggaactgatctttctcctgaagcaccatcattga
>gnl|bcl2dbcds|A0A8C6R201_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Nannospalax galili GN=BCL2A1 (length=462 residues).
tactctttggctgaggactatcttcagtatgtcctacaagttccctcgtttgaatcggctccaattgttttctcagtcca
aaaagaagttgaacagaatctgaaactatacttggacaattttgatgttgtacccacagatacagctagtacaatattca
atcaagtgatggaaaaagaatttgaagatggtatcattaactgggggaggattgtgaccatatttgcttttgggggtgtt
ttcctcaaggaacttccacaagagcagatggacttggatgtggatacctacaagcaagtttcttgttttgtggctgaatt
cataaagaataacacaggagaatggatacgtcaaaatggaggttgggtatatggcttcataaggaagtttgaacctaagt
ctggctggctgacttttctggaagtcatgggacagatctgggaattgatctttctcctgaag
>gnl|bcl2dbcds|A0A8C6RID6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nannospalax galili GN=BCL-2 (length=711 residues).
atggcgcacgccggcagaacagggtatgataaccgggagattgtgatgaagtacatccactataagctgtcacagagggg
ctacgaatgggatgctggagatgcggacgccgcgcccctgggggccacccccgccccgggcatcttttcttccttgcctg
ggagcaacccaaccgccgctgtgcaccaggacccagccgccaggacctcgccgccgcgcctcccggctgcaatggctggg
caggcgctcagcccggtgccacctgtggtccacctgaccctccgccaggctggggatgacttctcccgtcgttaccgccg
cgacttcgcagagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgcttcgtcacggtggtggaggagc
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcaccgctggtggacaacatcgccctctggatgaccgactacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactgtatggacccagtgtgcggcccctgtttgacttctcttggctgtctc
tgaagaccctgctcagtctggccctggtaggggcctgcatcaccctgggtgcctatttgggccacaagtga
>gnl|bcl2dbcds|A0A8C6RID6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nannospalax galili GN=BCL-2 (length=642 residues).
atggcgcacgccggcagaacagggtatgataaccgggagattgtgatgaagtacatccactataagctgtcacagagggg
ctacgaatgggatgctggagatgcggacgccgcgcccctgggggccacccccgccccgggcatcttttcttccttgcctg
ggagcaacccaaccgccgctgtgcaccaggacccagccgccaggacctcgccgccgcgcctcccggctgcaatggctggg
caggcgctcagcccggtgccacctgtggtccacctgaccctccgccaggctggggatgacttctcccgtcgttaccgccg
cgacttcgcagagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgcttcgtcacggtggtggaggagc
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcaccgctggtggacaacatcgccctctggatgaccgactacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggtaggtgcacatctgactgaaggagtctgggtttcggtgatcattttctggtaccctgggaggt
ag
>gnl|bcl2dbcds|A0A8C6RJE0_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Nannospalax galili GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctctgccccagacacacgggctctggtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggaaggcccagcagccgaccctctgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatctagccgctcagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtgtccgacgaacttttccaagggggccccaactggggtcgtcttgtggcattctttgtctttggggctgccttgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggattggatggtgacctacctggagacgcgcc
tggctgactggatccacagcagtgggggctgggagctagaagcgatcaaagctcgagtcagggagatggaggaagaggcc
gagaagctaaaggagctacagaacgaggtggagaagcagatgaatatgagtccacccccaggcaatgctggcccagtgat
tatgtctattgaggagaagatggaggctgatgcccgctctatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcggtcaaccgtgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtctctgtttagaggaag
acaaatcaaggtgatccccaaacgaaccaacagaccaggtatcagcacaacagaccggggcttcccacgtgctcgttacc
gtgccaggactaccaactacaacagttcccgttctcgattctacagtggttttaacagcaggccccggggtcgagtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8C6RJE0_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Nannospalax galili GN=BCL2L2 (length=582 residues).
atggcgaccccagcctctgccccagacacacgggctctggtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggaaggcccagcagccgaccctctgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatctagccgctcagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtgtccgacgaacttttccaagggggccccaactggggtcgtcttgtggcattctttgtctttggggctgccttgtg
tgctgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggattggatggtgacctacctggagacgcgcc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgccagcaagtga
>gnl|bcl2dbcds|A0A8C6W748_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nannospalax galili GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcgtacaagctttcccagaaaggatacagctggagtcagtt
cagtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcatctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggagctg
atccccatggttgcagtgaagcaagcgctaagagaggctggggatgagtttgaactgcggtaccggcgggcattcagtga
cctaacatcccagcttcatataaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgagatg
gggtaaactggggtcgcattgtggcctttttctcctttggcggtgcactgtgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaacgcagcagctgagagtcggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttcttctgggttcactctttagccggaagtga
>gnl|bcl2dbcds|A0A8C6WBP6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Nannospalax galili GN=BCL2L10 (length=552 residues).
atggcagatcccctgcgggagcgcacccggcagctgctgatagactacctgctgttctgcgcacgggaaccaggcacccg
ggagctgccaccgagctccagcgaggccgccgtgctgcgctcggtagcggcacagaccctgcagctccaccagcccttct
tctcctccttccgcggctaccagggcaacagtctggagctgctgtcacagatggcggatgtcgtgttgtccgaccagcaa
agcctcaactggggcagagtggtagtgcttgtggccttcgctggcatgctcctggatcaaagcccttgtaagaataccaa
ggggaggaataggctccatgtgctccgggactgcctttacatggtggacctcctatgtactcgcctcactggacggcacc
gtgcttggctggaagctcaggatgactgggatggcttttgccgcttcttcagaagacccttcccactgagtttttggagg
agactgctgctccagatgtttttatcatgcttctttgcaataggcatactatatttgtggaaacgattataa
>gnl|bcl2dbcds|A0A8C6SVR4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neogobius melanostomus GN=MCL-1 (length=741 residues).
gtatgctacctgcaaaacggacaaaattcggcatccctacaacaatgttgggtatgcttatgcctcaaaatggagtcacc
cacagccctgcaagtcaagaacgaccattcaagaaagcacaaaaacctacgggagggcgattacgaccacaactcggacg
gcggctcgctcccctgcacgcccgagttccagtcggacagtgaacaggagatgtccggctactccgtggagaacgacacg
aggcagcttctcggcgactttttcgagctaatcacggggatttcgcagccgggttggctccagcgacccgctttaacgac
aatgaagagagtcgtggacaaccttttagagaaacacagaatcgcgtacaatggtaggctgaatttgccttcaaatccaa
actggggggacgatgtaacgttcatgggcgacgtagccagaagtatattcgaagacggcaccaccaactggggtcggatc
gccagcctgatatccttcggggcggtggtgtgccagtacctgaagtccaaaggaagggaaagctgcgtggagagagtggc
tgaagaaatttcctcataccttctttcagaccaacgagactggctgatcaggaacaactcctgggatggttttgttgagt
tctttagagtagacgacccagaatcaaaagtgaggaacacacttatggctgtggccggactagcaggaatcggtgcaacc
ctggccatgttaatcaggtga
>gnl|bcl2dbcds|A0A8C6SVR4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neogobius melanostomus GN=MCL-1 (length=822 residues).
atgctacctgcaaaacggacaaaattcggcatccctacaacaatgttgggtatgcttatgcctcaaaatggagtcgtgga
ggcggagggagctatgactatggacgctcgcaacggcaacggctctctcagtcactgccacccgcaacagcagagaccca
cagccctgcaagtcaagaacgaccattcaagaaagcacaaaaacctacgggagggcgattacgaccacaactcggacggc
ggctcgctcccctgcacgcccgagttccagtcggacagtgaacaggagatgtccggctactccgtggagaacgacacgag
gcagcttctcggcgactttttcgagctaatcacggggatttcgcagccgggttggctccagcgacccgctttaacgacaa
tgaagagagtcgtggacaaccttttagagaaacacagaatcgcgtacaatggtaggtatgataaacaaactgtcagtgga
cgacagggggacgatgtaacgttcatgggcgacgtagccagaagtatattcgaagacggcaccaccaactggggtcggat
cgccagcctgatatccttcggggcggtggtgtgccagtacctgaagtccaaaggaagggaaagctgcgtggagagagtgg
ctgaagaaatttcctcataccttctttcagaccaacgagactggctgatcaggaacaactcctgggatggttttgttgag
ttctttagagtagacgacccagaatcaaaagtgaggaacacacttatggctgtggccggactagcaggaatcggtgcaac
cctggccatgttaatcaggtga
>gnl|bcl2dbcds|A0A8C6SVR4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neogobius melanostomus GN=MCL-1 (length=819 residues).
atgctacctgcaaaacggacaaaattcggcatccctacaacaatgttgggtatgcttatgcctcaaaatggagtcgtgga
ggcggagggagctatgactatggacgctcgcaacggcaacggctctctcagtcactgccacccgcaacagcagagaccca
cagccctgcaagtcaagaacgaccattcaagaaagcacaaaaacctacgggagggcgattacgaccacaactcggacggc
ggctcgctcccctgcacgcccgagttccagtcggacagtgaacaggagatgtccggctactccgtggagaacgacacgag
gcagcttctcggcgactttttcgagctaatcacggggatttcgcagccgggttggctccagcgacccgctttaacgacaa
tgaagagagtcgtggacaaccttttagagaaacacagaatcgcgtacaatggtaggctgaatttgccttcaaatccaaac
tggggggacgatgtaacgttcatgggcgacgtagccagaagtatattcgaagacggcaccaccaactggggtcggatcgc
cagcctgatatccttcggggcggtggtgtgccagtacctgaagtccaaaggaagggaaagctgcgtggagagagtggctg
aagaaatttcctcataccttctttcagaccaacgagactggctgatcaggaacaactcctgggatggttttgttgagttc
tttagagtagacgacccagaatcaaaagtgaggaacacacttatggctgtggccggactagcaggaatcggtgcaaccct
ggccatgttaatcaggtga
>gnl|bcl2dbcds|A0A8C6UPI9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Neogobius melanostomus GN=BCL2L1 (length=621 residues).
ataatgtctcacagtaatcgagagctggttgagttcttcctaagttacaagttaacacagaaaaactacccatgctctct
gctcatgtcagactctgctcgggttcaatctgatggaaacaaggcagcttgtgtcctgaacggtctgctgtctaacccca
atggcagtagacgaactctgagctcccagtctcatgatcacatagaggatgttaagactgcactccgggactctgcagat
gaatttgaagagctgttcacacaagcattcagcaacctctcctcccaacttgacatcactcctgatacagcttatcacag
ctttaaaagcgtcatggacgaggtgttcaaagatggggtcaattggggacgcatatgtgtagaaaaggacatgagcaatc
tggttcctcgcatcgctgactggatgactatctacctggatgagaatatcgcctcatggatccaaagccaagggggctgg
gactgttttgcgcaaatctttgggcagaatgctgctgcagaggccaggagatctcgggagactctgaagaaatggctgct
agttggagtggggttgctaacaggtgtgctggtcgctatgctcatcgctaggaaacagtga
>gnl|bcl2dbcds|A0A8C6UWE4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Neogobius melanostomus GN=BCL2L10 (length=564 residues).
atgtcttgtgggctgtggaaagagaccctggctctggcagaggactacctgtgcctgtgctgcagcccccaggcagcccg
tcctcctcccagcgggtcagctgctgccatgaggcgtctgggccaagacatggaggcccagcacaaggcacgcttccaca
ctctgagccagacctttctgaaacagtgcgggccggacccctgctccagtctcaggaaggtcatggaggagctggtggga
gatggactcttgaactggggaagggttgtgtcccttttcacctttgctggggtgctggccagacaaatacaagagcagaa
gtgcagcaggtcagggcaggaccctgggaaagtgcctgcagactgcaggctgctggcagaaaccatagcagattacctgg
gagaggagaagagagactggctgttggacaatggaggctgggtaggcttctgtgagttctcatgccactccaggaaggtg
gaccaggactcatccatgaagaccgctctgtttgctgctgctggggtgggtctcgctggcctcacctttctcttggtgcg
ctag
>gnl|bcl2dbcds|A0A3Q4HLQ8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neolamprologus brichardi GN=MCL-1 (length=819 residues).
atgaccaactatatgatgtcgaaaaggaaccagtgcaccttcatagactatcttattcctcaaaatggagtcctagaggg
accaatgcactatggatcgggaaattcctcaccgcagaacgccacaggctcctctaaagactctagcaacgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataccacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttactggactttcgcagcctcaacgaaaggaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtgttgt
cagctttgtggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactgcgtggcgctagttagcc
aagagatttctgcatacctgctgtctgagcagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3Q4MN81_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Neolamprologus brichardi GN=BCL2L10 (length=615 residues).
atgtgcagagagcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctggttttggccga
ggactacctgtccttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtc
taggctgggacatcgaaagacagcaccaagctcgcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggac
cactgcctcagcctcagaaaggtgatgaaggagctggttggagatggacacttgaactgggggagggttgtttctctttt
cgcctttactggagtgctggccagaaagatcctggagcagaagccggggctggaccctggtcaacagcaggaactgggac
aggagcccatgagctgcagaaggctggcagagaccatagctgattacctgggagaagagaagaaagactggctgttggat
aatgatggatgggaaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactcatccatgaagaaagcgct
gtttgctgccgccggtgtcggccttgctgggcttaccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A3Q4N4B5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Neolamprologus brichardi GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggctttttgcgttcggtggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcacttcgctgaaatctttgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgtcgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7AU04_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Neovison vison GN=BCL2L10 (length=582 residues).
atggcggacgcgttgagggagcgcacggcgcagctgctgaccgactacctggagtattgcgcccgcggccccggcacccc
cgcgcggtcgccgtctacgcgcgaggccgcggtgctgcgctcggtggccgccgacgtgcggcagcgtcacgagcgcttct
tgtcggattaccgcggctaccgcggcaaccgcgtggagctggtggctcaggtggagcgggagatactcgcccacccccaa
gccctaagctggggccgtgtggtggcgctcttgaccttcgcgggaacgctgctggagcgcccgccgccgggggcctgctc
gaacttggggccggacgcggaactggagctgggggagtgggaggccaccgttcgccaggactgccggcgcctggtggact
tcctctgcggtcggctcgcagggcagcaccgcgcctggctggaggcgcacggcggctgggatggcttttgtctcttcttc
acacccgtgctgctgtcttcttggaaaagactgctggtccaggctcttctgtcatgctttacggcagtgatcttaatcta
cttctggaaaagattaccgtga
>gnl|bcl2dbcds|A0A8C7B9K2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Neovison vison GN=BCL-2 (length=705 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggcgacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctcgccgcccccgccccccgccgccctcgccgccgctgccgccgcgggccctgcg
ctcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgtcgctaccgccgcgactt
cgcggagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttca
gggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggag
atgtcgcccctggtggacaacatcgccctatggatgactgagtacctgaaccggcacttgcacacctggatccaggacaa
cggaggctgggatgcctttgtggagctgtacggccccagcgtgcagcctctgtttgacttctcctggctgtccctgaagg
ccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A8C7BMW8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neovison vison GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggggg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagtaccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccaacgtcaccgcgacccccccgaggctgctgttcttcgagcctacccgccgcgcgtcgcc
gcctgaagagatggaaggcccagctgccgacgccatcatgtcgcccgaagaggagctggatgggtacgagccggaacctt
tggggaagaggcctgctgtcctgcctttgctggagttggtgggggaggccagcagtggcccctgcacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtccctggagattatttctcggtacctgcg
ggagcaggcaacgggcgccaaggacgcgaaaccactgggcgggcctggggctgccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C7BMW8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neovison vison GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggggg
cgcctcctcttcgggagggcggcttttggcaacgggcgccaaggacgcgaaaccactgggcgggcctggggctgccagcc
ggaaggcgttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C7BPR9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Neovison vison GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgcagaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtaaagcaagcgctaagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatctcagcttcacatcacccccgggacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctgtgcgtggagagcgtagacaaggagatgcag
gcattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C7BPR9_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Neovison vison GN=BCL2L1 (length=666 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgcagaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtaaagcaagcgctaagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatctcagcttcacatcacccccgggacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctgtgcgtggagagcgtagacaaggagatgcag
gcattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggtccggactggcttattttaccccgagttcctggcacacggcctgaggttgggtaagggcttagccagcatctgct
cagtgaacatgaagggttattattag
>gnl|bcl2dbcds|A0A8C7EW82_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Neovison vison GN=BCL2L2 (length=582 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgtaccttctctgatttggcagcccagctgcatgtgaccccaggctcggcccagcagcgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggccaagtgcaagagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|U6CQS8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Neovison vison GN=BCL2A1 (length=525 residues).
atgacagacggtgagttcgggtacacgctgtcgctggctcaggactacgtgaggcatgtcctgcagatcccgcagcccgg
cccggccgccagcagagtgtcccgggtcctgcgggacgtggcctcctccgtgcagcgggaggtggaacagaacttgaaac
catgcttggacagctttgacgtggggtccatcgacactgccagaaccatcttcaatcaagtcatggaaaaggaatttgaa
gacggcatcattaactgggggaggattgtgaccgtatttgcctttgaaggcattctctccaagaagctcctccgggagcg
aatttccccggacgtggatgcttccagggtttcttactttgtggcagagttcatcacgacaaacatgagggagtggataa
gacaaaacggaggctgggaggacggctttgtaaagaagttcgagcccaagtccggctggctgacctttctggaagttaca
ggaaagatctgtgaaatgttctctctcctgaagcaatactactga
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=816 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=1053 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=444 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
catgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgatggtccatgttttcagcgacg
gcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaa
gaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaag
aggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcag
gtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I3GEA7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacttggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2I3GEA7_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L2 (length=846 residues).
gggctgcgggcggttcggggctccgggccggggcggcggcgccatcttgtgccccggggccggtggggaggccggggagg
ggggccccgggggcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcg
cccccccgggagctccgggccctgggcctggttcgggagcccccggcagccaagaggaggaggaggagccgggactggtc
gagggtgacccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgagtcagggagatggaggaaga
agctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccag
tgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagca
gaagagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcc
caaagggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctgtttagag
gaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgc
taccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgt
ctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2I3GEA7_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacttggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2I3GQS0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2A1 (length=528 residues).
atgacagactgcgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacagcctgg
atcaggtccaagcaaaacgtccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgtgtccatagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtcaagaaacttctacgacagcg
aactgccccggatgtggatacttacaaggagatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctctctttcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2I3GQS0_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2A1 (length=492 residues).
atgacagactgcgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacagcctgg
atcaggtccaagcaaaacgtccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgtgtccatagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtcaagaaacttctacgacagcg
aactgccccggatgtggatacttacaaggagatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcataatcacatgcctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2I3GQS0_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2A1 (length=618 residues).
atgacagactgcgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacagcctgg
atcaggtccaagcaaaacgtccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgtgtccatagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtcaagaaacttctacgacagcg
aactgccccggatgtggatacttacaaggagatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctcaatactgttgactagaaaggacactccatattgtgaaaccggcctaatttttctgactcttatgga
aacaattgccaacacatacttctactttaaaataaacaactttgatgatgtaacttga
>gnl|bcl2dbcds|A0A2I3GZF9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagccgg
ggcacacgccccatccagctgcatcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|G1R3W6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L10 (length=696 residues).
atggttgaccagttgcgggagcgcaccgagcggctgctggccgactacctggggtgctgcgcccgggaacccggcacccc
cgagccgacgccgtccacgcccgaggccgccatgctgcgctccgcggccgccaggttacggcagctccacccgtccttct
tctccgcctacctcggctaccctgggaaccgcgtcgagctggtggtgctgatggcggattccgtgctctccgacagcccc
ggccccacctggggcagagtggtgacgctcgtggccttcgcagggacgctgctggagagagggccgctggtgaccgcccg
gtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcgcctcgtggggcagcaccgcgcctggctgcaggctcagggcggctgggtgagcacgcggcggacaccg
ggacacggggcgggacgggcagccgggaagcgcccacgaggccggcacggatggcttttgtcacttcttcaggaccccct
ttccgctggctttttggagaaaacagctggtccaggcttttctgtcatgcttgttaacaacagccttcatttatttctgg
acacgattattatgagttttaaaacttttaacccgcttctacctgcacagctgtga
>gnl|bcl2dbcds|G1RER8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L1 (length=651 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggc
>gnl|bcl2dbcds|A0A1A7ZDF6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L1 (length=702 residues).
atgtctcaaaaccaagaactagttcttttctatattagatataaactgtcacagaggaactatcccctcaaccacatagt
cctcaatgaccccctaaacaggactggtgcgggggatgcggtggtggggggtgaggaggagaggacagagacacacgcca
atgggacctttaacaggacgagtcccgggaccccagcggcgtccccgctacggcagcagccgccggcgtccacgacggac
atggaccgggtgaaagaggccctccgagacacggccaacgagttcgagctgcgatacgcccgcgccttcaacgacctgca
cagccagctgcacatcacgcccgccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtca
actgggggcgcatcgtgggactcttcgcgttcggcggcgcgctgtgtgtagagtgcgtggagaaggagatgagtcccctg
gtggtcaggatcgtggagtggatgaccgtctacctggacaaccacattcagccctggatccagagtcagggaggatggga
gcgcttcgccgacatctttgggcacgacgcggcggctgaaagcaggaggttccaggagagctttaggatgtggctgctgg
tgggaatgaccgtgctcacggcggtcgtggcaggctcgctgttcgcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A1A8A2S0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L1 (length=660 residues).
atgccacacagtaacagagagctggtggagtactacatcagctacaagttgtcccaaaggaactgtcccatgtctctgct
ggggccagaggatgggggtaagaagactcgggaggactgggacaattcagctgctagcaatggccggctggtcagcagca
gggacagcccaccagggaagacttgtgccccccgtggtggcatggaggcagtgaaatcagctctaaaggactcagcagat
gagtttgaacttttatacgcacagagttttagtcacctttccctgcagctcgatatcacgccagacacggcctaccacag
cttcaagagcgtgctggacgagctgttcagagatggggtaaactggggacgggtggtgggcctctttgtctttggggggt
tgctgtgtgtgcagtgtaaggagaggaatttaagcgagctggttccccgcattgcagactggatgaccacctacctggat
gatcagatcgggctgtggatcagcagccaaggaggatgggactgttttgcagagatttatgggcgaggagctgcggcaga
ggcaaggaggttccaggagaccctgaagaagtggctgttagcaggagtgctgctgctgtcaggggtgctgctcggtgtgc
tcattgcaaagaaacggtga
>gnl|bcl2dbcds|A0A1A8A7I9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=MCL-1 (length=822 residues).
atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctcaaaatggagtcgtggatggaccattacacta
cggaccgggagattcccctcctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagagtccggtgacg
gccccaaacgcccgagcaacctggaagtgtctccgcacaatggatttgctgctaaacgcttcagccacgaggaggaggac
ggctctctgccgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggtcatgccggagatgaggcgct
ggcgaacgacaccagacaactaatcaaccgcttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatggctgcgaaa
tgcacttccgatgacctgacgttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaactggggtcggat
cgtgagcctgctggccttcggggcggtggtggcccagtaccagaaggacaacgggaggcaaaacaacgtagagctagtca
gccatgaggtttcaacctacctgttgtctcaacagagagactttctgctcagaaacaactcatggcaaggctttgtggag
ttctttcgtgtaacagacccagagtcaacagtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
tctagccctgctgatcaggtga
>gnl|bcl2dbcds|A0A1A8A7I9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=MCL-1 (length=873 residues).
atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctcaaaatggagtcgtggatggaccattacacta
cggaccgggagattcccctcctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagagtccggtgacg
gccccaaacgcccgagcaacctggaagtgtctccgcacaatggatttgctgctaaacgcttcagccacgaggaggaggac
ggctctctgccgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggtcatgccggagatgaggcgct
ggcgaacgacaccagacaactaatcaaccgcttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatggctgcgaaa
tgcacttccgatgacctgacgttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaactggggtcggat
cgtgagcctgctggccttcggggcggtggtggcccagtaccagaaggacaacgggaggcaaaacaacgtagagctagtca
gccatgaggtttcaacctacctgttgtctcaacagagagactttctgctcagaaacaactcatggcaaggctttgtggag
ttctttcgtgtaacagacccagagtcaacagtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
tctagccctgctgatcagttgttgcaggcatgacaccagttttcagacagttccctcaataccttcatattga
>gnl|bcl2dbcds|A0A1A8A7I9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=MCL-1 (length=822 residues).
atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctcaaaatggagtcgtggatggaccattacacta
cggaccgggagattcccctcctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagagtccggtgacg
gccccaaacgcccgagcaacctggaagtgtctccgcacaatggatttgctgctaaacgcttcagccacgaggaggaggac
ggctctctgccgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggtcatgccggagatgaggcgct
ggcgaacgacaccagacaactaatcaaccgcttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatggctgcgaaa
tgcacttccgatgacctgacgttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaactggggtcggat
cgtgagcctgctggccttcggggcggtggtggcccagtaccagaaggacaacgggaggcaaaacaacgtagagctagtca
gccatgaggtttcaacctacctgttgtctcaacagagagactttctgctcagaaacaactcatggcaaggctttgtggag
ttctttcgtgtaacagacccagagtcaacagtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
tctagccctgctgatcaggtga
>gnl|bcl2dbcds|A0A1A8VCB0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L10 (length=768 residues).
atgggcggagggctaaatgcgcagaagggaagcggtgattgccccgaggttctccttccgccgtctggatgtggcgagag
ctgtcacctaccgctgggaggagaacatgggaccagtgatcgggccagcatgtctacgtccggaccatgggtccctacca
ggggcgtggctagcctctcttacagcaaaatgtcctgtgggctgtggaatgatactctggctgtggccgaggattacctg
tccacgtgctgctgcggcccaaatccagcccctccacctcccagcgagacagccgctgccatgaggcgtctggcccagga
tatggagacccagcaccagacccgtttccactctctggctcagaacttcctgaagcgctgcgggccagacatctgctcta
gcctcaggaaggtgatggacgagatggctggagacggacactttaactgggggcgggttgtgtccctctttgcttttact
ggggtgctgatcagacagctgcaggagcagaggacctccagaccggggctggaccctgggcaagagctggaaccgaagct
catcagctgtcggttgctggcggagaccatagctgattacctggtgaagcacaagaaaggctggctgttggagaatgaag
gatgggaaggcttcagccagtactcccacaacaccagaccagtaagtctggactcctccatgaagacagcgctggttgct
gttgctggagttggcctggctgggctaacctttctcctggtgcgctag
>gnl|bcl2dbcds|A0A1A8VCB0_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L10 (length=615 residues).
atgtggcgagagctgtcacctaccgctgggaggaaaatgtcctgtgggctgtggaatgatactctggctgtggccgagga
ttacctgtccacgtgctgctgcggcccaaatccagcccctccacctcccagcgagacagccgctgccatgaggcgtctgg
cccaggatatggagacccagcaccagacccgtttccactctctggctcagaacttcctgaagcgctgcgggccagacatc
tgctctagcctcaggaaggtgatggacgagatggctggagacggacactttaactgggggcgggttgtgtccctctttgc
ttttactggggtgctgatcagacagctgcaggagcagaggacctccagaccggggctggaccctgggcaagagctggaac
cgaagctcatcagctgtcggttgctggcggagaccatagctgattacctggtgaagcacaagaaaggctggctgttggag
aatgaaggatgggaaggcttcagccagtactcccacaacaccagaccagtaagtctggactcctccatgaagacagcgct
ggttgctgttgctggagttggcctggctgggctaacctttctcctggtgcgctag
>gnl|bcl2dbcds|A0A8C6YT47_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nothoprocta perdicaria GN=MCL-1 (length=705 residues).
atgggggtcacagtggtgacaggcatccttggcagtgctcgaggggcagtggatgtatcggggcgggggcagagtgagac
cgacattgggggaccacagcagtgctatagggcccaacgccgccgggggcgggtgcaggcttggcggtgctataggggcc
atgcctataaggaccaacacggggggggggagggggcgggatcaggcccagctaagctcttctcgggccttctcagcggc
cccggccggcccggcggcgcgggccttatggagaaggcgctcgagacgctgcggagggtcggcgacggcgtcatgcgcaa
gcacgagctcgccttccaaggaatgctgcggaagctggaaatccagaaggaggaagacctgcagtcagtgtctgaggtgg
ctgtccatgttttcagtgatggagtaacaaactggggtagagttgtgacactcatctcatttggtgcctttgttgcaaaa
cacctgaagagcataaaccaggagaaatgcatcccttcgttagcagggatcatcacagatgctctcatctcatccaaacg
agagtggcttctgagccaaggaggctgggagggttttgttgacttctttcaagtagaggacctagaacgaagcatcagaa
atgtcctcgtggcttttgcggggtttgctggactgggagcaagcctggcgtacatgatccggtga
>gnl|bcl2dbcds|A0A8C6ZF48_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nothoprocta perdicaria GN=BCL-2 (length=723 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctcaagtacatccattacaaactctcgcagagggg
atacgactgggcggccagcggcgaccgcgcgccggcctccccggcgctctcccctcctgctgctgctgctgctgctgctg
ctcctgctgctgctgggactccctctgatcacactgggccggtgtctcggcaccccgagccccccggctcggctgctgct
agtaacgagggcgaggggctgcgcccggcgccgcccggcgtccacctggccctgcgccaggccggcgatgagttctcgcg
ccgctaccagagggacttcgcgcacatgtccggccagctgcacctgacgcccgtcacggcgcgcggccgcttcgtggccg
tggtggaggagctcttccgagatggcgtcaactgggggaggatcgtggccttcttcgagttcggcggcgtcatgtgcgtg
gagagcgtcaaccgggagatgtcgccgctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgca
gaactggatccaggacaacggcggatgggatgccttcgtggagttgtacggcaacagtatgcggcctttgttcgatttct
cctggatctctctgaagactatcctaagcctggttctggtgggagcttgcatcactcttggcgcttatttcggacataag
tag
>gnl|bcl2dbcds|A0A8C6ZVQ3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Nothoprocta perdicaria GN=BCL2A1 (length=525 residues).
atggaaactgctgagttttattacgtgtattatttaactcacgattatctgcagtatgtgcttcaagaatcacatcttgg
accagcccaaaccagagttgctcacgtcctgcgaaacattgcgtcctcactgcaagatcaaacagaggaggctctgcgac
ccatcttggataggattgatattgactctgtagatgttgccaagagaattttcaatggagtcatggaagaaaattttgct
gatggaaataccaactggggacgaatcacgaccatattcacctttggaggacttctcaccaagaagcttcaagagcacgg
agttcagctcactggagaggagaaggagcagatttcttacttcatcacagagtacatcataaataacaaagctgagtgga
tagatgcgaatggtggctgggaaaatggcttcctgtcgaagtttgaaaggagatcactactatctctctccaaaattaca
gcccttttgatggcttttttctccctgttcagggagtactactga
>gnl|bcl2dbcds|A0A8C7ECQ9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nothoprocta perdicaria GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcgcagaaggggtacagctggagtcagct
gcaggaggaggatgagaacaggactgactttgcggtagaccccgaggtggacggcgtcctcaacgggagcccgtcctggc
accccccgggcagccacatagtaaacggagccgctgtgcacaggagcagccccgaagtccgcgagatcgtccacgccgcc
gacgtgaggcaggcgctgaaagaggcgggggacgagtttgagctgaggtaccggcgagcgttcagcgacctcacctcgca
gctccacatcacccccggcacggcctaccagagcttcgagcaggtggtgaacgaactgttccgcgacggcgtcaactggg
gccgcatcgtggctttcttctccttcggcggggcgctgtgcgtggagagcgttgacaaggagatgcgggtattggtggga
cgcattgtagcttggatgaccacgtacttgaccgaccatctagatccctggatccaagagaacggcggatgggagcggtt
cgtggacctctacgggaatgatgctgctgccgagatgaggaagggccaggagagcttcaacaaatggctcctgaccgggg
ccaccgtggccggggtgcttctgctgggctccctgctgagccgcaagtga
>gnl|bcl2dbcds|C3VIT1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Odontesthes bonariensis GN=BCL2L1 (length=708 residues).
atgtctcaaaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcctctcaaccacatagt
gctcaatgagcctccgaacaggactggtgccggggacgggggtctgggcgaggagcagagcacagagacgcacgccaacg
ggacttttaccgggaccagtcccgggaccccgccggtgtcccctctgaggcagcaaccgttgccgtcgacgacgacgacg
acgcgcctggacgcggtgaaagaggccctccgagacacggccaacgagttcgagctgcggtacgcccgcgccttcagcga
cctccacagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacg
gcgtcaactggggtcgcatcgtggggcttttcgctttcggcggggcgctgtgcgtggagtgcgtggagagggagatgagc
cccttggtgggcaggatcgtggagtggatgacggtctacctggacaaccacattcagccctggatccagagccagggagg
atgggaacgcttcgctgagatcttcgggcaggacgcggcggccgaaagcaggaggtctcaggagagcttcaagaagtggc
tgctggtggggatgaccgtggtgaccggggtggtggtgggctcgctgttcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7CBC7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggggatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgtgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A8C7CBC7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=837 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggggatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgtgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtttgtgtgttaccctgtataccctaggaccaactacatacattctttccaaatggacacttta
cataacattgaagattctaaaatattgtttttatttagtgtgctccaagaagttaaaccaaacctgttttcatttgacat
tttctttaagtgttccgttccttccttgctgtgctga
>gnl|bcl2dbcds|A0A8C7CHJ0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL-2 (length=693 residues).
atgatggcaaacgataatccttataacagtcgctttattgttgaaaaatacatacatcacaaactgttgaagaagggatt
tgtatgggaattttatccagaaaacgattccccaaataatggttttggggagccctctccccctaactcccctgaagttt
ttgcacggaggtcccaaccctccgccgaaggcgtggacactgactctccgctccaaaacaggatcccgcaaccggaccga
catgcccggctccatagggtgctgcgcgaggcgggggacgagattgaaataatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacgcccagtacggcacagagaaggtttactgctgttatagaggagctcttcagcgacggtgtaa
actggggtcggattgtggctttctttgaatttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacattgcccattggatgacagagtacctgaacggacccctgcagaactggatccaggagaatggtgactggga
cgcctttgtggagatctatgggcagcagaggatctctgccttccactcctggccctacctaaagacagtgttcggcctgg
ccgccctgggtgcagccggagtcaccattggagccttgttcatccagaagtga
>gnl|bcl2dbcds|A0A8C7FX38_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtagtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgagggagatgaggccattgcaaatgggtctgtggggaactactggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgag
tttgagctgcgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggtggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagattggatgaccacatacctggacaac
catatccagccctggatccagagccaaggaggatgggaccattttgcagagatctttggcagagatgctgctgcagatgt
tcgacggtcccaggagaacataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctca
tcatgaagaaacgccaatga
>gnl|bcl2dbcds|A0A8C7G8X1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL-2 (length=681 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgccgaggaggaggaaggtgctgctaataatgggtcgatgatttctcctcggccgggtttggcacggcggtgcc
acggggccaataacggcggaccgggcagcgtccctagtctttccaaatggctctcccaaccggacccgcatgcagctatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagcccgactttgcagagatgtcacaccagctgta
tctcacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacgtcgcaggtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcaactggattcaggagaacgggggatgggaggcttttgttga
gctctatgacagacagagggactcggtgttctgttcgtggccgtccatcaagaccgtcttcggcctggctgcactggggg
ccgcaagccttaccatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A8C7H1W6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=867 residues).
atgagtctgttgtcgtcgtcgattgcccgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagc
tgatgatgctagccctttgtactatatcgacggggccgtatgtgctggggcgtcaccgaagtctaaagtggacttgggaa
atgggaccggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacgtcctcgataatcatttg
tcagaccgaagcaacaatgacgattctttgccctgcactcctcagatggcgtcagaatgtgggcctgaactattggaaca
tgataccagacaactcattgatgatatgttgagggaatacacaggactgtctcagcctcgatggaagcaaagcaagtatc
ttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatgcatacaatggtatggtcgtcaaacttgac
ttggatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccatgttcagtgatgggatcacgaactgggg
tcgcatcgccagcctggtggcatttggcgcagtggtgagccagcacctgaaggagagtggcaggggacactgcgttgatt
tggtgggccgagagattgccacatacctcctctctgaccaaagggactggctggtcaaaaacaatgcttggaatggattt
gtagagttttttcatgttcaagatcctgagtcctcggtaaggaacaccctcctagcctttgctggagttgctgggattgg
ggcaacacttgccatgttgatcagaaagtgccctgctctaccccaggggtgtgtggtgtgtttgtga
>gnl|bcl2dbcds|A0A8C7H1W6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=825 residues).
atgagtctgttgtcgtcgtcgattgcccgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagc
tgatgatgctagccctttgtactatatcgacggggccgtatgtgctggggcgtcaccgaagtctaaagtggacttgggaa
atgggaccggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacgtcctcgataatcatttg
tcagaccgaagcaacaatgacgattctttgccctgcactcctcagatggcgtcagaatgtgggcctgaactattggaaca
tgataccagacaactcattgatgatatgttgagggaatacacaggactgtctcagcctcgatggaagcaaagcaagtatc
ttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatgcatacaatggtatggtcgtcaaacttgac
ttggatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccatgttcagtgatgggatcacgaactgggg
tcgcatcgccagcctggtggcatttggcgcagtggtgagccagcacctgaaggagagtggcaggggacactgcgttgatt
tggtgggccgagagattgccacatacctcctctctgaccaaagggactggctggtcaaaaacaatgcttggaatggattt
gtagagttttttcatgttcaagatcctgagtcctcgaaaatggactatgcccgcaagttctctgaaatccttgatagcac
catggttggaatgagtacccagtga
>gnl|bcl2dbcds|A0A8C7H400_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=909 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacccctttgtgctatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatataatagca
aagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcatcaattc
tgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcagtggtga
gccagcacttgaaggagattggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctctctgac
caaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagt
aaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcagacagtgccctgctc
taccccaggggtgtgtggtgtgtttgtga
>gnl|bcl2dbcds|A0A8C7H400_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=882 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacccctttgtgctatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatataatagca
aagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcatcaattc
tgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcagtggtga
gccagcacttgaaggagattggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctctctgac
caaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagt
aaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcaggaattcagcagatt
ag
>gnl|bcl2dbcds|A0A8C7IJ10_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=693 residues).
atgtgtattaacctacctgaactggtggtatactatattacctataaactatcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgaggggggacaggtggaagggggggcggcagtcacgacacaccccaatggca
cagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggcctggacgca
gtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagct
acacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtgaactggggac
gtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagcccactagtgggacgg
attgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatgggaccggtttgc
agagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgcttgctgggatga
cactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7IJ10_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=696 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgaggggggacaggtggaagggggggcggcagtcacgacacaccccaatg
gcacagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggcctggac
gcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctccca
gctacacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtgaactggg
gacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagcccactagtggga
cggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatgggaccggtt
tgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgcttgctggga
tgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7J9N8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtatactatatcacctataaactatcacagagggactaccccttcaacca
catggagctcacagaagcccagaatcggactgagggggggcaggtggaagggggtgcggcagtcatgacatacgtcaacg
ggacgagtcccggtactcctccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagctttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctatcagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctatctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggtttctggcggggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7N2B4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=963 residues).
atggcatgtcctgacattggtaaccgcgtcaaggcaacgttgaagcatctgaaagtggcagggtctatcgacagcactcc
tttgttcactagcagaggacctgaacatgagtacagatggggagacctcgaaacggatagctccttagcttacggcagca
aacactttggtgtactaggagagtctgccaacatgtaccaccttccaaatacggttgacacacacaaatgtttcatgtgt
aacctcgaaatcaagaactttgttgagaacgacaccctgctaggtgagcacatctttcacgtgtacaacacaagcggacg
ctgtaagtaccttaccgataggtacacgaatcgagaagacgagatgatgctcttactggggaaggaacggtacaggaggg
gaaaaattgcattccctgatagcatcatcaccaactcgaccggagccctggacaccgacaccaggcaactcattaaatgt
gtcctaggacaatgtacgggacttctgaaacctaggtggaacgaaagcaaagctctgtcaacaatgagtagagttatcgg
gcagttactagagaagcacagatacacatacaacggtatgatcaacacactctatgtggatgacagaggggataacgtga
agttcctcagtgcagtagcccatagcatctttgaagacgggaccgtcaactggggccgtgttgccagcctgacatctttt
ggggctgcggtgtgccggtacttgagaggcaaggggagagacaactgtgtggatttggtgggagaggagatatcagagta
cctggtcactcaccacaaggactggctagtcaaacataactcctggaatgggttcgtggagttctttccagtagcagaac
ctgagtccagatgtcggaacatcatcatgaccatttttggattggctggtattggggcaacaatgaccttcttggttatg
tga
>gnl|bcl2dbcds|A0A8C7N3I9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL-2 (length=675 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggaagatgctgataataatgggtcgatgatttctcctccgcctggtttggcacggcggtgccacggag
ccaataacgccagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacccgcatgcagctattcacaga
gttttgcgtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtcg
ccttcttcgagttcggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccggg
tggatgacggagtatctaaatggaccgctgcacaactggattcaagagaacgggggatgggaggcctttgttgagctcta
tgacagacagagggactccgtgttcggttcatggccgtccatcaagactgtctttggcctggctgcactgggggccgcaa
gccttaccatcggagcttaccttacacagaagtga
>gnl|bcl2dbcds|A0A060XE41_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgacggagatgaggccattgcaaatgggtctgtggggaactaccggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgag
tttgagctacgctacacccgtgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattggatgaccacctatctggacaac
catatccagccctggatccagagccaaggcggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgt
tcgacggtcccaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctca
tcatgaagaaacgccaatga
>gnl|bcl2dbcds|A0A286MU87_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgacggagatgaggccattgcaaatgggtctgtggggaactaccggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgag
tttgagctacgctacacccgtgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattggatgaccacctatctggacaac
catatccagccctggatccagagccaaggcggatgggcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgccagtga
>gnl|bcl2dbcds|A0A8C7LPD4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=MCL-1 (length=849 residues).
atgagtctgtcgaagtcgattgcacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagctga
tgatgctagccctttgtactatttcgacggggccgtatgtgctgcggcgtcaccgaagtctaaagtggacttgggaaatg
ggaccggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacgtcctcgataatcatttgtca
gaccgaagcaacaatgacgattctttgccctgcactcctcagatggcgtcagaatgtgggcctgaactatcgaattgtcc
atcgggcgatgaagtattggaacatgatatcagacaactcattgagaattttttgggggactacacaggactgtctcagc
ctcgatggaagcaaagcaagcctcttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatgcatac
aagggtatggtcgtcaaacttgacctggatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccatgtt
cagtgatgggatcacgaactggggtcgcatcgccagcctggtggcatttggcgcagtggtgagccagcacctgaaggaga
gtggcaggggacactgcgttgatttggtgggccaagagattgccacatacctcctctctgaccaaagggactggctggtc
aaaaacaatgcttgggatggatttgtagagttctttcatgttcaagatcctgagtcctcgaaaatggactatgcccgcaa
gttctctgaaatccttgacagcaccatggttggaatgagtacccagtga
>gnl|bcl2dbcds|A0A8C7P574_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=705 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgagggggatgaggggggacaggtggaagggggggcggcagtcacgacac
accccaacggcacagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatg
ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacct
gtcctcccagctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtg
tgaactggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagccca
ctagtgggacggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatg
ggaccggtttgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgc
ttgcggggatgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7PM33_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=MCL-1 (length=888 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcaggtggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagaaagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcat
caattctgtggccacgaccatgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagatgggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaacactcgccatgttggtcaggaattcag
aagattag
>gnl|bcl2dbcds|A0A8C7PM33_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=MCL-1 (length=876 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcaggtggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagaaagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcat
caattctgtggccacgaccatgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagatgggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaacactcgccatgttggtcaggtga
>gnl|bcl2dbcds|A0A8C7PM33_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=MCL-1 (length=933 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcaggtggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagaaagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcat
caattctgtggccacgaccatgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagatgggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaacactcgccatgttggtcagtctgttgg
attatagtggcggactgaattgggacagtgctttggtgtcaagctcaagttag
>gnl|bcl2dbcds|A0A8C7Q7B4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL-2 (length=690 residues).
atggcaaacgataatccttataacagtcgctttattgttgaaaaatacatacatcacaaactgttgaagaagggatttgt
atgggaattttatccagaaaacgattccccaaataatggttttggggagccctctccccctaactcccccgaagtttttg
cacggaggtcccaaccctccgccgaaggcgtggacactgactctccgctccaaaacaggatcccgcaacctgaccgacat
gcccggctccatagggtgctgcgcgaggcgggggacgagattgaaataatgtatcagcgggactttgcagagatgtcggg
gcagttgcattttacgcccagtacggcacagagaaggtttactgctgttatagaggagctcttcagcgacggtataaact
ggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaggta
gacaacattgcccattggatgacagagtacctgaacggacccctgcagaactggatccaggagaatggtgactgggacgc
ctttgtggagatctatgggcagcagaggatctctgccttccactcctggccctacctaaagacagtgttcggcctggccg
ccctgggtgcagccggagtcaccattggagccttgttcatccagaagtga
>gnl|bcl2dbcds|A0A8C7RD80_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggggatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgcattcagtgatctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggatgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccatagccaaggaggatgggaccgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A8C7RG50_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttataacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaaatgggatt
tgtatggaaatttcaaggagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccactgccgcgggagaggacaccgactctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgatgcgggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacatcgctcgttggatgacggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggccgtacttaaagacagtgttcggcctggccgccc
tgggagccgccggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A8C7UB69_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactagtggtatactatatcacctataaactatcacagagggactaccccttcaacca
catggagctcacagaagcccagaatcggactgaggggggacaggtggaagggggtgcggcagtcatgacatacgtcaacg
ggacgagtcccggtactcctccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagctttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctatcagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctatctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttgggatggacgctgcagccgagagcaggaagtctcaggagacctttaagaagtggcttctggcggggatgaccctgt
tcacaggagttgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8K9V051_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=MCL-1 (length=963 residues).
atggcatgtcctgacattggtaaccgcgtcaaggcaacgttgaagcatctgaaagtggcagggtctatcgacagcactcc
tttgttcactagcagaggacctgaacatgagtacagatggggagacctcgaaacggatagctccttagcttacggcagca
aacactttggtgtactaggagagtctgccaacatgtaccaccttccaaatacggttgacacacacaaatgtttcatgtgt
aacctcgaaatcaagaactttgttgagaacgacaccctgctaggtgagcacatctttcacgtgtacaacacaagcggacg
ctgtaagtaccttaccgataggtacacgaatcgagaagacgagatgatgctcttactggggaaggaacggtacaggaggg
gaaagattgcattccctgatagcatcatcaccaactcgaccggagccctggacaccgacaccaggcaactcattaaatgt
gtcctaggacaatgtacgggacttctgaaacctaggtggaacgaaagcaaagctctgtcaacaatgagtagagttatcgg
gcagttactagagaagcacagatacacatacaacggtatgatcaacacactctatgtggatgacagaggggataacgtga
agttcctcagtgcagtagcccatagcatctttgaagacgggaccgtcaactggggccgtgttgccagcctgacatctttt
ggggctgcggtgtgccggtacttgagaggcaaggggagagacaactgtgtggatttggtgggagaggagatatcagagta
cctggtcactcaccacaaggactggctagtcaaacataactcctggaatgggttcgtggagttctttccagtagcagaac
ctgagtccagatgtcggaacatcatcatgaccatttttggattggctggtattggggcaacaatgaccttcttggttatg
tga
>gnl|bcl2dbcds|A0A8C8CMB3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=MCL-1 (length=888 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgactccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgatttagatgaccgatgcgatgacatgagtttcat
caattctgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagattggcaggggacactgcattgagtctgtgggccaaaagatcaccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcaggaattcag
cagattag
>gnl|bcl2dbcds|A0A8C8CMB3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=MCL-1 (length=1401 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgactccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgatttagatgaccgatgcgatgacatgagtttcat
caattctgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagattggcaggggacactgcattgagtctgtgggccaaaagatcaccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcagccaaccac
caatacagaatcaaatacctgtagctcaggagtggattactagcatacctgtggtggtgttctcttcacccagtggttgc
aagcacactcattacagaataacacctcacctaaggggtgtcagtgtaaatgacgttgggtccttgagccgccacaggct
cccctgcctcagccggctcatcgggctttcatgcctcagccggatcgccagactcccctgcctcagccggctcatcgggc
tttcatgcctctgccagatcgcaagactcccctgcttccaccggcttgtcaggatctcatgcctcagccggtctgtcagg
ttcccgcgccccagccggctcgacaggttcccgcgcctcagccgacgtgacaggtttccacgcttcagcaggggtcacca
atctgctcctgatccctgggtttgtctcccttatcggcgccctgcggctggagccgcgcgtcggggagggggcagtgtca
cgtatactctctctccgacctctaggtcatcaggctgctga
>gnl|bcl2dbcds|A0A8C8D057_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=702 residues).
atgtgtattaacctacctgaactggtggtatactatattacctataaactatcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgagggggatgaggggggacaggtggaagggggggcggcagtcacgacacacc
ccaatggcacagtgaacgggacgagtcctgggactccaccgcgacagtctccccccttgtcccctcagcggacaatgggc
ctggacgcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtc
ctcccagctacacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtga
actggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagcccacta
gtgggacggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatggga
ccggtttgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgctgg
cggggatgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8D057_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=705 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgagggggatgaggggggacaggtggaagggggggcggcagtcacgacac
accccaatggcacagtgaacgggacgagtcctgggactccaccgcgacagtctccccccttgtcccctcagcggacaatg
ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacct
gtcctcccagctacacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtg
tgaactggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagccca
ctagtgggacggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatg
ggaccggtttgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgc
tggcggggatgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8FJG7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtatactatatcacctataaactatcacagagggactaccctttcaacca
catggagctcacagaagcccagaattgtactgagggggggcaggtggaagggggtgcggcagtcatgacatacgtcaacg
ggacgagtcccggtactcctccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagctttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctatcagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggtaggatcaca
gactggatgaccgtctatctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgccgagat
ctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggtttctggcggggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8GL24_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttataacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaagtgggatt
tgtatggaaatttcaaggagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccactgccgcgggagaggacaccgactctccttaccaaaacagcagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgaggctggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaa
gtagacaacatcgctcgttggatgacggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggtcgtacttaaagacagtgttcggcctggccgccc
tgggagccgccggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A8C8GSY4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggagatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgtgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatctttggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A8C8GSY4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=720 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggagatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgtgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatctttggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtttgtgtgttaccctgtataccctaggaccaactacatacattctttccaaatggacacttga
>gnl|bcl2dbcds|A0A8C8J941_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacagactgagggagatgaggccatttcaaatgggtctgtggggaactactggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcggtggatgag
tttgagctgcgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccatagctt
tgagagtgtgatggacgaagtgttcagggacggtgtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagattggatgaccacatacctggataac
catatccagccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgt
tcgacggtcccaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctca
tcatgaagaaacgccaatga
>gnl|bcl2dbcds|A0A8C8JWJ1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=675 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggaagatgctgataataatgggtcgatgatttctcctccgcctggtttgncacggcggtgccacgggg
ccaataacgccagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacccgcatgcagctattcacaga
gttttgcgtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtag
ccttcttcgagttcggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccggg
tggatggcggagtatctaaatggaccgctgcacaactggattcaagagaacgggggatgggaggcctttgttgagctcta
tgacagacagagggactccgtgttcggttcatggccgtccatcaagactgtctttggcctggctgcactgggggccgcaa
gccttaccatcggagcttaccttacacagaagtga
>gnl|bcl2dbcds|A0A8C8JWJ1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=810 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggaagatgctgataataatgggtcgatgatttctcctccgcctggtttgncacggcggtgccacgggg
ccaataacgccagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacccgcatgcagctattcacaga
gttttgcgtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtag
ccttcttcgagttcggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccggg
tggatggcggagtatctaaatggaccgctgcacaactggattcaagagaacgggggatggatctgcaggcacttccaaag
gagactccccagaggagaccccccagaggagaccccccaaagggaccccccagaggagaccccccagggagactcccaaa
gtagaccccccaaagggactccccagaggagacccccacaggagaccccccagagggaccccccaaggagaccccccaaa
ggagaccccccgaggaggaccccccagaggagaccccccagaggagacaccccagcaagctttgaacatgggaatacaca
cactgcttga
>gnl|bcl2dbcds|A0A8C8LPV9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=MCL-1 (length=849 residues).
atgagtctgtcgaagtcgattgcacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagctga
tgatgctagccctttgtactatttcgacggggccgtatgtgctggggcgtcaccgaagtctaaagtggacttgggaaatg
ggactggcgatactccacgacccacgacgttaggaatgaatgtcgtgaaaaccaacgtcctcgataatcatttgtcagac
cgaagcaacaatgacgattctttgccctgcactcctcagatggcgtcagaatgtgggcctgaactatcgaattgtccatc
gggcgatgaagtattggaacatgataccagacaactcattgagaattttttgggggactacacaggactgtctcagcctc
gatggaagcaaagcaagcctcttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatgcatacaat
ggtatggtcgtcaaacttgacttggatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccatgttcag
tgatgggatcacgaactggggtcgcatcgccagcctggtggcatttggcgcagtggtgagccagcacctgaaggagagtg
gcaggggacactgcgttgatttggtgggccaagagattgccacatacctcctctctgaccaaagggactggctggtcaaa
aacaatgcttggaatggatttgtagagttctttcatgttcaagatcctgagtcctcggtaaggaacaccctcctagcctt
tgctggagttgctgggattggggcaacacttgccatgttgatcaggtga
>gnl|bcl2dbcds|A0A668RI12_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oreochromis aureus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagcctttgaacaggactgatgggggggcggcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggacccctccggcatccccgcagcggcagcagcagccgccatcaacgacggacctc
gacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttcacag
ccagctgcacatcacgccggccacggcctaccaaagctttgagaacgtgatggacgaggtgttccgggacggcgtcaact
ggggccgcatcgtagggctttttgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttggtg
ggcaggatcgtagagtggatgaccgtctacctagacaaccacattcagccctggatccagagccaaggaggatgggagcg
cttcgctgaaatcttcgggcaggatgcggcggccgaaagccggaggtctcaggagagtttcaagaagtggctgctggtgg
ggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A668RLC9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis aureus GN=MCL-1 (length=837 residues).
atgaccaactatttgatgtcgaaaaggaaccagtttaccttcatagactatcttcttcctcaaaatggagtcccggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcatttggacagtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacatgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggttctgggatgcattattgtga
>gnl|bcl2dbcds|A0A668SNL1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis aureus GN=MCL-1 (length=723 residues).
atgttctccttaaattgctgtctgtctgagtggtgtccaaacaacgatgtgggctttatagataattgggaaaccctctg
taggaaacctggtcttgttaggagagacggcatccatcccactttggatggagcagctctcatttctagaaatctggaag
acggttcgttgccgagcaccccggagtttcatttggacagtgaatccgacgaggagctggagagagaaacgaaactcatt
attcacagttttttgggagactttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacgatgaaaag
agttgttgcggacgtattagaaaagcacagatatgcttacaacggaatgattaataaattgtcattggatgaaagagaag
aagatatgtcatttgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgtcagctttgtggccttc
ggagcagtggtgtctcagcacctgaaggaaaagggcagggacaactgcgtggtgctagtgagtcaagagatttctgcata
cttgctgtctgaacagcgagactggattatcaaaaacaatgcatgggatggctttgtggcgttcgttcgagtagcagacc
ctgagtcgatagtcaggaacacactcatggcctttgctggatttgcttgtattggagcaacactggcactgttgatcagg
tga
>gnl|bcl2dbcds|A0A668SSC1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oreochromis aureus GN=BCL2L10 (length=696 residues).
atgtcgagaggcggagtcacacattctctatcagctgaagggaagactcaactgtaccgacgctctccttccgccgtctg
tatgtgcagagagcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctgcttttggccg
aggactacctgtccttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagccgctgccatgaggcgt
ctgggctgggacatcgaaagacagcaccaagctcgcttcgacaacctcgctcagaccttcctggtgcagtgtgggccgga
ccactgcctcagcctcagaaaggtgatgaaggagctggttggagatggacacttgaactgggggagggttgtttctcttt
ttgcctttactggagtgctggccagaaagatcctggagcagaagccggggctggaccctgggcaacagcaggaactggga
caggagcccatgagctgcagaaggctggcagagaccatagctgattacctgggagaagagaagaaagactggctgttgga
taatgatggatgggaaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactcatccatgaagaaagcgc
tgtttgctgccgccggtgtcggccttgctgggcttaccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A668TEB6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=1017 residues).
atgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagcc
tctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctaca
agcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgcc
atcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaaca
ggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtgg
aggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctactc
cccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtgg
catacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctgaa
acctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagctctgt
cggtccagatggttacatgctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagg
atgcatttgtggagctgtacgacagacagagggactccgtcttcagctgctcctggccctccatcaagacagttttcggc
ttggctgcgctcggagcggccagtctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A668TEB6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=1080 residues).
atgtcctctgaagaagggttcagctcagcgataacagattggctttttatcaatacctggtggctccttcttccgttcat
catgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagc
ctctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctac
aagcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgc
catcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaac
aggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtg
gaggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccat
gaaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctact
ccccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtg
gcatacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctga
aacctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagctctg
tcggtccagatggttacatgctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcag
attgtcaccatgggattgtttcggaccatcgcacttttttacctggggagctttgacagcatcgtgcgccgctgtatgat
tcaaagggagcagtcaaaagcggccaataagagggagtaa
>gnl|bcl2dbcds|A0A668TEB6_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=894 residues).
atgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagcc
tctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctaca
agcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgcc
atcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaaca
ggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtgg
aggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctactc
cccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtgg
catacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctgaa
acctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcaattgtcaccatgggattgtttcggac
catcgcacttttttacctggggagctttgacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaaagcggcca
ataagagggagtaa
>gnl|bcl2dbcds|A0A668TEB6_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=561 residues).
atgtcctctgaagaagggttcagctcagcgataacagattggctttttatcaatacctggtggctccttcttccgttcat
catgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagc
ctctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctac
aagcaaggagcgttcatcactttggtggcacgagacgaggtggtgctctgcatctcagttgatgtttccagtgattacag
tcaagtggaaaacgtgataaaacaggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcag
tttctgggaagtttgaggaagtggaggtagatcgttttaaaattgtcaccatgggattgtttcggaccatcgcacttttt
tacctggggagctttgacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaaagcggccaataagagggagta
a
>gnl|bcl2dbcds|A0A668TEB6_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=687 residues).
atggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcggggatacgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggttcaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctccgccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggagtgaactggggccgga
ttattgctttcttcgagtttgggggcacggtgtgcgtggaatgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagctgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagtctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A669C7T2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=837 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggttctgggatgcattattgtga
>gnl|bcl2dbcds|A0A669C7T2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=972 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggacaaacactcactcaggtctcaggaagaaatggagagtgtctcgccatggtgatgatccacagc
aggcctcccctaatcttctcctgtggctaatgttatctaccacccaggttacccctgtagttaactgtgaagaacacact
ggtagacaatag
>gnl|bcl2dbcds|A0A669C7T2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=885 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacgacccgggaggtggaatggacaaaaggaaaaatgtttcaaattacattatttaa
ttcacagagatctatttttgctaaaagatgccataataaaaaggaaaaagacattttttttccttttttgctagtctttt
tttaa
>gnl|bcl2dbcds|A0A669EYA1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oreochromis niloticus GN=BCL2L10 (length=696 residues).
atgtcgagaggcggagtcacacattctctatcagctgaagggaagactcaactgtaccgacgctctccttccgccgtctg
tatgtgcagagagcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctgcttttggccg
aggactacctgtccttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagccgctgccatgaggcgt
ctgggctgggacatcgaaagacagcaccaagctcgcttcgacaacctcgctcagaccttcctggtgcagtgtgggccgga
ccactgcctcagcctcagaaaggtgatgaaggagctggttggagatggacacttgaactgggggagggttgtttctcttt
ttgcctttactggagtgctggccagaaagatcctggagcagaagccggggctggaccctgggcaacagcaggaactggga
caggagcccatgagctgcagaaggctggcagagaccatagctgattacctgggagaagagaagaaagactggctgttgga
taatgatggatgggaaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactcatccatgaagaaagcgc
tgtttgctgccgccggtgtcggccttgctgggcttaccttcctcttggtgcgctag
>gnl|bcl2dbcds|I3IZK7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oreochromis niloticus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagcctttgaacaggactgatgggggggcggcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggacccctccggcatccccgcagcggcagcagcagccgccatcaacgacggacctc
gacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttcacag
ccagctgcacatcacgccggccacggcctaccaaagctttgagaacgtgatggacgaggtgttccgggacggcgtcaact
ggggccgcatcgtagggctttttgcgttcggcggggcactgtgtgttgagtgcgtcgagaaggagatgagccccttggtg
ggcaggatcgtagagtggatgaccgtctacctagacaaccacattcagccctggatccagagccaaggaggatgggagcg
cttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctggtgg
ggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|I3KXG5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=684 residues).
atgttctccttaaattgctgtctgtctgagtggtgtccaaacaacgatgtgggctttatagataattgggaaaccctctg
taggaaacctggtcttgttaggagagacggcatccatcccactttggatggagcagctctcatttctagaaatctggaag
acggttcgttgccgagcaccccggaagaaactaaactcattattcacagttttttgggagactttactggactttctcag
cctcaacgaaaggaaaccaaagcactaaaaatgatgaaaagagttgttgcggacgtattagaaaagcacagatatgctta
caacggaatgattaataaattgtcattggatgaaagagaagaagatatgtcatttgtagcgaagagcctctttggagacc
acacgaccaactggggtcgtattgtcagctttgtggccttcggggcagtggtgtctcagcacctgaaggaaaagggcagg
gacaactgcgtggtgctagtgagtcaagagatttctgcatacttgctgtctgaacagcgagactggattatcaaaaacaa
tgcatgggatggctttgtggcgttcgttcgagtagcagaccctgagtcgatagtcaggaacacactcatggcctttgctg
gatttgcttgtattggggcaacactggcactgttgatcaggtga
>gnl|bcl2dbcds|A0A6I8NSR7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=MCL-1 (length=1392 residues).
atgctgggcctgcagaagaacgccgtcatcggcctcaacctctactgcgggggcgccggcagcggcgcgggggcctcccc
gcccggagggcgcctgcggcccgacaaggcggcggcggtcggcgagggcccggcggcggcggcggcggcggcggcccggc
gcgcgggcgggggaggggaggccgcggcgccgctgattggcggaggcgccggcgcgagcccctcggcggcggccggcctg
ggggtcgcgcgcccggcccccattggcgccgagggccctgacgtcatcgggaccctcgcgcccgcccggcgcgcgccgcc
tgaggggacggagccgccgccgccgtcggccgccgccgccgccgccgccctcctccgccccgaggacgaactggacggct
acgagcccgaggccccggccaaacgtccggcccacctggccgtgctggacctgcccggccaggccggcggctccctgccc
tccacgccgccgcccgacgaccgcgacgacatggcggacgggctgtaccgccagtccctggagctcatcacccactacct
ccgcgagcaggcggccggacggaaggacgagccccggggccgggaccgccgggcgctggagaccctgaggagggtgggcg
acggcatccagcgcaaccacgagaccgccttccagggtgagggaggcctccggcgcatgcgcgaagcgggcgcgcccctc
cccccccctccgtcctacgtactgagcgccctcccggagcctaatggcacccctccccccccccccgtcccctctccccg
caggcatgctccgcaagctggacatccagaaggaggaggacctgaaggccgtgtcccgcgtcggcacccacgttttcaac
gacgggacgacgaactggggccgcatcgtgacgctcatctctttcggcgccttcgtggccaagcacttgaagagcatcaa
ccaggagggctgcatcgaccccctggccgagagcatcacggaggtcctggtgaccaccaagagggactggctggtcaaac
agaaaggctgggaaggatttgtggaattcttccacgtggaggacatggaaggcagcgtccggaacgtgctcctgctcttc
gccggggtggccagcctgggagccggcttggcctatctaataagatgatggggggacccccccccccttccccctcggac
gctcagagactgacttcacatcggagcagaccagccccaggcgccggccacccgtcggaactgtcgcttctgccgccggg
aagctttatttatgaagcccagcgtccagccgcccagaattggcaccgacaggcaccgagcggcggcccagccaggcaag
agggtttgggctggtttggggacggatattaa
>gnl|bcl2dbcds|A0A6I8NSR7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=MCL-1 (length=1041 residues).
atgctgggcctgcagaagaacgccgtcatcggcctcaacctctactgcgggggcgccggcagcggcgcgggggcctcccc
gcccggagggcgcctgcggcccgacaaggcggcggcggtcggcgagggcccggcggcggcggcggcggcggcggcccggc
gcgcgggcgggggaggggaggccgcggcgccgctgattggcggaggcgccggcgcgagcccctcggcggcggccggcctg
ggggtcgcgcgcccggcccccattggcgccgagggccctgacgtcatcgggaccctcgcgcccgcccggcgcgcgccgcc
tgaggggacggagccgccgccgccgtcggccgccgccgccgccgccgccctcctccgccccgaggacgaactggacggct
acgagcccgaggccccggccaaacgtccggcccacctggccgtgctggacctgcccggccaggccggcggctccctgccc
tccacgccgccgcccgacgaccgcgacgacatggcggacgggctgtaccgccagtccctggagctcatcacccactacct
ccgcgagcaggcggccggacggaaggacgagccccggggccgggaccgccgggcgctggagaccctgaggagggtgggcg
acggcatccagcgcaaccacgagaccgccttccagggcatgctccgcaagctggacatccagaaggaggaggacctgaag
gccgtgtcccgcgtcggcacccacgttttcaacgacgggacgacgaactggggccgcatcgtgacgctcatctctttcgg
cgccttcgtggccaagcacttgaagagcatcaaccaggagggctgcatcgaccccctggccgagagcatcacggaggtcc
tggtgaccaccaagagggactggctggtcaaacagaaaggctgggaaggatttgtggaattcttccacgtggaggacatg
gaaggcagcgtccggaacgtgctcctgctcttcgccggggtggccagcctgggagccggcttggcctatctaataagatg
a
>gnl|bcl2dbcds|A0A6I8PIR3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L1 (length=615 residues).
atgtctctgcggaactacgacctggtgagagacttcgtctcctacaagctggcccagcgcgggcacgactggagccggct
ggtcgacccggaggccccggacacgggggccgagggggccgaggggggccgggcggccccggcggcggcggaggacgacg
acgaggccgtgaggcggaccctgagggaggccggggacgagttcgaggtgaggtaccggcgggcgttcagcgacctggcc
tggcagctgcacatcaccccggccacggcctaccagagcttcgagcaggtggtcaacgagctcttccgcgacggcgtcaa
ctggggccgcgtggtggccttcttcgccttcggcggggccctctgcgtggagagcgccgacaaggagatgggccccctcg
tcggacgcgtcgggagctggatggccacctacctcgaccgccgcctcgacccctggatccgagacaacggaggctgggac
acgttcgtggagctctacggcaacgacgcggccgcccagagccggaaggaccaagaacgcttcaaccgctggctgctcac
cggcctcaccgtggccgccgtcctgctgctcggctccctgttcacccgcaagtga
>gnl|bcl2dbcds|F6S8G3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2A1 (length=528 residues).
atggacgacggtgtattctggtccgtccgagccctggctctggactatctggatgacgtcctccagacgccgcgacttgg
gacggtcccaagcagaacttctcgggcgctgcaaaacgtcatgttctcggtccagggggacgtggagaaggctctgaagc
cgtgcttcgacagtctcgacgttggctcggtaggggcagccagaagaatcttcggccaaattgtggaaaaggagttcgag
gacggcatcgtcaactgggggcggattgtgacgatatttgtcttggggggcattctcaccaagaagctccaaaggagcgg
agtcccgctgacgagagagactcgggaggagatttcttgtttcatcgcggagttcaccacccaccacgccggagagtgga
taaggcagaacggaggctgggaaaatggatttttaaataagtttgaacaaaagaccgtctggtcggtgttagcggatatt
tcgatgaagatcttgggcgtactctcccacctgaagcaattttactga
>gnl|bcl2dbcds|F7G6M3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L2 (length=588 residues).
atggcgaccccggccccggcctcggtctcagacacccgggccctggtggcggactttgtgggctacaagctgcggcagaa
gggcttcgcctgcggggccgggcccggggagggccccccggcccagcccctgcaccgggccatgcgggccgccggggacg
agttcgagtcacgcttccggcgggccttctcggacttggcgtcccagctgcacgtgacgcccggctcggcccagcagcgc
ttcacccaggtgtcggacgagctcttccagggggggcccaactggggccggctggtggccttcttcgtgttcggggccgc
gctctgcgccgagagcgtcaacaaggagatggagcccctggtggggcaggtgcaggactggatggtggcctacctggaca
cccagctggccgactggatccgcagcagcgggggctgggcggagttcacggccctgtacggggacggggccctggaggac
gcccggcgcctgcgggagggcaactgggcctccgtccggaccgtgctgacgggggccgtggcgctgggagccctggtgac
cgtcggggccttcttcgcgagcaagtga
>gnl|bcl2dbcds|A0A5F9CRQ4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL-2 (length=681 residues).
atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaagtacatccactataagctgtcccagagggg
ctacgagtgggacgctggggacgcgggcgccgcctccgcgccgggcgtcttctcctcccagcccgcgcccgctgcgcccc
gggacccggccgccaggacctcgccgccgccgccgccggccgccgcggggcccgcgctcagcccggtgccacctgtggtc
cacctgaccctccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcggagatgtccagccagctgca
cctgacgccctttcacgcgagggggcgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggagga
ttgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatc
gccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataatggaggctgggatgccttcgtgga
actgtacggccccagcgtgcggcctctgtcagacttctcctgggtgtctctgaagactttgttcagcctggccctgatag
gagcttgcatcaccctcggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A5F9CRQ4_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL-2 (length=1170 residues).
atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaagtacatccactataagctgtcccagagggg
ctacgagtgggacgctggggacgcgggcgccgcctccgcgccgggcgtcttctcctcccagcccgcgcccgctgcgcccc
gggacccggccgccaggacctcgccgccgccgccgccggccgccgcggggcccgcgctcagcccggtgccacctgtggtc
cacctgaccctccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcggagatgtccagccagctgca
cctgacgccctttcacgcgagggggcgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggagga
ttgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatc
gccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataatggaggctgggcagacaaaagccc
ttggatctcggggtgtctttgtacttctcggagagccaccccaggagcacattccctgacggagggctcagccacctctt
ccgcctcattatactctgctcagcaccgagaagcctggcatggtttctgctggaatgaaaagattggcagagctgcccta
gacaacagcaccgcaaaacactgtggcagaaggtttggtctacataccaaggcagccaaagtattaattgcattctctgt
gatcgcaaaaaaggcgctgaattcttctcttcacgttttcagaatgacagacttctgctctgccagctctgagcacagcg
catcacatggaaaggagcggctagatttgagggggaaaactcagaagacggatgatggtagccagctagttcttcaaaaa
gagttccccgtgaactgtttcggaactgtggaaggtcagaagcagagtaaggatgtacttccatgcatttacataatcta
cgaagccttttcccatcttgaagtcttactttatgtgttgcagtgggacctggccagctgccagctgcagtttgagccca
tttccttttgcattggtttctgtgtccagggaaaccttgtttctctatga
>gnl|bcl2dbcds|A0A5F9CXI7_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2A1 (length=852 residues).
atgttcgcctcccagggcttcggaagcttccagaagaagcagtcaccggctctgctctccgagcagcagaagatgagtga
ctgcgagtttggctatgtgcacacactggctcaggactatctgctgtacatcctgaagacgccacagcctggactgggac
cgagcaaaacgtccagggtgctgcagaacgtcaccttctccatccagcaagaagtggaagaggctctgcaaccgtacctg
cacaatgtgcctgtcgcgtccgtcgagactgccaggacaattttcaaccaagtgatggagaaagagtttgaggatggtgt
gatcaactggggcaggattgtgaccatatttgcattcgaaggggtcctggccaagaagctcctccaggagcaggctgttc
cggatgtggacacgttcaagtccatcccttattttgtggctgagttcataacgaggaggatgggagaatggataaggcaa
aacggaggctgggtgattgcccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatgccggatgaaat
cgagacagaagagatcatcaaggatatcttccagcaaggcaaagtctgctttatcccccgctaccggttgcagagcaatc
acatggatatggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcctggaacattcatcagccgagt
gagagtgacacgcgggaggaggccttggccaccgatgcacacatgcagatgagcagagaaggctatggaagagaagaacc
cagcgcacagggaaggctgttctctctggagggcggtaggcagaaatgttaa
>gnl|bcl2dbcds|A0A5F9CXI7_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2A1 (length=567 residues).
atggcggcggcggcggctgtgagcggcgccaagcggagcctgcgggccgagctgaagcagcgtctgcgggccatcagcgc
cgaggagcgactgcgccagtcccgcctactgacccagaaggtgattgcccaccggcagtatcagaaatcccagagaatct
ccatcttcctgagcatgccggatgaaatcgagacagaagagatcatcaaggatatcttccagcaaggcaaagtctgcttt
atcccccgctaccggttgcagagcaatcacatggatatggtgaaattagcgtcagcagacgaaatttcttcacttcctaa
aacctcctggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggccaccgggggcctcgacctcatct
tcatgccgggcctcgggctttgccccctgctgctgcttttgctactccgacatccgttcttcgcttgctgctcaggtgcg
gagtttacgcttcctcttcttgctctcggaacgccagcatggtctggagaccagcggctgatactcctaagagcttctct
ttgttga
>gnl|bcl2dbcds|A0A5F9CXI7_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2A1 (length=996 residues).
atgttcgcctcccagggcttcggaagcttccagaagaagcagtcaccggctctgctctccgagcagcagaagatgagtga
ctgcgagtttggctatgtgcacacactggctcaggactatctgctgtacatcctgaagacgccacagcctggactgggac
cgagcaaaacgtccagggtgctgcagaacgtcaccttctccatccagcaagaagtggaagaggctctgcaaccgtacctg
cacaatgtgcctgtcgcgtccgtcgagactgccaggacaattttcaaccaagtgatggagaaagagtttgaggatggtgt
gatcaactggggcaggattgtgaccatatttgcattcgaaggggtcctggccaagaagctcctccaggagcaggctgttc
cggatgtggacacgttcaagtccatcccttattttgtggctgagttcataacgaggaggatgggagaatggataaggcaa
aacggaggctgggtgattgcccaccggcagtatcagaaatcccagagaatctccatcttcctgagcatgccggatgaaat
cgagacagaagagatcatcaaggatatcttccagcaaggcaaagtctgctttatcccccgctaccggttgcagagcaatc
acatggatatggtgaaattagcgtcagcagacgaaatttcttcacttcctaaaacctcctggaacattcatcagccgagt
gagagtgacacgcgggaggaggccttggccaccgggggcctcgacctcatcttcatgccgggcctcgggttcgacaggga
cggcaaccggctggggaggggcaggggctactacgacacctacctgcagcgctgcctgcagcagcagggggcaaagccct
acaccatcgccctggccttcagagagcagatctgcccccaggtgcccgtggacgacacagacatgagcgtcgacgaggtg
ctgtacgtggacgcggccgcttccctcgcgccctga
>gnl|bcl2dbcds|A0A5F9CXI7_BCL2A1-04 BCL2-related protein A1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2A1 (length=624 residues).
atggcggcggcggcggctgtgagcggcgccaagcggagcctgcgggccgagctgaagcagcgtctgcgggccatcagcgc
cgaggagcgactgcgccagtcccgcctactgacccagaaggtgattgcccaccggcagtatcagaaatcccagagaatct
ccatcttcctgagcatgccggatgaaatcgagacagaagagatcatcaaggatatcttccagcaaggcaaagtctgcttt
atcccccgctaccggttgcagagcaatcacatggatatggtgaaattagcgtcagcagacgaaatttcttcacttcctaa
aacctcctggaacattcatcagccgagtgagagtgacacgcgggaggaggccttggccaccgggggcctcgacctcatct
tcatgccgggcctcgggttcgacagggacggcaaccggctggggaggggcaggggctactacgacacctacctgcagcgc
tgcctgcagcagcagggggcaaagccctacaccatcgccctggccttcagagagcagatctgcccccaggtgcccgtgga
cgacacagacatgagcgtcgacgaggtgctgtacgtggacgcggccgcttccctcgcgccctga
>gnl|bcl2dbcds|G1T264_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L10 (length=564 residues).
atggcagacgctttggaggagcgcactgcgcgcctgctcaccgactacctggagtgctgcgcccgcgagcccggcacccc
tgagccgcagccgtccacgccggaggcggctgtgctgcgctgtgcggccacgcagcttcagcgggtccactggcccttct
tctccgtctaccgcggctaccccggcaaccgcatcgagctggcggcgcgcgtggcggaggccgtgctctccgacggccac
gacctcagctggggccgcgtggtgacgctcgtgaccttcgccgggacgcttctggacagagggccgccggtgaccaccca
gcgggtgaggaggaatgaaatcgcccgggactgccagcgcttggtggccttgctgtgcgctcgcctcgcagggcagcacc
gcgcctggctgcaggctcaaggcggctgggatggcttttgtgtcttctaccggactcccttaccgctgaccttctggaga
agactgctggtccgcacttttctgtcctgctttgtagctacagccttactcttcgcctggacgcgcgtgtatcgtgagtt
gtaa
>gnl|bcl2dbcds|G1T2Q0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=MCL-1 (length=1059 residues).
atggcgatgtttagcctgagaagaaacgcggtaatcggactcaacctctacttgggggggcccgggttgggagccggtgg
cggcggcgtcgcccctccggcagagcggcttttggctgcggagaaggaggccgcggcccggctagaggtagggggagggg
aggccggcgcggtgattggcggaagcccgggcgctagccccccggccgcgctggcgccggacgcccggagggtcgcgcgg
ccggcgcccattggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctgtacttggcgcccacccgccgcgc
gtcgccgctcgaggagatggaagccccggctgcggacgccatcatgtcgcccgaagaggagctggacggctacgagccgg
agccccttgcgaagcggccggccgtcctgcccctgctggacttggtgggggaggccagtaaggtccctagcacggacggg
tcgctgccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatcgcccggta
ccttcgggagcaggcgaccggcgccaaggacgcgaagccgatgggccgggccggcagcgcgagccggaaggcgctcgaga
ccctgcggcgggtcggggacggtgtgcagcgcaaccacgagacggccttccaaggaatgcttcggaaactggacatcaaa
aacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgtaacaaactggggcaggattgt
gactctgatttctttcggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatagaacctttagcgg
aaagtatcacagatgttctcgtcaggacgaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttc
ttccatgtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgttgccggagtaggagcggggct
ggcttatctgataagatag
>gnl|bcl2dbcds|G1T2Q0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=MCL-1 (length=594 residues).
atgtttagcctgagaagaaacgcggtaatcggactcaacctctacttgggggggcccgggttgggagccggtggcggcgg
cgtcgcccctccggcagagcggcttttggcgaccggcgccaaggacgcgaagccgatgggccgggccggcagcgcgagcc
ggaaggcgctcgagaccctgcggcgggtcggggacggtgtgcagcgcaaccacgagacggccttccaaggaatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgtaacaaa
ctggggcaggattgtgactctgatttctttcggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgca
tagaacctttagcggaaagtatcacagatgttctcgtcaggacgaaacgggactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgttgccgg
agtaggagcggggctggcttatctgataagatag
>gnl|bcl2dbcds|G1TV33_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggccgactttgtaggctacaagctgaggcagaagggtta
tgtctgtggggctggccctggagagggcccggcagctaacccgctgcaccaagccatgcgggcagccggagatgagttcg
agacccgcttccggcaaaacttctccgacctggccgctcagttgcatgtgaccccaggctcagcacagcagagcttcacc
caggtctgcgatgaacttttccaaaggggtcccaactggggccgcgtggtggccttctttgcctttggggccgcactgtg
tgctgagagcgtcaacaaggagatggagcccctggtgggacaagtgcaggagtggatggtgacctacctggagacgcagc
tggccggctggatccacagcaccgggggctgggcggagttcacagctctgtacggggatcgggccctggaggaggcgcgg
cgtctgcgggaggggacctgggcgtcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaaatga
>gnl|bcl2dbcds|A0A3B3I2Q5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagagagctggtccggttctatttagcctataagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagacgatgggggagaaactgaagaggaccactccgatgcccggaatcgcaggctggtcagcagtgaggacg
gccggctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccagacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgt
gtgtcgagtgtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgag
gagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A3B3I2Q5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctataagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agacgatgggggagaaactgaagaggaccactccgatgcccggaatcgcaggctggtcagcagtgaggacggccggctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccagacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcgagt
gtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgaggagatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A3B3IB64_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=693 residues).
atgtcccggaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacggagacgcacgccaacgggacgt
ttaacgggacaactcccgggaccccgccgctctccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctccggtacgcccttgccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggggcc
gcatcgtggggctcttcgcattcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccgg
attgtggagtggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaagccgcggctgagagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3B3IJ04_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=807 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttag
taggtga
>gnl|bcl2dbcds|A0A3B3IJ04_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=858 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttaa
tatgatggccatttttaaaggacttcctgcttctaccagacttcacaactcgagatag
>gnl|bcl2dbcds|A0A3P9I2N4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagggagctggttcggttctatttagcctataagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagatgatgggggagaaactgaagaggaccactccgctgcccggaacggcaggcaggtcagcagtgaggacg
gccagctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgt
gtgtcgagtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcaag
gagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A3P9I2N4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctataagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agatgatgggggagaaactgaagaggaccactccgctgcccggaacggcaggcaggtcagcagtgaggacggccagctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcgagt
gtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcaaggagatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A3P9IIZ2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L10 (length=579 residues).
atgtcttgtgggctgaggaaagagaccctagctgtggccctggattacctgtccctgagctgcaggagcccactccaggc
ccccccacctcccagcgagtcagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccagccccgcttct
ccaccttagcacagaacttcaggaagcacagcgggcaggacctgtgctccagcctcaggaaggtgatggaggagctggtg
ggagatgaacgcttgaactgggggagggtcgtttccctttttgcattcgtgggagtgctggcgaggcagctgagggagca
aacagacatgaacccggggctggaccccgggcgggaagtggcggccgggcctgtgagctgccaggcgctggcagaaactg
tagctgatttcctgggaggagacaagaaagagtggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
acagccagagaggtgagtcaggactcgtccatgaagactgcgctcttcgcggcggccagcgtcggcctggctggactcac
cttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A3P9ILF6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=804 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagagc
gggagagatgtccgcgcgcgtgcctctgccgtccacattggcctctcgcgtggcaaatcccgacccgtccgatcagttca
aaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctcccgaacaccccggag
ctggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcaccaa
tttctttaggaactttgttggaatttctcagtatccacaccgggataataaatacatgtcgaccgcgaaaagagtggtga
acgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgatatg
tcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcctt
cggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgcacgt
acctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttcagac
ccagaaactacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttagtag
gtga
>gnl|bcl2dbcds|A0A3P9ILF6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=855 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagagc
gggagagatgtccgcgcgcgtgcctctgccgtccacattggcctctcgcgtggcaaatcccgacccgtccgatcagttca
aaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctcccgaacaccccggag
ctggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcaccaa
tttctttaggaactttgttggaatttctcagtatccacaccgggataataaatacatgtcgaccgcgaaaagagtggtga
acgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgatatg
tcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcctt
cggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgcacgt
acctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttcagac
ccagaaactacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttaatat
gatggccatttttaaaggacttcctgcttctgccagacttcacaactcgagatag
>gnl|bcl2dbcds|A0A3P9JYH1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=693 residues).
atgtcccggaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacggagacgcacgccaacgggacgt
ttaacgggacaactcccgggaccccgccgctctccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctccggtacgccctggccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggggcc
gcatcgtggggctcttcgcattcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccgg
attgtggagtggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaagccgctgctgagagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P9L1F3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=807 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtccctctgccgtccacattagcctctcgcgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtactccgcgaggaggtttcacgacgtcgacgacgatggctctctcccgaacaccccc
gagctggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaatctacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttag
taggtga
>gnl|bcl2dbcds|A0A3P9L1F3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=858 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtccctctgccgtccacattagcctctcgcgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtactccgcgaggaggtttcacgacgtcgacgacgatggctctctcccgaacaccccc
gagctggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaatctacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttaa
tatgatggccatttttaaaggacttcctgcttctgccagacttcacaactggagatag
>gnl|bcl2dbcds|A0A3P9LM07_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L10 (length=579 residues).
atgtcttgtgggctgaggaaagagaccctagctgtggccctggattacctgtccctgagctgcaggagcccactccaggc
ccccccacctcccagcgagtcagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccagccccgcttct
ccaccttagcacagaacttcaggaagcacagcgggccggacctgtgctccagcctcaggaaggtgatggaggagctggtg
ggagatgaacgcttgaactgggggagggtcgtttccctttttgcattcgtgggagtgctggcgaggcagctgagggagca
aacagacatgaacccggggctggaccccgggcgggaagtggcgcccgggcctgtgagctgccaggcgctggcagaaactg
tagctgatttcctgggaggagacaagaaagagtggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
acagccagagaggtgagtcaggactcgtccatgaagactgcgctcttcgcggcggccagcgtgggcctggctggactcac
cttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A3P9MKK4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagagagctggtccggttctatttagcctacaagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagacgatgggggagaaactgaagaggaccactccgctgcccggaatggcaggccggtcagcagtgaggact
gccagctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttatttgtctttggtggtgcgctgt
gtgtcgagtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgag
gagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgcttggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A3P9MKK4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctacaagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agacgatgggggagaaactgaagaggaccactccgctgcccggaatggcaggccggtcagcagtgaggactgccagctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttatttgtctttggtggtgcgctgtgtgtcgagt
gtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgaggagatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgcttggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|H2MBQ3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L10 (length=579 residues).
atgtcttgtgggctgaggaaagagaccctagctgtggccctggattacctgtccctgagctgcaggagcccactccaggc
ccccccacctcccagcgagtcagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccagccccgcttct
ccaccttagcacagaacttcaggaagcacagcgggccggacctgtgctccagcctcaggaaggtgatggaggagctggtg
ggagatgaacgcttgaactgggggagggtcgtttccctttttgcattcgtgggagtgctggcgaggcagctgagggagca
aacagacatgaacccggggctggaccccgggcgggaagtggcgcccgggcctgtgagctgccaggcgctggcagaaactg
tagctgatttcctgggaggagacaagaaagaatggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
acagccagagaggtgagtcaggactcgtccatgaagactgcgctcttcgcggcggccagcgtgggcctggctggactcac
cttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A3B3C5I4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias melastigma GN=BCL2L10 (length=606 residues).
atggatggtttttctgctcagaaaatgtcttgtgggctgaggaaagagaccctagctgtggccctggattacctgtccct
gagctgcaggagcccagtcctccaggcccccccacctcccagcgagtcagcttctgccatgcggcgcctggcccaggaca
tggagacgcagtaccagccccgcttctccacgctagctcaggacttcaggaagcactgcgggccggacctgtgctccagc
ctcaggaaggtgatggaggagctggtgggagatgaacacttgaactgggggagggttgtttccctttttgcattcgtggg
agtgctggcgagacagctgagggagcaaacggacacgaacccggggctggacctcgggcgggaagcggcacccggacctg
tgagctgccaggcgctggcagaaactgtagctgatttcctgggaggagacaagaaagagtggatgctagaaaatgatgga
tgggaaggcttctgtaagttctccagaacagccagagaggtgagccaggactcgtccatgaagacggcgctctttgcagc
ggccagcgtgggcctggccggactcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A3B3CEX1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias melastigma GN=MCL-1 (length=906 residues).
atgcttcctttgcaaaaacacatggttaacagctacattacgccgagctgtggatgtacggcactcttcggcggagcggg
agagagatccgcgcgcgtgcctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccgaacagatgaaaa
gaccgcaggacctcgacatgttagggaataaatctccgtatgcggcgaggaggtttcacgacgacgacggcggctctctc
ccgaacaccccggagctggagtgcgacaacagcgtacttgtacccaacgacccaccgataaaccaggacaccacggaatt
cctcacgaacttctttaggaactatgttggattatctcaatctcgccaccgggagagcaaatacatatcgacggcgaaaa
gagtagtgaacgacatgatggataaacatcggttcgcctttaatggtatgatcaataggctgtctttggaagacaatttg
gacgatatgtcatttattagccgcgtagcagagaacatgtttgcggaccggaccaccaactggggccgcatcgccagcct
gctggccttcggggcggcggtgtgtctgcagctgaaggagaagggcagaggtcactccgtggacctggtcagtcaggaga
tctgcacgtacctgctgcgtgagcagcgggactggctgatcaacaacaactcatgggatggtttcgtagagttctttcac
gtcccagacccagaatcaacagtcaggaacactttggtggccgtccttggacttgcaggcgttggggctttactggccca
ggtgcaaggtccataccgtatttggcaggatatgacatcatgtcacactaatctatccaaaaataaagttggaagatcac
caagttttgctgttgaagggccgtaa
>gnl|bcl2dbcds|A0A3B3CEX1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias melastigma GN=MCL-1 (length=813 residues).
atgcttcctttgcaaaaacacatggttaacagctacattacgccgagctgtggatgtacggcactcttcggcggagcggg
agagagatccgcgcgcgtgcctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccgaacagatgaaaa
gaccgcaggacctcgacatgttagggaataaatctccgtatgcggcgaggaggtttcacgacgacgacggcggctctctc
ccgaacaccccggagctggagtgcgacaacagcgtacttgtacccaacgacccaccgataaaccaggacaccacggaatt
cctcacgaacttctttaggaactatgttggattatctcaatctcgccaccgggagagcaaatacatatcgacggcgaaaa
gagtagtgaacgacatgatggataaacatcggttcgcctttaatggtatgatcaataggctgtctttggaagacaatttg
gacgatatgtcatttattagccgcgtagcagagaacatgtttgcggaccggaccaccaactggggccgcatcgccagcct
gctggccttcggggcggcggtgtgtctgcagctgaaggagaagggcagaggtcactccgtggacctggtcagtcaggaga
tctgcacgtacctgctgcgtgagcagcgggactggctgatcaacaacaactcatgggatggtttcgtagagttctttcac
gtcccagacccagaatcaacagtcaggaacactttggtggccgtccttggacttgcaggcgttggggctttactggccca
ggtgtgtaggtga
>gnl|bcl2dbcds|A0A3B3DHA1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias melastigma GN=BCL2L1 (length=693 residues).
atgtcccgcaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacagagacgcacgccaacgggacgt
ttaacgggacgagtcccgggaccccgccgctatccccgctgcgtcagcagcagttgccgtcgacgacgaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctgcggtacgccctggccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactgggggc
gcatcgtggggctcttcgcgttcggcggggcgctgtgcgtcgagtgcgtggagaaggagatgagccccctggtggacagg
attgtggagtggatgaccgtctacctggacaaccacatccagccgtggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaggccgcagccgaaagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3B3E2W4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias melastigma GN=BCL2L1 (length=654 residues).
atgtcccactgtaaccgagagctggtgcagttctatttaggctataagatgtcatccagagactatcctgtgtccctgct
gaaacccacagatgatgggggacaaactgcagaggaccgctctgctacctgcaacggcacactggtcaacagcgaggacg
gccagctgaagaagtcctgcccctgttgtgctagcatggatgccatcaaatccacccttaaagattcggccaatgagttt
gagcgtcgcttcagtcaaggttttagtgatctctctctgcagtttcacatcactcctgacacggcctaccaaaacttcaa
aagtgtgttggatgagctgttcaaggatgggataaactgggggcgtgttgtgggtttgtttgtctttggtggtgtgctgt
gtgttgagtgtgtcgagaggaatatgagtgagctggtctcccgcattgctgaatggatgaccatgtacctagacgagcaa
ataagtccatggatccacagtcaaggaggatgggattgctttgcacagctgtatgggcaggatggcgctgcagaagcgag
aagatttcaagagacgctgaaaaagtggacgctggtcgcagtggcacttctaaccggactgctgcttggtttgctcattg
ccaagaaacggtga
>gnl|bcl2dbcds|A0A8C7X109_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias sinensis GN=MCL-1 (length=855 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagagc
gggagagatgtccgcgcgcgtgcctctgccgtccacattggcctctcgcgtggcaaaccccgacccgtccgatccgatca
aaagaccgcaggacctcgagtattccacgaggaggtttcacgacgtcgacgacgatggctctctcccgaacaccccggag
ctggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgagaacaccagggaattcctcaccaa
tttctttaggaactttgttggaatttctcagtatccaaaccgggataataaatacatgtcgaccgcgaaaagagtggtga
acgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgatatg
tcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcctt
cggggcggcggtgtgtcaggacttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgcacgt
acctgctgagtgagcagcgaaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttcagac
ccagaaactacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttaatat
gatggccttttttaaaggacttcctgcttctgccagacttcacaactcgagatag
>gnl|bcl2dbcds|A0A8C7XSQ2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias sinensis GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagagagctggttcggttctatttagcctataagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagacgatgggggagaaactgaagaggaccactccactgcccggaacggcaggccggtcagcagtgaggacg
gccagctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggggcgctgt
gtgtcgagtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcgag
gcgatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaaccggactgctgctgggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A8C7XSQ2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias sinensis GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctataagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agacgatgggggagaaactgaagaggaccactccactgcccggaacggcaggccggtcagcagtgaggacggccagctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggggcgctgtgtgtcgagt
gtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcgaggcgatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaaccggactgctgctgggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A8C7XY96_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias sinensis GN=BCL2L10 (length=579 residues).
atgtcttgtgggctgaggaaagagaccctagctgtggccctggattacctgtccctgagctgcaggagcccactccaggc
ccccccacctcccagcgagtcagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccagccccgcttct
ccaccttagcacagaacttcaggaagcacagcgggccggacctgtgctccagcctcaggaaggtgatggaggagctggtg
ggagatgaacgcttgaactgggggagggtcgtttccctttttgcatttgtgggagtgctagcgcggcagctgagggagca
aacagacatgaacccggggctggaccccgggcgggaagtggcgggcgggcctgtgagctgccaggcgctggcagaaactg
tagctgatttcctgggaggagacaagaaagagtggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
acagccagagaggtgagtcaggactcgtccatgaagactgcgctcttcgcggcggccagcgtcggcctggctggactcac
cttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A8C7YJI1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias sinensis GN=BCL2L1 (length=693 residues).
atgtcccggaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcacagcacggagacgcacgccaacgggacgt
ttaacgggacaactcccgggaccccgccgctctccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctccggtacgccctggccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggggcc
gcatcgtggggctcttcgcattcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccgg
attgtggagtggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaagccgcggctgagagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7ZK61_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias sinensis GN=BCL-2 (length=687 residues).
atggcgaacgtgtctaatcgcagtattgtagaaaagtacatttgccacaaactctccaagaggggctacgtgtgtgggct
gaacggcggccagcccgagaatgctgccaataacggctcggttggggaccattccccgactccggtccgccgccgctgcg
acgcaggaacggggcctgacgaggagagcagcccccgcctcatcagagcgctctcccgggcggacccgctcgcggacatc
cacagggtcctgcgcgaggcgggagacgagctggagcgcctgtaccagcgggacttcacggagatgtcgcggcagctgta
cctcacctccaccacggcgaagacgaggttcgccgaggtgattgacgaactgttccgggacggcgtgaactggggccgga
ttatcgcgttcttcgagttcgggggcacggtgtgcgtggagtgcgcgtccaacgaggagatgagcacgcaggtggccagc
atcgccgagtggatgacggagtatttaaacggacctctcaacagctggattgaagaaaacgggggatgggatgcctttgt
ggagctgtacgacagacagaaggaaaccgtcttcagctgctactggccgtccatcaagactgtcttcggcctggctgctc
tcggggcggcgagcctgaccattggagcataccttgcacaaaagtga
>gnl|bcl2dbcds|C1BLI0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Osmerus mordax GN=BCL2L1 (length=669 residues).
atgtcttacagtaaccgtgagctggtggtgttcttcataagctataaactttcacagaggaattatcctatttctcagtt
gggactggaagatgccagtgaacggactaatgttgacaagaccaatgtctccccagttaatggatctgttgaaaatgacc
gaaattgcataggcagtctggggatatcttcatctccacaggggggtatagaggcggttaaagcagctcttagagactct
gcagatgagtttgaattgcgttacaccagagccttcaatgatccctcttctcaactgcatatcacccctgctacagcata
ccatagctttgaaagtgtaatgaacgaggtgttcagggacggcgtcaactggggacgtgtagtaggcctgtttgcttttg
gtggtgctctttgtgctgagtgtgtcgagaaggatatgagtcacctggtagcgcgtattgcagattggatgaccacctac
ctggacaaccacatccagccatggatacagagacagggtggatgggaccgatttgctgacattttcggcagggatgctgc
tgctgaggttcgacgttcccaggagaacctaagaagatggctgctagtaggggcgatactgcttgcaggagtgttggtcg
gctctctcattgcaaagaaacatcattga
>gnl|bcl2dbcds|H0WKI0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Otolemur garnettii GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagacgtgggcgttgcaccccccggggccgccactgcgccgggcgtcttctcctcccagcccg
ggcgcacccctactcccgctgcgccccgggacccggccgccaggacctcgcccccggccgcccccgccgccgccgccgcc
gcggagcctctgctcagcccggtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctctcgccgcta
ccgccgcgacttcgccgagatgtccagccagttgcacctgacgcccttcaccgcgagaggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggacgcctttgtggaattgtatggccccagcatgcggcctctgtttgacttctcctggc
tgtctctgaagaccctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|H0WZ06_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L10 (length=576 residues).
atggcagacccgttgagggagcgcaccgagcggctgctgactgactacctggagtactgcgcgcgggatccgactgcccc
ggagccgacgccgtcctcgcccgaggccgccttgctgcgctccgtgaccgcctatatacagcagcgccactggtcctttt
tctccgcctacataggctaccccgggaatcgcgttcaggtggtggaacggatggtgaaggctatgctctcagacaaccag
agactcaactggggccgagtggtgacgctcgtgaccttcgcagggacgcttctacagaggcctccagtagaagccaggcg
ggagaagcaggacaagtcgcaactgaaggagggagaagacgaagtcgccagggattgccagcgcctagtggccctactga
gctctcggctggtggggcagcaccgcgtttggctggaggctcaaggcggctgggatggcttttgtcagttcttcaggaca
cccttaccgctagctttttggagaagattgctgttcgaagttttactgttgtgctttttagcaacggtcttcatctattt
ctggacacgacttact
>gnl|bcl2dbcds|H0WZ23_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2A1 (length=522 residues).
atgactgactgtgagtttggatacattcacaggctggctcaggactatctgcagtatgtcctgcaaatacagcaatgtgg
atcaggtccaagcaaaacgtccagagtgctgcaaaatgttgcattttcagtccaagaagaggttgaaaagagtctgaaac
catgcttagacaattttaatgttgtatccatagatactgccagaacaatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggcaggattgtgacaatatttgcctttggaggtattctcctcaagaaacttctccaacagcg
aattgccctggatgtggatacttataaggagatttcttattttgttgctgagttcataatgaattacacaggagaatgga
taaggcaaaatggaggctgggaacatggctttgtaaagaagtttgaacctaactctggctactctggctggctgactttt
ctggaagttacaagaaagatctgtgaaatgctgcctctcctg
>gnl|bcl2dbcds|H0X6V2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggagctggtggttgactttatctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaggccccagaagggaatgaatcagagctggagacccccagtgccattaatggca
acccatcctggcacctggctgacagccccacggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatctcagctgcacatcaccccagggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgaattgtggcctttttctccttcggcggggctctgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacttgaatgaccacctagagccttggatccaggagaacggcgg
ctggtggaggtgtcaggcctttccagagcttctctctcccaaatcaaattccatttatttcaaagtttgcatgtgtggca
atttttgctctttggctgcagctgggagatgcttgactataggagttatgggttattct
>gnl|bcl2dbcds|H0XFB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otolemur garnettii GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggcgccgggctgggggctggcagcggcgg
cgccacacccccgggagggcggcttttggctgcggagaaggaggccgcggcccggcgagaggcagggggaggggaagccg
gcgaggtgattggcggaagccccggcgcgagttccccggcctccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggtgccgaagtccccgacgtcaccgcgacccccacgaggctgctgttcttcgcgcccaccctccgtgcggcgcc
gcgggaggagatggaagcccctgccgccgacgccatcatgtcgccggaagatgagctggacgggtacgagccggagcctt
tggggaagcggccggcggtcctgcctttgctggagttggtcggggaggccagtaacggccccagcactgatgggtcactt
ccttcgacaccgcccccagcagaggaggaggaggatgagttataccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggcgaccggtgccaaggacgcgaaaccaatgggcagggcaggagccgccagcaggaaggcgctggagaccttgc
gccgcgttggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|H0XHA5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otolemur garnettii GN=MCL-1 (length=582 residues).
ctaccagaccagatggaagcccaagttgccgatgccgtcaagtcgcccgaaggtgaggtggcctcgtgcgagccggagcc
tctcaagaagcaaccggagggcctgcctttgctggagtttgttggtgaggccggtaacggccccagcactgacacacttc
cttccacacctcccccagcagaggaggaggatgagttatactggcagtcgatggagatcatctctcggtacctatgggag
caggaaactggagaggatatcaactctttgtctcgagtgatggcccatgttttcagttacggcgtaacaaattggggcag
gattatgaccctaatttttggtggctttgtggccaagcacctgaagaccataaaccaagaaggctacatcaaaccgctag
aagaaaatatcgcagatgtccttgtgaggacaaaaccggactggctagtcaaacaacgaggctgggatggctttgtggag
ttcttctacctggaagacctggaaagcagcgtcagaaacgtgctgctggctttcgcaggtgttgctggagtaggagctgg
cttgacctatctaataagatag
>gnl|bcl2dbcds|H0XR82_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggcccaggggagggcccagcaactgacccgttgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgtaccttctctgatctggcagctcagctacatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggccgcactgtg
tgctgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtagcctacctggagacacggc
tggctgactggatccatagcagtggtggctgggcggagttcacagctctatacggggacggggccctggaggaggctcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C8A4L8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Otus sunia GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagtggaggacgccgagatggacggtgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccgtgcaccggagcagcctcgaagtccatgaaatcgttcaagcg
gccgatgtgaggcaggcgctgagagaggcgggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccccggcacggcgtaccagagctttgagcaggtagtgaacgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtatcttggatgaccatgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacaatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C8AIP7_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Otus sunia GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttagctcaagattatctgcaatatgtgcttcaggagtcacatcttgg
accagcccaaaccagggttgctcatgtcttgcgaaacattgcatcttcgctgcaagatcaaaccgaggaggctctcagac
cattcttggacaggattgatattacctctgtagctgttgccaagagaattttcaatggtgtcatgcaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacatttggaggtcttctcactaagaagcttcaagagcatgg
agttcagctcactggagaggagaaggagcagatttcttatttcatcacagagtacataataaacaacaaagctgaatgga
tagatgcaaacggtggctgggaaaatggcttcctaatgaagtttgaaagaagatcactactatctttctccaaaattaca
gccatattcatagctgttttctccttattcagagagtactactga
>gnl|bcl2dbcds|A0A8C8ANG9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Otus sunia GN=BCL-2 (length=732 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcacccctgcctccgggtctctctcctcctgctgctgctgctgcggtcgctg
ctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgct
gctagccacgcgcccccggccgaggggctgcgccccgcaccccaggtcgtccacctcgccctgcgccaggcgggcgacga
gttctcccgccgctaccagagggactttgcccaaatgtccggccagctgcacctgacgcccttcacggcccggggccgct
tcgtggcggtggtggaggagctcttccgagacggggttaactggggcaggatcgtggccttcttcgagtttggcggcgtg
atgtgcgtggagagtgtcaaccgggagatgtctccccttgtagacagcatcgccgcctggatgaccgagtacctgaaccg
gcacctgcacaactggatccaggacaacggaggctgggatgccttcgtcgagttgtatggcaacagtatgaggcctttct
ttgatttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctc
ggacataagtag
>gnl|bcl2dbcds|A0A8C8B1M7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otus sunia GN=MCL-1 (length=1290 residues).
atggtgcaggctgcgagcacggcgtgcccggtgccgggggacagcggcacggcggggggtggtggtgctggggtgtgtgt
agctgcacgggggggccctgcgctgctgaggggctgctgcacggggctaagaacggccggggcccggcagcaccgagggg
cggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngagctggatggcttcg
agcccgaggccgagcgcggcccggcgggggactcgctgcccggcaccccgcccgggccgcccgcgccgcccgatgggctg
cggcaggactcgctggagctcatcagccgctacctgcgggaggcggcgggcgaggccgagcccggcgccaagaagctctt
cccggggctgctgggcgggcccggccggccgggcgggtcgggcgacgccgtgatggagaaggcgctggaaacgctgcgga
gggtcggcgacggcgtcatgcagaagcacgagctcgccttccagggaatgcttcggaagctggaaatccagaaagaggaa
gatctgcaatcagtatgtgaagtggctgcccacgtgttcagtgatggagtaacaaactggggtagagtggtgacgctcat
ctcgtttggtgcctttgttgcgaaacacctgaagagcataaaccaggagaagtgcatcagctcgctggcagggatcatca
cggacgcgctcgtctcatcgaagcgcgagtggctactgagccaaggaggctgggagggctttgtcgacttctttcgagtc
gaggacctggaaggcagcatcagaaatgtactgatggcgtttgcaggtgtggccggactgggagcgagcttggcctacat
gatccggtga
>gnl|bcl2dbcds|Q9MZS7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcttggcacctggcggatagccctgcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacgtttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|W5PSA5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagttttttcagaaaggatacagctggagtcagtt
tagtgacatggaagagaacagaactgagaccctagaagggacagaatcagatatggaaacccccagtgccatcagtggca
acccatcctggcacctggcagatagccctgtggtgaatggagccactggtcacagcagaagcttggacaccgggaaaatg
atccccatggcagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggaaagcatatcagagctttgaacaggtaataaatgaactcttccaggatg
gggtgaactggggtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaaagcatagtcaaggagatgcag
gtattggtaagtcaggtcacgacttggatggccacttacctaaatgaccacctagagccttggatccaggagaatggcga
ctgggacatttttgtggaactctacgaaaacaatacagcaaccgagagccaaaagggccaagagcacctcaaccgctggt
ccctgacggacatgactgtggccggtatggctctgctgggcttgctcttcaactgtaag
>gnl|bcl2dbcds|W5Q0N6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ovis aries GN=BCL2A1 (length=528 residues).
atgactgacactgagtttgactacgttcacaagctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaacatccagggtgttacaagacgtggcttcctctgtccaggacgaagtggaaaggactctgaagc
agtgcttggataagtttgatgtggtgtctgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgagcaagcg
tattgcctcagacatggacatgtgcaaggacatttcttatttcgtggcggagttcatcaccaaaaacacaggagagtgga
taaggcaaaacggaggctgggaaaatggttttgtaaagaagtttgaaaccaaatctggctggctgacttttctggaagtt
acaggaaagatctgtgaaacattatgtcgtctgaagcaatactattga
>gnl|bcl2dbcds|W5QDH4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ovis aries GN=BCL2L2 (length=1092 residues).
atgggctggccaaacctgaaatacctccttctgggcctctcaccatatattcatgccagtcttttatgtttgactccaac
agccgcccggatggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggc
agaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga
gatgagtttgagacccgcttccggcgcaccttctccgatttggcagctcagctgcatgtgaccccgggttcggcccagca
gcgcttcacccaggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggag
ccgcattgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctg
gagacgcggctggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatgga
ggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctg
gcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
acagcagaagagctagaagcacacttccatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtgg
ccatcccaaagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttat
ttagaggaagacagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggtttcccacga
gcccgataccgtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
tcgcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|W5QDH4_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Ovis aries GN=BCL2L2 (length=669 residues).
atgggctggccaaacctgaaatacctccttctgggcctctcaccatatattcatgccagtcttttatgtttgactccaac
agccgcccggatggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggc
agaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga
gatgagtttgagacccgcttccggcgcaccttctccgatttggcagctcagctgcatgtgaccccgggttcggcccagca
gcgcttcacccaggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggag
ccgcattgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctg
gagacgcggctggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctgga
ggaggcgcggcgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggccgtggcactttcgctagctg
agggctctggccgcttttttgcagaaagt
>gnl|bcl2dbcds|W5QI41_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ovis aries GN=MCL-1 (length=807 residues).
gggagccggaaaccccgccctgccccaggccccgcccctgccttgaccccgccggttaggtgccgtgcgcaaccgccgga
agctttcgctgccttccccatttacgggatgcagataaagaggcagcagcagtggttcaagatgtttggcttcaagaggc
gccctgccgtccggcctttacctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctgccctcg
acgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcctggagca
agcaaccggcaccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcgcagag
tcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaagacgat
gtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactcttatttc
ttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacag
atgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccgtgtagag
gacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaat
aagatag
>gnl|bcl2dbcds|W5QIG4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ovis aries GN=BCL2L10 (length=582 residues).
ggtcggccccccggtagaggcggagccatggtggacccgtttagggagcgcacggcccggctgctgatggactggctgga
gttctgcgcccgggagcccggcactccagctcctgcgccgtccacgcccgaggctgctgtgctgcgccacgtggccgccc
gtgtcctggaagcaaatcgaaacgtcttgcccctataccgccgctaccgcaggcaccgcgtcgagctggtggccaggatg
gcgcagaggctgctcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtctctgct
ggagaggcagccgcagacgacccgacggcagaagagagacgacggcagcgttagcagggactgtcggctcctcgtggccc
ttctctgcgctcagttctgcgaaaggcaccgcgcctggctgatggcgaacggcggctgggatggattttgtctctccttc
agccactcattgcaaccatcttgggaaagacagctggtctggtttttcctctcatactggacagcaataatcataatcta
cttctggataaaattatcgtga
>gnl|bcl2dbcds|A0A2R8Z9D7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pan paniscus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2R8Z9D7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Pan paniscus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggatacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2R8ZJ66_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Pan paniscus GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagccaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
gattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggaaaatggctttgtaaagaagtttgaacataaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2R8ZJ66_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Pan paniscus GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagccaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
gattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggggaaatggcacaatcacacgcctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2R8ZJ66_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Pan paniscus GN=BCL2A1 (length=591 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagccaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
gattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggaaaatggctttgtaaagaagtttgaacataaatctggctggatgacttttctagaagtt
acaggaaagatctcaatactgttgaccagaaaggacactccatattgtgaaaccggcctaatttttctgactgttatgga
aacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A2R9A2Q3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Pan paniscus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtgg