Dataset for CDS BCL2A1 of organism Bos mutus grunniens

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9YDG7_BCL2A1-      atggc-------------ggcagcgg--------tggccgtgagc-----
A0A8B9YDG7_BCL2A1-      atgactgacactgagtttggctacgttcacgggctggctgaggactatct
A0A8B9YDG7_BCL2A1-      atgactgacactgagtttggctacgttcacgggctggctgaggactatct
A0A8B9YDG7_BCL2A1-      atgactgacactgagtttggctacgttcacgggctggctgaggactatct
                        *** *             ***  **         **** * *  *     

A0A8B9YDG7_BCL2A1-      ----------------------------ggcgccaagcggagc-------
A0A8B9YDG7_BCL2A1-      gaaatatgtgttgcagatacagcaacctggatccaagccaagcaaaatat
A0A8B9YDG7_BCL2A1-      gaaatatgtgttgcagatacagcaacctggatccaagccaagcaaaatat
A0A8B9YDG7_BCL2A1-      gaaatatgtgttgcagatacagcaacctggatccaagccaagcaaaatat
                                                    **  ******  ***       

A0A8B9YDG7_BCL2A1-      ---------------------------ctg--cgggccgag---------
A0A8B9YDG7_BCL2A1-      ccagggtgttacaagatgtggcttcctctgtccaggacgaagtggaaagg
A0A8B9YDG7_BCL2A1-      ccagggtgttacaagatgtggcttcctctgtccaggacgaagtggaaagg
A0A8B9YDG7_BCL2A1-      ccagggtgttacaagatgtggcttcctctgtccaggacgaagtggaaagg
                                                   ***  * ** ***          

A0A8B9YDG7_BCL2A1-      ---ctgaagca----------------------gcgtctgcgggcgctg-
A0A8B9YDG7_BCL2A1-      actctgaagcagtgcttggataagtttgatgtggtgtccgtagacactgc
A0A8B9YDG7_BCL2A1-      actctgaagcagtgcttggataagtttgatgtggtgtccgtagacactgc
A0A8B9YDG7_BCL2A1-      actctgaagcagtgcttggataagtttgatgtggtgtccgtagacactgc
                           ********                      * *** *  * * *** 

A0A8B9YDG7_BCL2A1-      ------------------agcgctg-------------------------
A0A8B9YDG7_BCL2A1-      cagaacaatattcaaccaagtgatggaaaaggaatttgaagatggcattg
A0A8B9YDG7_BCL2A1-      cagaacaatattcaaccaagtgatggaaaaggaatttgaagatggcattg
A0A8B9YDG7_BCL2A1-      cagaacaatattcaaccaagtgatggaaaaggaatttgaagatggcattg
                                          ** * **                         

A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ttaactggggcaggattgtaaccatattcgcctttgaaggtattcttacc
A0A8B9YDG7_BCL2A1-      ttaactggggcaggattgtaaccatattcgcctttgaaggtattcttacc
A0A8B9YDG7_BCL2A1-      ttaactggggcaggattgtaaccatattcgcctttgaaggtattcttacc
                                                                          

A0A8B9YDG7_BCL2A1-      -aggagcggctgcgccag--------------------------------
A0A8B9YDG7_BCL2A1-      aagaaacttctgggcaagtgtattgcctcagacatggacatgtgcaagga
A0A8B9YDG7_BCL2A1-      aagaaacttctgggcaagtgtattgcctcagacatggacatgtgcaagga
A0A8B9YDG7_BCL2A1-      aagaaacttctgggcaagtgtattgcctcagacatggacatgtgcaagga
                         ** * *  *** ** **                                

A0A8B9YDG7_BCL2A1-      ----tcccacctcttggc-----------ccagaa---------------
A0A8B9YDG7_BCL2A1-      catttcttactttgtggcggagttcatcaccgaaaatacaggagagtgga
A0A8B9YDG7_BCL2A1-      catttcttactttgtggcggagttcatcaccgaaaatacaggagagtgga
A0A8B9YDG7_BCL2A1-      catttcttactttgtggcggagttcatcaccgaaaatacaggagagtgga
                            **  ** *  ****           **  **               

A0A8B9YDG7_BCL2A1-      -------------------ggtgtttacccataatgaatat---caaaag
A0A8B9YDG7_BCL2A1-      taaagcaaaatggaggctggg---------aaaatgggtttgtaaagaag
A0A8B9YDG7_BCL2A1-      taaagcaaaatggaggctgggtgtttacccataatgaatat---caaaag
A0A8B9YDG7_BCL2A1-      taaagcaaaatggaggctgggtgtttacccataatgaatat---caaaag
                                           **         * ****  * *    * ***

A0A8B9YDG7_BCL2A1-      tccaaaagagtgtccatctttctgagcatgccagatgaaattgagacaga
A0A8B9YDG7_BCL2A1-      tttgaaaccaaatctggctggctga-------------------------
A0A8B9YDG7_BCL2A1-      tccaaaagagtgtccatctttctgagcatgccagatgaaattgagacaga
A0A8B9YDG7_BCL2A1-      tccaaaagagtgtccatctttctgagcatgccagatgaaattgagacaga
                        *   ***     **   **  ****                         

A0A8B9YDG7_BCL2A1-      ggagatcatcaaggacattttccgacaaggcaaaacctgctttatccctc
A0A8B9YDG7_BCL2A1-      ----------------cttttctg--------------------------
A0A8B9YDG7_BCL2A1-      ggagatcatcaaggacattttccgacaaggcaaaacctgctttatccctc
A0A8B9YDG7_BCL2A1-      ggagatcatcaaggacattttccgacaaggcaaaacctgctttatccctc
                                         ***** *                          

A0A8B9YDG7_BCL2A1-      ggtaccagttgcagagcaatcacatggatatggtgaagttagcatcgcca
A0A8B9YDG7_BCL2A1-      ----------------------------------gaagtta-------ca
A0A8B9YDG7_BCL2A1-      ggtaccagttgcagagcaatcacatggatatggtgaagttagcatcgcca
A0A8B9YDG7_BCL2A1-      ggtaccagttgcagagcaatcacatggatatggtgaagttagcatcgcca
                                                          *******       **

A0A8B9YDG7_BCL2A1-      gaggaaatcgcttcgctgcccagaacttcctggaacattcagcagcccgg
A0A8B9YDG7_BCL2A1-      ggaaagatc-------------------tgtgaaacattatgtcgcc---
A0A8B9YDG7_BCL2A1-      gaggaaatcgcttcgctgcccagaacttcctggaacattcagcagcccgg
A0A8B9YDG7_BCL2A1-      gaggaaatcgcttcgctgcccagaacttcctggaacattcagcagcccgg
                        *   * ***                     ** ******  *  ***   

A0A8B9YDG7_BCL2A1-      tgaggatgaagttctggaggaggccttgtcaacagggggacttgacctca
A0A8B9YDG7_BCL2A1-      ------tgaag------------------caata----------------
A0A8B9YDG7_BCL2A1-      tgaggatgaagttctggaggaggccttgtcaacagggggacttgacctca
A0A8B9YDG7_BCL2A1-      tgaggatgaagttctggaggaggccttgtcaacag---------------
                              *****                  *** *                

A0A8B9YDG7_BCL2A1-      tctttgtgccgggtctcgggttcgacaaacagagcaaccgtttgggacgg
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      tctttgtgccgggtctcgggttcgacaaacagagcaaccgtttgggacgg
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      ggcaagggctactatgacgcctacctgaagcgttgtctgcagtcccagga
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ggcaagggctactatgacgcctacctgaagcgttgtctgcagtcccagga
A0A8B9YDG7_BCL2A1-      ------------------------------------ttgcagtc------
                                                                          

A0A8B9YDG7_BCL2A1-      cgtgaaaccctacaccctggccttggctttcaaagagcagatctgcctcc
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      cgtgaaaccctacaccctggccttggctttcaaagagcagatctgcctcc
A0A8B9YDG7_BCL2A1-      -----------------------tgtctggtaa-----------------
                                                                          

A0A8B9YDG7_BCL2A1-      aggtcccggtgaatgagaatgatgtgaaggtagacgaagtgctttacgaa
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      aggtcccggtgaatgagaatgatgtgaaggtagacgaagtgctttacgaa
A0A8B9YDG7_BCL2A1-      ---------tgagtgag---------------------------------
                                                                          

A0A8B9YDG7_BCL2A1-      gactcctga
A0A8B9YDG7_BCL2A1-      --ctattga
A0A8B9YDG7_BCL2A1-      gactcctga
A0A8B9YDG7_BCL2A1-      ------tga
                              ***

© 1998-2022Legal notice