Dataset for CDS BCL-2-like of organism Denticeps clupeoides

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C4BCS5_MCL1-01      atgagcctgagcgccatgaagcgtccggcgggcagcgtgatcggcctgct
A0A8C4CMF6_BCL2L1-      atgtcctacagcaacagagagc---------------tggttg---tgta
                        ***  *   ***  **   ***               ** * *   **  

A0A8C4BCS5_MCL1-01      ctgctcgcacttcgcggttccatgcgcggtcgcggacaacaaagggga--
A0A8C4CMF6_BCL2L1-      ttacatcaact----------ataaactgtcccaga--------ggaact
                         * *    ***          **   * *** * **        ** *  

A0A8C4BCS5_MCL1-01      --ccccggggacgagctgg--------acgaggcggactctttcgcg--c
A0A8C4CMF6_BCL2L1-      accctctgagccacgtcggcctgacccaccagatggagtctccagtggac
                          ** * * * *  *  **        ** **  *** ***   * *  *

A0A8C4BCS5_MCL1-01      tgaagcc---cgagcgccgg-gacatgggcctggacagcggcttccagag
A0A8C4CMF6_BCL2L1-      agcagtcaggagggcgcaggtgtgacggcgctgtccaacggct--cagtg
                         * ** *    * **** ** *  * **  ***  ** *****  *** *

A0A8C4BCS5_MCL1-01      ctccgacgacgacgcgtccctgcccgcgtcccccgacgggccgccgcgca
A0A8C4CMF6_BCL2L1-      aacggaacaag-cgcgt---tgccggcatccgccga------gctgtccc
                          * **  * * *****   **** ** *** ****      ** *  * 

A0A8C4BCS5_MCL1-01      cgatcctggaccgcgaccgcgacgccctggagctcgagaccaggcagctc
A0A8C4CMF6_BCL2L1-      cgctgctgtccc----cggtgctgtccgggaacggtagcggtggtgg--c
                        ** * ***  **    * * *  * ** *** *   **    **  *  *

A0A8C4BCS5_MCL1-01      gtcggcgacttctaccggatctacgtcg-gagggaagcccgccgacacgc
A0A8C4CMF6_BCL2L1-      gccagcagcagcagcagcatcgatgccgtgaaggaggcccttcgagac--
                        * * **  *  *  * * *** * * ** ** *** ****  *** **  

A0A8C4BCS5_MCL1-01      gtccgcacaacgcgct---------------gccgaccatgaggaaagtc
A0A8C4CMF6_BCL2L1-      -tctgc-caacgagttcgagcttcgttactcgcgggccttcagcgacctc
                         ** ** ***** * *               ** * ** * **  *  **

A0A8C4BCS5_MCL1-01      gtggacgaggtgctgcggaagcaccagatatctttcaaaagtatggtcca
A0A8C4CMF6_BCL2L1-      tcgtcccagctgc-------acatca-----cgcccgccaccgcgtacca
                          *  * ** ***        ** **     *   *   *    *  ***

A0A8C4BCS5_MCL1-01      gaaattggtgctgcagtctcagaacgaga-agatggcctttgttacggca
A0A8C4CMF6_BCL2L1-      gagcttcg------------agagcgtgatggacgaggttttccgcgacg
                        **  ** *            *** ** **  ** *   ***    ** * 

A0A8C4BCS5_MCL1-01      gtcgccaagaacatatttaaagatggaaccaccaactggggccgcatcgc
A0A8C4CMF6_BCL2L1-      g----------------------------cgtgaactggggccgcgtggt
                        *                            *   ************ * * 

A0A8C4BCS5_MCL1-01      cagcctggtggcatttggggccgtggtctgccgagaact------gaagg
A0A8C4CMF6_BCL2L1-      gggcctgttcgccttcggaggggcgctctgcgtggagtgcgtggagaagg
                          ***** * ** ** ** *  * * *****   **         *****

A0A8C4BCS5_MCL1-01      cgat--------tgacagggagga---ctgtgtgga-gaccgtgactacg
A0A8C4CMF6_BCL2L1-      agatgagtccgctggtagcgcgcatcgccgactggatgaccgt--ctacc
                         ***        **  ** * * *   * *  **** ******  **** 

A0A8C4BCS5_MCL1-01      cagatctgcacgt----acctcgccaccgaacaaa-------gggagtgg
A0A8C4CMF6_BCL2L1-      tggacaaccacatccagccctggatccagagccaaggaggatgggaccgc
                          **    *** *     *** *   * ** * **       ****  * 

A0A8C4BCS5_MCL1-01      ttcgtcaataacagcggctgggttggctttgtgga----cttctttcacg
A0A8C4CMF6_BCL2L1-      ttcgctgagatcttcggcaaggacaccgccgcagagagtcgtcgctctca
                        ****   * * *  ****  **    *   *  **    * **  ** * 

A0A8C4BCS5_MCL1-01      tggaggatccagaga-----ctgtagtctggaacaccttgattgcagtag
A0A8C4CMF6_BCL2L1-      ggaaagctttaagaattggcttgtggcagggatgaccttggttacaggag
                         * * * *  *   *      *** *   ***  ****** ** *** **

A0A8C4BCS5_MCL1-01      caggcttcgcggggctgggagctggcctggcgctcatgatcagatga
A0A8C4CMF6_BCL2L1-      t---cgtggtgggttcactcattgtccggaagcacctg------taa
                            * * * ***         ** ** *  ** * **      * *

© 1998-2023Legal notice