Dataset for CDS BAK1 of Organism Accipiter nisus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9NHL2_BAK1-01      atggcctcagggaacgacggtgacccaccgagggcccacagacgccgggg
A0A8B9NHL2_BAK1-02      atggcctcagggaacgacggtgacccaccgagggcccacagacgccgggg
                        **************************************************

A0A8B9NHL2_BAK1-01      aagcaacaggcgcaggctgtcacaagagctcaactcagaagaccaagtgg
A0A8B9NHL2_BAK1-02      aagcaacaggcgcaggctgtcacaagagctcaactcagaagaccaagtgg
                        **************************************************

A0A8B9NHL2_BAK1-01      tggaggagacggaggaggtgtttcggagctatgccttctaccgctatcaa
A0A8B9NHL2_BAK1-02      tggaggagacggaggaggtgtttcggagctatgccttctaccgctatcaa
                        **************************************************

A0A8B9NHL2_BAK1-01      caggagagagaggagagaggggaggaggtgcccatggacccagagattgt
A0A8B9NHL2_BAK1-02      caggagagagaggagagaggggaggaggtgcccatggacccagagattgt
                        **************************************************

A0A8B9NHL2_BAK1-01      ggagatccagcaggagctgggcagcaccgggagcctggtaggaaggcgcc
A0A8B9NHL2_BAK1-02      ggagatccagcaggagctgggcagcaccgggagcctggtaggaaggcgcc
                        **************************************************

A0A8B9NHL2_BAK1-01      tggccatcatcggtgacgacattaataagcggtacgatgcggagtttcgc
A0A8B9NHL2_BAK1-02      tggccatcatcggtgacgacattaataagcggtacgatgcggagtttcgc
                        **************************************************

A0A8B9NHL2_BAK1-01      tacatgctgaaatccttgcagcccaccaaggagaacgtctacgagcactt
A0A8B9NHL2_BAK1-02      tacatgctgaaatccttgcagcccaccaaggagaacgtctacgagcactt
                        **************************************************

A0A8B9NHL2_BAK1-01      caccagaatagcctccagcttgttcgagagcggcattaactggggccggg
A0A8B9NHL2_BAK1-02      caccagaatagcctccagcttgttcgagagcggcattaactggggccggg
                        **************************************************

A0A8B9NHL2_BAK1-01      tgattgcgctgctgggtttcggctaccgcatggccatccacgtctaccag
A0A8B9NHL2_BAK1-02      tgattgcgctgctgggtttcggctaccgcatggccatccacgtctaccag
                        **************************************************

A0A8B9NHL2_BAK1-01      cacggcacaaggggtttcctctactggatcacccgcttcgtctcggagtt
A0A8B9NHL2_BAK1-02      cacggcacaaggggtttcctctactggatcacccgcttcgtctcggagtt
                        **************************************************

A0A8B9NHL2_BAK1-01      catgctccgcaaccgcatcgcccagtggatcgcccagcagggaggatggg
A0A8B9NHL2_BAK1-02      catgctccgcaaccgcatcgcccagtggatcgcccagcagggaggatggg
                        **************************************************

A0A8B9NHL2_BAK1-01      tg------------------------------------------------
A0A8B9NHL2_BAK1-02      tgagccagcgggaacgtggggctgtcccagggggaatttggggacaaggg
                        **                                                

A0A8B9NHL2_BAK1-01      ------gctgcactcgagctggacaatgtttacatgaagtacatgctggt
A0A8B9NHL2_BAK1-02      gaggcagccgtgctccggccggtgaacg----------gcgcagcctggg
                              ** *  ***  ** **  ** *          *  **  **** 

A0A8B9NHL2_BAK1-01      ggtggtggccct-----ggtcatggtggggc--------atttagtggta
A0A8B9NHL2_BAK1-02      gactacggcactgctgcggtc--ggtggggttacccgggtgccagcagag
                        *     *** **     ****  *******             **  *  

A0A8B9NHL2_BAK1-01      cgacg--cttcttcaggc---cctaa
A0A8B9NHL2_BAK1-02      cagcaacctggcccaggcagatctaa
                        *  *   **    *****    ****

© 1998-2023Legal notice