Dataset for CDS BAK1 of Organism Laticauda laticaudata

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5SDR0_BAK1-01      cagtgttctggagaaggcgaaacatgtcctctggaggatcctgttatctc
A0A8C5SDR0_BAK1-02      cagtgttctggagaaggcgaaacatgtcctctggaggatcctgttatctc
                        **************************************************

A0A8C5SDR0_BAK1-01      ttctgcagaggacttggtagctgaacagactgaggaggtgttccagagct
A0A8C5SDR0_BAK1-02      ttctgcagaggacttggtagctgaacagactgaggaggtgttccagagct
                        **************************************************

A0A8C5SDR0_BAK1-01      atgctttccatcgataccagcaggagcgggagcaaactgagggggatatg
A0A8C5SDR0_BAK1-02      atgctttccatcgataccagcaggagcgggagcaaactgagggggatatg
                        **************************************************

A0A8C5SDR0_BAK1-01      ccagttgatccagaaattgctgcaattcagcaggagccaaatagcatcaa
A0A8C5SDR0_BAK1-02      ccagttgatccagaaattgctgcaattcagcaggagccaaatagcatcaa
                        **************************************************

A0A8C5SDR0_BAK1-01      caatcaggtgggtcgacgcttagctatcattgctgatgacatcaatgcac
A0A8C5SDR0_BAK1-02      caatcaggtgggtcgacgcttagctatcattgctgatgacatcaatgcac
                        **************************************************

A0A8C5SDR0_BAK1-01      ggtatgataaggagttctctgagatgctgaagtccttgcagccttccaag
A0A8C5SDR0_BAK1-02      ggtatgataaggagttctctgagatgctgaagtccttgcagccttccaag
                        **************************************************

A0A8C5SDR0_BAK1-01      gacaatgcatatgagtacttcaccagaatagcctccagtttgtttgaaag
A0A8C5SDR0_BAK1-02      gacaatgcatatgagtacttcaccagaatagcctccagtttgtttgaaag
                        **************************************************

A0A8C5SDR0_BAK1-01      cggcatcaattgggggcgtgtgatagcgctgctgggcttcggctacagga
A0A8C5SDR0_BAK1-02      cggcatcaattgggggcgtgtgatagcgctgctgggcttcggctacagga
                        **************************************************

A0A8C5SDR0_BAK1-01      tggcaatccatgtataccagcatggcataactggcttcctgagaagaatt
A0A8C5SDR0_BAK1-02      tggcaatccatgtataccagcatggcataactggcttcctgagaagaatt
                        **************************************************

A0A8C5SDR0_BAK1-01      gcacgttacatggctgaatttgtgctacacaatcgcattgcacgatggat
A0A8C5SDR0_BAK1-02      gcacgttacatggctgaatttgtgctacacaatcgcattgcacgatggat
                        **************************************************

A0A8C5SDR0_BAK1-01      tgctcagcaaggaggatgggtggcagcactggacttgagcaatatttatt
A0A8C5SDR0_BAK1-02      tgctcagcaaggaggatgggtaagtgaaccgaa---gaaccatcttcctc
                        *********************    * ** * *   ** * ** **  * 

A0A8C5SDR0_BAK1-01      ggaaatacatgttgatgatagccgcagtgattgtgctgggccaattcgtt
A0A8C5SDR0_BAK1-02      tagtttgtataaagtctgcttctccatttaggcaactgg---aatctatt
                             *  **   *       *  ** * *     ****   ***   **

A0A8C5SDR0_BAK1-01      ct-acggcgcttcttcaatgactga
A0A8C5SDR0_BAK1-02      ctgatgg-----cctcaat--ctag
                        ** * **     * *****  **  

© 1998-2023Legal notice