Dataset for CDS BCL-2-like of organism Mus spicilegus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6GN16_BCL2A1-      atg-----------------------------------------------
A0A8C6H5H7_BCL2A1-      atg-----------------------------------------------
A0A8C6G6C7_BCL2L1-      atgtct--------------------------------------------
A0A8C6IEV0_BCL2L10      atggccgact----------------------------------------
A0A8C6H5J8_BCL2-01      at------------------------------------------------
A0A8C6GJU8_MCL1-01      atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
A0A8C6GJU8_MCL1-02      atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
A0A8C6GJU8_MCL1-03      atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
                        **                                                

A0A8C6GN16_BCL2A1-      --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
A0A8C6G6C7_BCL2L1-      cagagcaa-----------------------ccgggag--------ctgg
A0A8C6IEV0_BCL2L10      ---cgcaggaccc------------------actgcatgaacgcactaga
A0A8C6H5J8_BCL2-01      -ggcgcaag----------------------ccgggagaacagggtatga
A0A8C6GJU8_MCL1-01      cggcgccagcctcggcgcgggcggcggttctccggcaggggcgcgcctgg
A0A8C6GJU8_MCL1-02      cggcgccagcctcggcgcgggcggcggttctccggcaggggcgcgcctgg
A0A8C6GJU8_MCL1-03      cggcgccagcctcggcgcgggcggcggttctccggcaggggcgcgcctgg
                                                                          

A0A8C6GN16_BCL2A1-      --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
A0A8C6G6C7_BCL2L1-      tggtcg---------------actttctctcctacaagctttcccagaaa
A0A8C6IEV0_BCL2L10      cggct---------------------------------------------
A0A8C6H5J8_BCL2-01      taaccg-ggagatcgtgatgaagtacatacattataagctgtcacagagg
A0A8C6GJU8_MCL1-01      tggccgaggaggccaaggcgcggcgc--------------------gagg
A0A8C6GJU8_MCL1-02      tggccgaggaggccaaggcgcggcgc--------------------gagg
A0A8C6GJU8_MCL1-03      tggccgaggaggccaaggcgcggcgc--------------------gagg
                                                                          

A0A8C6GN16_BCL2A1-      -------------------agtg---------------------------
A0A8C6H5H7_BCL2A1-      -------------------actg---------------------------
A0A8C6G6C7_BCL2L1-      ggataca------------gctggagtcagtttagtgatgtcgaagagaa
A0A8C6IEV0_BCL2L10      -------------------gctg--------tctgac-tacatatt----
A0A8C6H5J8_BCL2-01      ggctacgagtgg-------gatg--------ctggagatgcggacg----
A0A8C6GJU8_MCL1-01      ggggaggggaggccgccctgctg--------cccggcgcgcgggtggtcg
A0A8C6GJU8_MCL1-02      ggggaggggaggccgccctgctg--------cccggcgcgcgggtggtcg
A0A8C6GJU8_MCL1-03      ggggaggggaggccgccctgctg--------cccggcgcgcgggtggtcg
                                             **                           

A0A8C6GN16_BCL2A1-      ---agtatgagttcacgtatatc---------------------------
A0A8C6H5H7_BCL2A1-      ---agtccgagctcatgcatatc---------------------------
A0A8C6G6C7_BCL2L1-      taggactgaggccccagaagacactgaagcagagagggagacccccagtg
A0A8C6IEV0_BCL2L10      -----cttctgcgcacgggagcc--------------ggacaccccagaa
A0A8C6H5J8_BCL2-01      ------cggcgcccctgggggct--------------g----cccc----
A0A8C6GJU8_MCL1-01      cccggccgccgcccgtgggcgcc--------------gaggaccccgacg
A0A8C6GJU8_MCL1-02      cccggccgccgcccgtgggcgcc--------------gaggaccccgacg
A0A8C6GJU8_MCL1-03      cccggccgccgcccgtgggcgcc--------------gaggaccccgacg
                                  *  *  *                                 

A0A8C6GN16_BCL2A1-      -cact---------------------------------------------
A0A8C6H5H7_BCL2A1-      -cact---------------------------------------------
A0A8C6G6C7_BCL2L1-      ccatc------------------------------aatggcaacccatcc
A0A8C6IEV0_BCL2L10      ccacc---------------------------------------------
A0A8C6H5J8_BCL2-01      -cacc------------------------------cctggcatcttctcc
A0A8C6GJU8_MCL1-01      tcaccgcgtcggccgaaaggcggctgcataagtcgcccggcctcctcgcc
A0A8C6GJU8_MCL1-02      tcaccgcgtcggccgaaaggcggctgcataagtcgcccggcctcctcgcc
A0A8C6GJU8_MCL1-03      tcaccgcgtcggccgaaaggcggctgcataagtcgcccggcctcctcgcc
                         **                                               

A0A8C6GN16_BCL2A1-      --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
A0A8C6G6C7_BCL2L1-      tggcacctggcggata----------------------------------
A0A8C6IEV0_BCL2L10      -----gcccac---------------------------------gtctgt
A0A8C6H5J8_BCL2-01      ttccagcctga---------------------------------------
A0A8C6GJU8_MCL1-01      gtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcc
A0A8C6GJU8_MCL1-02      gtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcc
A0A8C6GJU8_MCL1-03      gtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcc
                                                                          

A0A8C6GN16_BCL2A1-      --------------------------------------------ccctgg
A0A8C6H5H7_BCL2A1-      --------------------------------------------ccctgg
A0A8C6G6C7_BCL2L1-      --------------------------------------------gccccg
A0A8C6IEV0_BCL2L10      cgagg------------------------------------------cgg
A0A8C6H5J8_BCL2-01      ----gagcaacccaatg-----------------------------cccg
A0A8C6GJU8_MCL1-01      cgaggaggaactggacggctgcgagccggaggcgatcggcaagcgcccgg
A0A8C6GJU8_MCL1-02      cgaggaggaactggacggctgcgagccggaggcgatcggcaagcgcccgg
A0A8C6GJU8_MCL1-03      cgaggaggaactggacggctgcgagccggaggcgatcggcaagcgcccgg
                                                                         *

A0A8C6GN16_BCL2A1-      ctgagc--------------------------------------------
A0A8C6H5H7_BCL2A1-      ctgagc--------------------------------------------
A0A8C6G6C7_BCL2L1-      ccgtga--------atggagccactggccacagcagcagtttggatgcac
A0A8C6IEV0_BCL2L10      ctttgcttcgctct-----gtgactaggcagatccag----caggagcac
A0A8C6H5J8_BCL2-01      ctgt---------------gcaccgggacatggctgc----cagga----
A0A8C6GJU8_MCL1-01      ccgtgctgcccctcctggagcgcgtgagcgaggcggc----caagagctc
A0A8C6GJU8_MCL1-02      ccgtgctgcccctcctggagcgcgtgagcgaggcggc----caagagctc
A0A8C6GJU8_MCL1-03      ccgtgctgcccctcctggagcgcgtgagcgaggcggc----caagagctc
                        *                                                 

A0A8C6GN16_BCL2A1-      -----------actaccttcagtatgtgctacaggtacccg---------
A0A8C6H5H7_BCL2A1-      -----------actactttcagtatgtcctacaggtacctg---------
A0A8C6G6C7_BCL2L1-      gggaggtgat--ccccatggcagcagtgaagcaagcgctgagagag----
A0A8C6IEV0_BCL2L10      caag-------aatttttttcctcctt-ctgcgaaagccgg---------
A0A8C6H5J8_BCL2-01      ------cgtctactctcaggcc-cctcgttgccaccgctgg---------
A0A8C6GJU8_MCL1-01      cggggccgacggctctctgccctccacgccgccgccgcccgaggaggaag
A0A8C6GJU8_MCL1-02      cggggccgacggctctctgccctccacgccgccgccgcccgaggaggaag
A0A8C6GJU8_MCL1-03      cggggccgacggctctctgccctccacgccgccgccgcccgaggaggaag
                                                       *     *            

A0A8C6GN16_BCL2A1-      ----------------------cctttgagtcggctccaagccaagcata
A0A8C6H5H7_BCL2A1-      ----------------------cctttgagtcggctccaagcaaagcatg
A0A8C6G6C7_BCL2L1-      ----------------------gctggcgatgagttt-----ga--actg
A0A8C6IEV0_BCL2L10      ---------------ggcaaccgcctggaactggt---gaaaca--catg
A0A8C6H5J8_BCL2-01      ----------------------gcctgcgctcagccctgtgcca--cctg
A0A8C6GJU8_MCL1-01      aggacgacctataccgccagtcgctggagatcatctc-gcgcta--cttg
A0A8C6GJU8_MCL1-02      aggacgacctataccgccagtcgctggagatcatctc-gcgcta--cttg
A0A8C6GJU8_MCL1-03      aggacgacctataccgccagtcgctggagatcatctc-gcgcta--cttg
                                               *                   *    * 

A0A8C6GN16_BCL2A1-      cag----------actgctgcaaagagttgctttctc-------------
A0A8C6H5H7_BCL2A1-      cag----------agtgctacaaagagttgctttctc-------------
A0A8C6G6C7_BCL2L1-      cgg-----------------------------------------------
A0A8C6IEV0_BCL2L10      gcggataagttgctc---tccaaaga-ccaagacttc-------------
A0A8C6H5J8_BCL2-01      tgg---------------tcca-----tctgaccctc-------------
A0A8C6GJU8_MCL1-01      cgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcggg
A0A8C6GJU8_MCL1-02      cgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcggg
A0A8C6GJU8_MCL1-03      cgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcggg
                          *                                               

A0A8C6GN16_BCL2A1-      -----tgttcagaaggaagttgga-------------------aagaacc
A0A8C6H5H7_BCL2A1-      -----cgttcagaaggaagttgaa-------------------aagaatc
A0A8C6G6C7_BCL2L1-      -------taccggagagcgttcagtgatct-------------aacatcc
A0A8C6IEV0_BCL2L10      -------aactggagccaactggtgatgctcc------------------
A0A8C6H5J8_BCL2-01      --cgccgggctgggga----tgacttctct------cgtcgctaccgtcg
A0A8C6GJU8_MCL1-01      cgcggcgggccggagagcgctggagaccctgcggcgcgtgggcgacggcg
A0A8C6GJU8_MCL1-02      cgcggcgggccggagagcgctggagaccctgcggcgcgtgggcgacggcg
A0A8C6GJU8_MCL1-03      cgcggcgggccggagagcgctggagaccctgcggcgcgtgggcgacggcg
                                 * *  *     *                             

A0A8C6GN16_BCL2A1-      tgaagtcata---cttggatgactttcacgtggaatccatagatactgcc
A0A8C6H5H7_BCL2A1-      tgaagtcata---cttggatgactttcacgtggaatccatagataccgcc
A0A8C6G6C7_BCL2L1-      cagcttcaca---------taacc--ccagggactgc----gtatcag--
A0A8C6IEV0_BCL2L10      -------------------tggccttcgcggggacgcttatgaatcaa--
A0A8C6H5J8_BCL2-01      tgacttcgca-----gagatgtccagtcag---ctgcacctgacgc----
A0A8C6GJU8_MCL1-01      tg-cagcgcaaccacgagacggccttccagggcatgctccggaaactg--
A0A8C6GJU8_MCL1-02      tg-cagcgcaaccacgagacggccttccagggcatgctccggaaactg--
A0A8C6GJU8_MCL1-03      tg-cagcgcaaccacgagacggccttccagggcatgctccggaaactg--
                                              *      *      *    *   *    

A0A8C6GN16_BCL2A1-      agaataatattcaa--------------------------ccaagtgatg
A0A8C6H5H7_BCL2A1-      agaataatattcaa--------------------------ccaagtgatg
A0A8C6G6C7_BCL2L1-      -----agctttgag---------------------------caggtagtg
A0A8C6IEV0_BCL2L10      -----ggcccttac----atgg-------------ctgtcaag-------
A0A8C6H5J8_BCL2-01      -------ccttcaccgcgaggg-gacg------ctttgccacg-gtggtg
A0A8C6GJU8_MCL1-01      -----gacattaaaaacgaaggcgatgttaaatctttttctcgagtaatg
A0A8C6GJU8_MCL1-02      -----gacattaaaaacgaaggcgatgttaaatctttttctcgagtaatg
A0A8C6GJU8_MCL1-03      -----gacattaaaaacgaaggcgatgttaaatctttttctcgagtaatg
                                  * *                                     

A0A8C6GN16_BCL2A1-      aaaaaagagtttgaagatggcatcattaattggggaaagattgtgactat
A0A8C6H5H7_BCL2A1-      gaaaaagagtttgaagatggcatcattaactggggaaggattgtgactat
A0A8C6G6C7_BCL2L1-      aatgaactctttcgggatggagt---aaactggggtcgcatcgtggcctt
A0A8C6IEV0_BCL2L10      -----------cagagaggggat------ctgaggaa-------------
A0A8C6H5J8_BCL2-01      gaggaactcttcagggatggggt---gaactgggggaggattgtggcctt
A0A8C6GJU8_MCL1-01      gtccatgttttcaaagatggcgtaacaaactggggcaggattgtgactct
A0A8C6GJU8_MCL1-02      gtccatgttttcaaagatggcgtaacaaactggggcaggattgtgactct
A0A8C6GJU8_MCL1-03      gtccatgttttcaaagatggcgtaacaaactggggcaggattgtgactct
                                       ** **  *       ** **               

A0A8C6GN16_BCL2A1-      atttacctttgg--------gggtgttctcctcaaaaaacttccacaaga
A0A8C6H5H7_BCL2A1-      atttgcctttgg--------gggtgttctcctcaaaaaacttccacaaga
A0A8C6G6C7_BCL2L1-      tttctcctttgg------cggggcactgtgcgtggaaagcgtagac--aa
A0A8C6IEV0_BCL2L10      ------------------tcgtctcata------------gtgacccgag
A0A8C6H5J8_BCL2-01      ctttgagttcgg------tggggtcatgtgtgtggagagcgtcaac--ag
A0A8C6GJU8_MCL1-01      tatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaag
A0A8C6GJU8_MCL1-02      tatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaag
A0A8C6GJU8_MCL1-03      tatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaag
                                                                 *   *    

A0A8C6GN16_BCL2A1-      ------------------------------------------ttttctgg
A0A8C6H5H7_BCL2A1-      gcagattgccctggatgtaggtgcttacaaacaagtttccagttttgtgg
A0A8C6G6C7_BCL2L1-      ggagatgc----aggtattggtgagtcggattgcaagtt---------gg
A0A8C6IEV0_BCL2L10      actgctgt------ctcatagtgaac-------------tttctgt----
A0A8C6H5J8_BCL2-01      ggagatgt----cacccctggtggacaacatcgc-------cctgt--gg
A0A8C6GJU8_MCL1-01      aaagctgcatcgaaccattagcagaaactatcacagatgttcttgtaagg
A0A8C6GJU8_MCL1-02      aaagctgcatcgaaccattagcagaaactatcacagatgttcttgtaagg
A0A8C6GJU8_MCL1-03      aaagctgcatcgaaccattagcagaaactatcacagatgttcttgtaagg
                                                                          

A0A8C6GN16_BCL2A1-      cagaattcataatgaa----taacacaggagaat--ggatatggcaggat
A0A8C6H5H7_BCL2A1-      cagaattcataatgaa----taacacaggagaat--ggatacggcggaat
A0A8C6G6C7_BCL2L1-      atggccacctatctgaat--gaccacctagagccttggatccaggagaac
A0A8C6IEV0_BCL2L10      ataatctgctcatggggcgtcggcac---cgctccaggctggaggctctc
A0A8C6H5J8_BCL2-01      atgactgagtacctgaac--cggcatctgcacacctggatccaggataac
A0A8C6GJU8_MCL1-01      acga------aacgggac--tggcttgt-caaac--------------aa
A0A8C6GJU8_MCL1-02      acga------aacgggac--tggcttgt-caaac--------------aa
A0A8C6GJU8_MCL1-03      acga------aacgggac--tggcttgt-caaac--------------aa
                                               *                          

A0A8C6GN16_BCL2A1-      ggagactgggtatct---ttcaaaaaatccagaggttttaaatttttttg
A0A8C6H5H7_BCL2A1-      ggaggttgggaagatggcttcataa-----agaagtttgaacc-------
A0A8C6G6C7_BCL2L1-      ggcggctgggacact---tttgtgg------atctctacggga-------
A0A8C6IEV0_BCL2L10      ggcggctgggatggc---ttt-tgc-----cgcttcttcaaga-------
A0A8C6H5J8_BCL2-01      ggaggctgggatgcc---tttgtgg--------------aact-------
A0A8C6GJU8_MCL1-01      agaggctggcctcca---tggttaa-----agg---ttcagcc-------
A0A8C6GJU8_MCL1-02      agaggctgggatggg---tttgtgg-----agttcttccacgt-------
A0A8C6GJU8_MCL1-03      agaggctgggttgta---cttctaa-----------ttcagtt-------
                         * *  ***                                         

A0A8C6GN16_BCL2A1-      gattatcggtgtactatgtgccagtctgctttgtaaggctataatatctc
A0A8C6H5H7_BCL2A1-      --------------------caaatctggct-----ggct----------
A0A8C6G6C7_BCL2L1-      -acaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgct-
A0A8C6IEV0_BCL2L10      -ac-------------------------------c---ctttaccgctc-
A0A8C6H5J8_BCL2-01      -at-------------------------------atggccccagcatgc-
A0A8C6GJU8_MCL1-01      -cc-------------------------------a----cttcaca-gt-
A0A8C6GJU8_MCL1-02      -ac-------------------------------aggacctagaag-gc-
A0A8C6GJU8_MCL1-03      -gg-------------------------------ataatcttcaga-gc-
                                                                          

A0A8C6GN16_BCL2A1-      acacagtaaattataagaaaaaaaaaaaaaaaaagaagacgacgtttagg
A0A8C6H5H7_BCL2A1-      ----------------------------------------gacttttctg
A0A8C6G6C7_BCL2L1-      ----------------------------------------ggttcctg--
A0A8C6IEV0_BCL2L10      ----------------------------------------ggcttctg--
A0A8C6H5J8_BCL2-01      ----------------------------------------gacctctgtt
A0A8C6GJU8_MCL1-01      ----------------------------------------gac--atgtt
A0A8C6GJU8_MCL1-02      ----------------------------------------ggc----atc
A0A8C6GJU8_MCL1-03      ----------------------------------------agt--ggatt
                                                                          

A0A8C6GN16_BCL2A1-      gagtctgagagtgctggcatccaaggcaccagcattgatgggctgcatct
A0A8C6H5H7_BCL2A1-      cag-------------------------------atgacaggacagatct
A0A8C6G6C7_BCL2L1-      ---------------------acgggcatgactgtggctggtgtggttct
A0A8C6IEV0_BCL2L10      ---------------------gagaagattgctgattcaggcttttctgt
A0A8C6H5J8_BCL2-01      tgatttctcctggctgtctctgaagaccctgctcagcctggccctggtcg
A0A8C6GJU8_MCL1-01      catataaaggaagccaatcacccaactgctga------------------
A0A8C6GJU8_MCL1-02      agaaatgtgctgctggcttttgcgggtgttgctggagtaggggctggtct
A0A8C6GJU8_MCL1-03      caaaccgtga----------------------------------------
                                                                          

A0A8C6GN16_BCL2A1-      g---------------ttaagagccctcttgctgaaatatgggagaatta
A0A8C6H5H7_BCL2A1-      g---------------ggaaatgctctttctcc-----------------
A0A8C6G6C7_BCL2L1-      g-------------ctgggctcactcttcagtc-----------------
A0A8C6IEV0_BCL2L10      caggcttctttgcaacagccatcttttttatct-----------------
A0A8C6H5J8_BCL2-01      gggcctgcatcactctgggtgcatacctgggcc-----------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      g-------------------gcatatctaataa-----------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
                                                                          

A0A8C6GN16_BCL2A1-      cccaggaaatgaggtag------
A0A8C6H5H7_BCL2A1-      ---------tcaagtaa------
A0A8C6G6C7_BCL2L1-      ---------ggaagtga------
A0A8C6IEV0_BCL2L10      ---------ggaaacgtttataa
A0A8C6H5J8_BCL2-01      ---------acaagtga------
A0A8C6GJU8_MCL1-01      -----------------------
A0A8C6GJU8_MCL1-02      ---------gatag---------
A0A8C6GJU8_MCL1-03      -----------------------
                                               

© 1998-2023Legal notice