Dataset for CDS BCL-2-like of organism Mus spicilegus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6GN16_BCL2A1-      at----------------------------------------------ga
A0A8C6H5H7_BCL2A1-      at----------------------------------------------ga
A0A8C6G6C7_BCL2L1-      at------------------------------------------------
A0A8C6IEV0_BCL2L10      at----------------------------------------------gg
A0A8C6GJU8_MCL1-01      atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
A0A8C6GJU8_MCL1-02      atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
A0A8C6GJU8_MCL1-03      atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
A0A8C6H5J8_BCL2-01      at----------------------------------------------gg
A0A8C6MXN1_BCL2L2-      at----------------------------------------------gg
A0A8C6MXN1_BCL2L2-      at----------------------------------------------gg
                        **                                                

A0A8C6GN16_BCL2A1-      gtg-------agtatgagttcacgtatatccactcc-------------c
A0A8C6H5H7_BCL2A1-      ctg-------agtccgagctcatgcatatccactcc-------------c
A0A8C6G6C7_BCL2L1-      -----------gtctcagagcaa-----------ccgggag--------c
A0A8C6IEV0_BCL2L10      ccgactcgcaggacccactgcatgaacgcactagacgg-----------c
A0A8C6GJU8_MCL1-01      cgg---cgccagcctcggcgcgggcggcggttctccggcaggggcgcgcc
A0A8C6GJU8_MCL1-02      cgg---cgccagcctcggcgcgggcggcggttctccggcaggggcgcgcc
A0A8C6GJU8_MCL1-03      cgg---cgccagcctcggcgcgggcggcggttctccggcaggggcgcgcc
A0A8C6H5J8_BCL2-01      cg------caagccgggagaacagggtatgataaccgggag--------a
A0A8C6MXN1_BCL2L2-      cga---ccccagcctcaacccca------gacacacgggct--------c
A0A8C6MXN1_BCL2L2-      cga---ccccagcctcaacccca------gacacacgggct--------c
                                   *                       *              

A0A8C6GN16_BCL2A1-      tggctgagcactaccttcagtat--------------gtgctacaggtac
A0A8C6H5H7_BCL2A1-      tggctgagcactactttcagtat--------------gtcctacaggtac
A0A8C6G6C7_BCL2L1-      tggtggtcgactttctctcctacaagctttcccagaaaggatacagctgg
A0A8C6IEV0_BCL2L10      tgctgtctgactacatattctt------------------ctgcgcacgg
A0A8C6GJU8_MCL1-01      tggtggccgag-----------------gaggccaaggcgcggcgcgagg
A0A8C6GJU8_MCL1-02      tggtggccgag-----------------gaggccaaggcgcggcgcgagg
A0A8C6GJU8_MCL1-03      tggtggccgag-----------------gaggccaaggcgcggcgcgagg
A0A8C6H5J8_BCL2-01      tcgtgatgaagtacatacattataagctgtcacagaggggctacgagtgg
A0A8C6MXN1_BCL2L2-      tagtggctgactttgtaggctataagctgaggcagaagggttatgtctgt
A0A8C6MXN1_BCL2L2-      tagtggctgactttgtaggctataagctgaggcagaagggttatgtctgt
                        *        *                                        

A0A8C6GN16_BCL2A1-      -------------------------------------------------c
A0A8C6H5H7_BCL2A1-      -------------------------------------------------c
A0A8C6G6C7_BCL2L1-      agtcagtttagtgatgtcgaagagaataggactgaggccccagaagacac
A0A8C6IEV0_BCL2L10      ---------------------gag-------------------------c
A0A8C6GJU8_MCL1-01      ---------------------ggggaggg-gaggccgccctgctg---cc
A0A8C6GJU8_MCL1-02      ---------------------ggggaggg-gaggccgccctgctg---cc
A0A8C6GJU8_MCL1-03      ---------------------ggggaggg-gaggccgccctgctg---cc
A0A8C6H5J8_BCL2-01      ---------------------gatgctggagatgcggacgcggcg---cc
A0A8C6MXN1_BCL2L2-      ---------------------ggagctgg--------------------c
A0A8C6MXN1_BCL2L2-      ---------------------ggagctgg--------------------c
                                                                         *

A0A8C6GN16_BCL2A1-      c---gcctttgagtcggctc------------------------------
A0A8C6H5H7_BCL2A1-      t---gcctttgagtcggctc------------------------------
A0A8C6G6C7_BCL2L1-      tgaagcagagagggagacccccagtgccatcaatggcaacccatcctggc
A0A8C6IEV0_BCL2L10      c-----------ggacaccc------------------------------
A0A8C6GJU8_MCL1-01      cggcgcgcgggtggtcgccc------------------------------
A0A8C6GJU8_MCL1-02      cggcgcgcgggtggtcgccc------------------------------
A0A8C6GJU8_MCL1-03      cggcgcgcgggtggtcgccc------------------------------
A0A8C6H5J8_BCL2-01      c------ctgggggctgccc------ccacccctggcatcttctccttcc
A0A8C6MXN1_BCL2L2-      c------ctggagaaggccc------------------------------
A0A8C6MXN1_BCL2L2-      c------ctggagaaggccc------------------------------
                                    *    * *                              

A0A8C6GN16_BCL2A1-      --------------------caagccaagcatacag--------------
A0A8C6H5H7_BCL2A1-      --------------------caagcaaagcatgcag--------------
A0A8C6G6C7_BCL2L1-      acctggcggatagc------cccgccgtgaatggag---ccactggccac
A0A8C6IEV0_BCL2L10      -----cagaaccaccg----cccac-gtctgtcgag--------------
A0A8C6GJU8_MCL1-01      --------ggccgccg----cccgt-gggcgccgaggaccccgacgtcac
A0A8C6GJU8_MCL1-02      --------ggccgccg----cccgt-gggcgccgaggaccccgacgtcac
A0A8C6GJU8_MCL1-03      --------ggccgccg----cccgt-gggcgccgaggaccccgacgtcac
A0A8C6H5J8_BCL2-01      agcctgagagcaacccaatgcccgctgtgcaccggg-------------a
A0A8C6MXN1_BCL2L2-      --------agccgccga---cccgc--tgcaccaag-------------c
A0A8C6MXN1_BCL2L2-      --------agccgccga---cccgc--tgcaccaag-------------c
                                            *              *              

A0A8C6GN16_BCL2A1-      -actgctgcaaaga-------------gttgctttctctgttcagaagga
A0A8C6H5H7_BCL2A1-      -agtgctacaaaga-------------gttgctttctccgttcagaagga
A0A8C6G6C7_BCL2L1-      agcagcagtttggatgcacgggaggtgatc-cccatggcagcagtgaagc
A0A8C6IEV0_BCL2L10      -gcggct---------------------ttgcttcgctctgtgactaggc
A0A8C6GJU8_MCL1-01      cgcgtcggccgaaaggcggctgcataagtcgcccggcctcctcgccgtgc
A0A8C6GJU8_MCL1-02      cgcgtcggccgaaaggcggctgcataagtcgcccggcctcctcgccgtgc
A0A8C6GJU8_MCL1-03      cgcgtcggccgaaaggcggctgcataagtcgcccggcctcctcgccgtgc
A0A8C6H5J8_BCL2-01      catggctgccaggacgtctactctcaggcccctcgttgccaccgctgggc
A0A8C6MXN1_BCL2L2-      catg-----------------------------------------cgggc
A0A8C6MXN1_BCL2L2-      catg-----------------------------------------cgggc
                                                                        * 

A0A8C6GN16_BCL2A1-      a----------------------------------------------gtt
A0A8C6H5H7_BCL2A1-      a----------------------------------------------gtt
A0A8C6G6C7_BCL2L1-      aagcgctgagagag---------------------------------gct
A0A8C6IEV0_BCL2L10      a----------------------------------------------gat
A0A8C6GJU8_MCL1-01      c----------------------------------------------gcc
A0A8C6GJU8_MCL1-02      c----------------------------------------------gcc
A0A8C6GJU8_MCL1-03      c----------------------------------------------gcc
A0A8C6H5J8_BCL2-01      ctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggct
A0A8C6MXN1_BCL2L2-      t----------------------------------------------gct
A0A8C6MXN1_BCL2L2-      t----------------------------------------------gct
                                                                       *  

A0A8C6GN16_BCL2A1-      ---ggaaagaacc----------------------------tgaagtcat
A0A8C6H5H7_BCL2A1-      ---gaaaagaatc----------------------------tgaagtcat
A0A8C6G6C7_BCL2L1-      ---ggcgatgagt---ttgaactgcggtaccggagagcgttcagtgatct
A0A8C6IEV0_BCL2L10      ccagcaggagcac----caagaatttttttcctc----cttctgcgaaa-
A0A8C6GJU8_MCL1-01      cgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggagg
A0A8C6GJU8_MCL1-02      cgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggagg
A0A8C6GJU8_MCL1-03      cgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggagg
A0A8C6H5J8_BCL2-01      ---ggggatgact---tctctcgtcgctaccgtcgtgacttcgcagagat
A0A8C6MXN1_BCL2L2-      ---ggagacgagt---ttgagacccgtttccgccgcaccttctctgacct
A0A8C6MXN1_BCL2L2-      ---ggagacgagt---ttgagacccgtttccgccgcaccttctctgacct
                           *                                         *    

A0A8C6GN16_BCL2A1-      acttggatgactttcacgt------------ggaatccatagatactgc-
A0A8C6H5H7_BCL2A1-      acttggatgactttcacgt------------ggaatccatagataccgc-
A0A8C6G6C7_BCL2L1-      aacatcccagc-ttcacat---------------aaccccagggactgc-
A0A8C6IEV0_BCL2L10      gccggggcaac-------------------------cgcctggaactgg-
A0A8C6GJU8_MCL1-01      aactggacggc-tgcgagccggaggcgatcggcaagcgcccggccgtgct
A0A8C6GJU8_MCL1-02      aactggacggc-tgcgagccggaggcgatcggcaagcgcccggccgtgct
A0A8C6GJU8_MCL1-03      aactggacggc-tgcgagccggaggcgatcggcaagcgcccggccgtgct
A0A8C6H5J8_BCL2-01      gtccagtcagc-tgcacct---------------gacgcccttcaccgc-
A0A8C6MXN1_BCL2L2-      ggccgctcagc-tacacgt---------------gaccccaggctcagc-
A0A8C6MXN1_BCL2L2-      ggccgctcagc-tacacgt---------------gaccccaggctcagc-
                                  *                         *          *  

A0A8C6GN16_BCL2A1-      ------cagaataatattcaaccaagtgatgaaaaaagag----------
A0A8C6H5H7_BCL2A1-      ------cagaataatattcaaccaagtgatggaaaaagag----------
A0A8C6G6C7_BCL2L1-      ------gtatcagagctttgagcaggtagtgaatgaactc----------
A0A8C6IEV0_BCL2L10      --------tgaaacacat------ggcggataagttgctc----------
A0A8C6GJU8_MCL1-01      gcccctcctggagcgcgtgagcgaggcggccaa-gagctccggggccgac
A0A8C6GJU8_MCL1-02      gcccctcctggagcgcgtgagcgaggcggccaa-gagctccggggccgac
A0A8C6GJU8_MCL1-03      gcccctcctggagcgcgtgagcgaggcggccaa-gagctccggggccgac
A0A8C6H5J8_BCL2-01      ------gaggggacgctttgccacggtggtggaggaactc----------
A0A8C6MXN1_BCL2L2-      ------ccagcaacgcttcacccaggtttccgacgaactt----------
A0A8C6MXN1_BCL2L2-      ------ccagcaacgcttcacccaggtttccgacgaactt----------
                                         *       *      *                 

A0A8C6GN16_BCL2A1-      -----------tttgaagatggcatcattaattggggaaa----------
A0A8C6H5H7_BCL2A1-      -----------tttgaagatggcatcattaactggggaag----------
A0A8C6G6C7_BCL2L1-      -----------tttcgggat---ggagtaaactggggtcg----------
A0A8C6IEV0_BCL2L10      -----------tccaaagaccaagacttcaactggagcca----------
A0A8C6GJU8_MCL1-01      ggctctctgccctccacgcc---gccgccgcccgaggaggaagaggacga
A0A8C6GJU8_MCL1-02      ggctctctgccctccacgcc---gccgccgcccgaggaggaagaggacga
A0A8C6GJU8_MCL1-03      ggctctctgccctccacgcc---gccgccgcccgaggaggaagaggacga
A0A8C6H5J8_BCL2-01      -----------ttcagggat---ggggtgaactgggggag----------
A0A8C6MXN1_BCL2L2-      -----------ttccaaggg---ggccctaactggggccg----------
A0A8C6MXN1_BCL2L2-      -----------ttccaaggg---ggccctaactggggccg----------
                                         *               *  *             

A0A8C6GN16_BCL2A1-      --gattgtgactatatttacctttgggggtgttctcctcaaaaa------
A0A8C6H5H7_BCL2A1-      --gattgtgactatatttgcctttgggggtgttctcctcaaaaa------
A0A8C6G6C7_BCL2L1-      --catcgtggcctttttctcctttggcggggcactgtgcgtgga------
A0A8C6IEV0_BCL2L10      ---------------actggtgatgctcctggccttcgcgggga------
A0A8C6GJU8_MCL1-01      cctataccgccagtcgctggagatcatctcgcgctacttgcgggagcagg
A0A8C6GJU8_MCL1-02      cctataccgccagtcgctggagatcatctcgcgctacttgcgggagcagg
A0A8C6GJU8_MCL1-03      cctataccgccagtcgctggagatcatctcgcgctacttgcgggagcagg
A0A8C6H5J8_BCL2-01      --gattgtggccttctttgagttcggtggggtcatgtgtgtgga------
A0A8C6MXN1_BCL2L2-      --tcttgtggcattctttgtctttggggctgccctgtgtgctga------
A0A8C6MXN1_BCL2L2-      --tcttgtggcattctttgtctttggggctgccctgtgtgctga------
                                                      *   *               

A0A8C6GN16_BCL2A1-      ---acttccacaaga-----------------------------------
A0A8C6H5H7_BCL2A1-      ---acttccacaagagcagattgccc-----tggatgtaggtgcttacaa
A0A8C6G6C7_BCL2L1-      -aagcgtagacaaggagatgcaggtatt-ggtga---------gtcggat
A0A8C6IEV0_BCL2L10      -------cgcttatgaatcaaggcccttacatggctgtcaagcagagagg
A0A8C6GJU8_MCL1-01      cgaccggctccaaggactcgaagcctctgggcga--ggcgggcgcggcg-
A0A8C6GJU8_MCL1-02      cgaccggctccaaggactcgaagcctctgggcga--ggcgggcgcggcg-
A0A8C6GJU8_MCL1-03      cgaccggctccaaggactcgaagcctctgggcga--ggcgggcgcggcg-
A0A8C6H5J8_BCL2-01      -gagcgtcaacagggagatgtcacccct-ggtgg---------acaacat
A0A8C6MXN1_BCL2L2-      -gagtgtcaacaaagaaatggagccttt-ggtgg--gacaagtgcaggat
A0A8C6MXN1_BCL2L2-      -gagtgtcaacaaagaaatggagccttt-ggtgg--gacaagtgcaggat
                                                                          

A0A8C6GN16_BCL2A1-      ------------ttttctggcagaattcataatgaataacacaggagaat
A0A8C6H5H7_BCL2A1-      acaagtttccagttttgtggcagaattcataatgaataacacaggagaat
A0A8C6G6C7_BCL2L1-      tgcaagttgga------tggccacctatctgaatgaccacctagagcctt
A0A8C6IEV0_BCL2L10      ggatctgaggaatcgtctcatagtgacccgagactgctgtctcatagtga
A0A8C6GJU8_MCL1-01      -ggccggagag------cgctggagaccctg---cggcgcgtgggcgacg
A0A8C6GJU8_MCL1-02      -ggccggagag------cgctggagaccctg---cggcgcgtgggcgacg
A0A8C6GJU8_MCL1-03      -ggccggagag------cgctggagaccctg---cggcgcgtgggcgacg
A0A8C6H5J8_BCL2-01      cgccctgtgga------tgactgagtacctgaaccggcatctgcacacct
A0A8C6MXN1_BCL2L2-      -------tgga------tggtggcctacctggagacacgtctggctgact
A0A8C6MXN1_BCL2L2-      -------tgga------tggtggcctacctggagacacgtctggctgact
                                                                          

A0A8C6GN16_BCL2A1-      ggatatggcaggatggagactgggtatct---ttcaaaaaatccagaggt
A0A8C6H5H7_BCL2A1-      ggatacggcggaatggaggttgggaagatggcttcataa-----agaagt
A0A8C6G6C7_BCL2L1-      ggatccaggagaacggcggctgggacacttt-tgtggatctctacgggaa
A0A8C6IEV0_BCL2L10      actttctgtataatctgctcatgg-ggcgtc---ggcaccgctccaggct
A0A8C6GJU8_MCL1-01      gcgtgcagcgcaac---cacgagacggccttccagggcatgctccggaaa
A0A8C6GJU8_MCL1-02      gcgtgcagcgcaac---cacgagacggccttccagggcatgctccggaaa
A0A8C6GJU8_MCL1-03      gcgtgcagcgcaac---cacgagacggccttccagggcatgctccggaaa
A0A8C6H5J8_BCL2-01      ggatccaggataacggaggctgggatgcctt-tgtggaactatat-----
A0A8C6MXN1_BCL2L2-      ggatccacagcagtgggggctgggcggagtt-cacagctctatacgggga
A0A8C6MXN1_BCL2L2-      ggatccacagcagtgggggctgggcggagtt-cacagctctatacgggga
                           *                  *                           

A0A8C6GN16_BCL2A1-      tttaaattttttt-----ggattatcggtgtactatgtgccagtctgctt
A0A8C6H5H7_BCL2A1-      ttgaacc--------------------------------caaatctggct
A0A8C6G6C7_BCL2L1-      caatgc------------agcagccgagagccggaaaggccaggagcgct
A0A8C6IEV0_BCL2L10      ggaggctctcggcggctgggatggcttttgccgcttcttcaagaaccctt
A0A8C6GJU8_MCL1-01      ctggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggt
A0A8C6GJU8_MCL1-02      ctggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggt
A0A8C6GJU8_MCL1-03      ctggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggt
A0A8C6H5J8_BCL2-01      ---ggcccc---------agc----atgcgacctctgtttgatttctcct
A0A8C6MXN1_BCL2L2-      cggggccct---------ggaggaggcacggcgtctgcgggaggggaact
A0A8C6MXN1_BCL2L2-      cggggccct---------ggaggaggcacggcgtctgcgggaggggaact
                                                                 *       *

A0A8C6GN16_BCL2A1-      tgtaaggctataatatctcacacagtaaattataagaaaaaaaaaaaaaa
A0A8C6H5H7_BCL2A1-      -----ggct-----------------------------------------
A0A8C6G6C7_BCL2L1-      tcaaccgct-----------------------------------------
A0A8C6IEV0_BCL2L10      taccgctcg-----------------------------------------
A0A8C6GJU8_MCL1-01      ccatg---------------------------------------------
A0A8C6GJU8_MCL1-02      ccatg---------------------------------------------
A0A8C6GJU8_MCL1-03      ccatg---------------------------------------------
A0A8C6H5J8_BCL2-01      ggctg---------------------------------------------
A0A8C6MXN1_BCL2L2-      gggca---------------------------------------------
A0A8C6MXN1_BCL2L2-      gggca---------------------------------------------
                                                                          

A0A8C6GN16_BCL2A1-      aaagaagacgacgtttagggagtctgagagtgctggcatccaaggcacca
A0A8C6H5H7_BCL2A1-      ---------gacttttctgcag----------------------------
A0A8C6G6C7_BCL2L1-      -----------ggttcctga---------------------cgggcatga
A0A8C6IEV0_BCL2L10      -----------gcttctggaga----agattgc--tgattcaggcttttc
A0A8C6GJU8_MCL1-01      -------------ttttcaaag----atggcgtaacaaactggggcagga
A0A8C6GJU8_MCL1-02      -------------ttttcaaag----atggcgtaacaaactggggcagga
A0A8C6GJU8_MCL1-03      -------------ttttcaaag----atggcgtaacaaactggggcagga
A0A8C6H5J8_BCL2-01      -------------tctctgaag----accctgc--tcagcctggccctgg
A0A8C6MXN1_BCL2L2-      -------------tcagtgagg----acagtgc--tgacgggggccgtgg
A0A8C6MXN1_BCL2L2-      -------------tcagtgagg----acagtgc--tgacgggggccgtgg
                                     *                                    

A0A8C6GN16_BCL2A1-      gcattgatgggctgcatctgttaagagccctcttgctgaaatatgggaga
A0A8C6H5H7_BCL2A1-      ---atgacaggacagatctgggaaatgctctttctcc-------------
A0A8C6G6C7_BCL2L1-      ctgtggctggtgtggttctgctgggctcactcttcagtcg----------
A0A8C6IEV0_BCL2L10      ---tgtcaggcttctttgcaacagccatcttttttatctg----------
A0A8C6GJU8_MCL1-01      ---ttgtgactcttatttctttcggtgcctttgtggccaaacacttaaag
A0A8C6GJU8_MCL1-02      ---ttgtgactcttatttctttcggtgcctttgtggccaaacacttaaag
A0A8C6GJU8_MCL1-03      ---ttgtgactcttatttctttcggtgcctttgtggccaaacacttaaag
A0A8C6H5J8_BCL2-01      ---tcggggcctgcatcactctgggtgcatacctgggcca----------
A0A8C6MXN1_BCL2L2-      cactgggggccctggtaactgtaggggccttttttgctag----------
A0A8C6MXN1_BCL2L2-      cactgggggccctggtaactgtaggggccttttttgctag----------
                                                                          

A0A8C6GN16_BCL2A1-      attacccaggaaatgaggtag-----------------------------
A0A8C6H5H7_BCL2A1-      -------------tcaagtaa-----------------------------
A0A8C6G6C7_BCL2L1-      --------------gaagtga-----------------------------
A0A8C6IEV0_BCL2L10      -----------------gaaacgtttataa--------------------
A0A8C6GJU8_MCL1-01      agcgtaaa-----ccaagaaagctgcatcgaaccattagcagaaactatc
A0A8C6GJU8_MCL1-02      agcgtaaa-----ccaagaaagctgcatcgaaccattagcagaaactatc
A0A8C6GJU8_MCL1-03      agcgtaaa-----ccaagaaagctgcatcgaaccattagcagaaactatc
A0A8C6H5J8_BCL2-01      --------------caagtga-----------------------------
A0A8C6MXN1_BCL2L2-      --------------caagtga-----------------------------
A0A8C6MXN1_BCL2L2-      --------------caagtga-----------------------------
                                         *                                

A0A8C6GN16_BCL2A1-      --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
A0A8C6IEV0_BCL2L10      --------------------------------------------------
A0A8C6GJU8_MCL1-01      acagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagagg
A0A8C6GJU8_MCL1-02      acagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagagg
A0A8C6GJU8_MCL1-03      acagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagagg
A0A8C6H5J8_BCL2-01      --------------------------------------------------
A0A8C6MXN1_BCL2L2-      --------------------------------------------------
A0A8C6MXN1_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6GN16_BCL2A1-      --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
A0A8C6IEV0_BCL2L10      --------------------------------------------------
A0A8C6GJU8_MCL1-01      ctggcctccatggttaaagg---ttcagcccca----cttcacagtgaca
A0A8C6GJU8_MCL1-02      ctgggatgggtttgtggagttcttccacgtacaggacctagaaggcggc-
A0A8C6GJU8_MCL1-03      ctgggttgtacttctaa------ttcagttggataatcttcagagcagtg
A0A8C6H5J8_BCL2-01      --------------------------------------------------
A0A8C6MXN1_BCL2L2-      --------------------------------------------------
A0A8C6MXN1_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6GN16_BCL2A1-      --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
A0A8C6IEV0_BCL2L10      --------------------------------------------------
A0A8C6GJU8_MCL1-01      tgttcatataaaggaagccaatcacccaactgctga--------------
A0A8C6GJU8_MCL1-02      -atcagaaatgtgctgctggcttttgcgggtgttgctggagtaggggctg
A0A8C6GJU8_MCL1-03      gattcaaaccgtga------------------------------------
A0A8C6H5J8_BCL2-01      --------------------------------------------------
A0A8C6MXN1_BCL2L2-      --------------------------------------------------
A0A8C6MXN1_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6GN16_BCL2A1-      -----------------------
A0A8C6H5H7_BCL2A1-      -----------------------
A0A8C6G6C7_BCL2L1-      -----------------------
A0A8C6IEV0_BCL2L10      -----------------------
A0A8C6GJU8_MCL1-01      -----------------------
A0A8C6GJU8_MCL1-02      gtctggcatatctaataagatag
A0A8C6GJU8_MCL1-03      -----------------------
A0A8C6H5J8_BCL2-01      -----------------------
A0A8C6MXN1_BCL2L2-      -----------------------
A0A8C6MXN1_BCL2L2-      -----------------------
                                               

© 1998-2022Legal notice