Dataset for CDS BCL-2-like of organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H9GPE7_BCL2-01        ------------------------------------------------at
H9GHK7_BCL2L1-01      ------------------------------------------------at
H9GEA6_MCL1-02        ------------------------------------------------at
H9GEA6_MCL1-01        atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcat

H9GPE7_BCL2-01        ggc----------------tcatcctggga--------------taagag
H9GHK7_BCL2L1-01      gtc-----------------------gagc-------------------a
H9GEA6_MCL1-02        ggccccgaacacgccggcctcacctggagccggcggaggcgtcggagaaa
H9GEA6_MCL1-01        ggccccgaacacgccggcctcacctggagccggcggaggcgtcggagaaa
                      * *                       * *                     

H9GPE7_BCL2-01        gttacgacaacag----ggaaatcgtgctgaggtacatccattacaagc-
H9GHK7_BCL2L1-01      gtaaccg----------agcgctcgtggtggacttcctttcctacaagc-
H9GEA6_MCL1-02        gtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcc
H9GEA6_MCL1-01        gtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcc
                      **  *                   * *  *   *           * ** 

H9GPE7_BCL2-01        --------tgtcgcagaaaggatatgac----------------------
H9GHK7_BCL2L1-01      --------tgtcgcagcggggccacagc-------tggcatgaga--ttg
H9GEA6_MCL1-02        tcaggtcttttctcagagaggccgcgccctctgattggcggggggcctcg
H9GEA6_MCL1-01        tcaggtcttttctcagagaggccgcgccctctgattggcggggggcctcg
                              * ** ***   **      *                      

H9GPE7_BCL2-01        --------------------------------------------------
H9GHK7_BCL2L1-01      agatg-------gagagcg-------------gggagg---------aag
H9GEA6_MCL1-02        cgccggacccctgagggcgctgattggcccctgggaggggtctcagcggg
H9GEA6_MCL1-01        cgccggacccctgagggcgctgattggcccctgggaggggtctcagcggg

H9GPE7_BCL2-01        -----------tgggttgccagtggagacagaggaaagtc----------
H9GHK7_BCL2L1-01      cgatg-------gagccagcaaacgagacggggaacaccctcaatgggag
H9GEA6_MCL1-02        cgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
H9GEA6_MCL1-01        cgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgc
                                  * *         ****  * *   *  *          

H9GPE7_BCL2-01        --------agcatctctttcccca---------gagcttctcaattctga
H9GHK7_BCL2L1-01      cccttcttggcatcccagccccagcc--------------atgtcatcaa
H9GEA6_MCL1-02        cc------ggcctccctgccgctgcctgaaggggagctcgacggctgcga
H9GEA6_MCL1-01        cc------ggcctccctgccgctgcctgaaggggagctcgacggctgcga
                               ** ** *   * *                           *

H9GPE7_BCL2-01        t----cctgtgagta----------------------ccaatgccccca-
H9GHK7_BCL2L1-01      tggggcctcagaaca--------------------ccccgaactccttg-
H9GEA6_MCL1-02        ggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccctcgc
H9GEA6_MCL1-01        ggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccctcgc
                           **   **  *                       * *   **    

H9GPE7_BCL2-01        ---------------------gggaagaa---------------------
H9GHK7_BCL2L1-01      ------aaga------ggaggaggaagaa---------------------
H9GEA6_MCL1-02        cggacaaagagatggcggaggaggaaggagagaaagggaaaggagggccc
H9GEA6_MCL1-01        cggacaaagagatggcggaggaggaaggagagaaagggaaaggagggccc
                                            ***** *                     

H9GPE7_BCL2-01        ---------------------cctgacccggtgccacaggttgtccatac
H9GHK7_BCL2L1-01      ------------------------aacccgagggtgga--tgtcagccag
H9GEA6_MCL1-02        cctctcttcccggaccacctgcggaagacgacgctggaagtggtaggccg
H9GEA6_MCL1-01        cctctcttcccggaccacctgcggaagacgacgctggaagtggtaggccg
                                               *  **  *    *  *         

H9GPE7_BCL2-01        aacattacgccaagccggagatgagttct--cccgacgctatcgg-----
H9GHK7_BCL2L1-01      acactta-gggaggctggcgatgagtttgaa--ctaaggtaccgg-----
H9GEA6_MCL1-02        ctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccgggccca
H9GEA6_MCL1-01        ctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccgggccca
                           *  *  * ** *  ** ***        * * *  * ***     

H9GPE7_BCL2-01        ----------------------agggactttgctcaaatgtctggcca--
H9GHK7_BCL2L1-01      ----------------------cgggcttttagtgacctgacctccca--
H9GEA6_MCL1-02        agttctccttccaaggcttgctggggcgcttcgggagcagccccaacgag
H9GEA6_MCL1-01        agttctccttccaaggcttgctggggcgcttcgggagcagccccaacgag
                                             ***   **    *   * *    *   

H9GPE7_BCL2-01        ---------------gctgcatttgaccc-------------ccagcact
H9GHK7_BCL2L1-01      ---------------gctccacatcaccttgggcacggcataccagagct
H9GEA6_MCL1-02        gcggaggtggcgcgcgcgctggag-acgctgcgccgggtgggcgagagcc
H9GEA6_MCL1-01        gcggaggtggcgcgcgcgctggag-acgctgcgccgggtgggcgagagcc
                                     **        **               * **  * 

H9GPE7_BCL2-01        gccagaag--tcgttttgtggcc---------------------------
H9GHK7_BCL2L1-01      tcgagcag------------------------------------------
H9GEA6_MCL1-02        tccgggagaagcacctgctggccttccaaggaatgcttagaaagttggaa
H9GEA6_MCL1-01        tccgggagaagcacctgctggccttccaaggaatgcttagaaagttggaa
                       *  * **                                          

H9GPE7_BCL2-01        ------------------------------------gtggtggaagagct
H9GHK7_BCL2L1-01      ------------------------------------gtggtgaatgaact
H9GEA6_MCL1-02        ataaagaaagaagaggacttggcgtctgtggcagaagtgacaacagaggt
H9GEA6_MCL1-01        ataaagaaagaagaggacttggcgtctgtggcagaagtgacaacagaggt
                                                          ***      **  *

H9GPE7_BCL2-01        cttccaggacgg---tgtgaactgggggaggattgtggcgttctttgaat
H9GHK7_BCL2L1-01      cttccacgatgg---ggtaaactgggggcggatagtggcattcttctcct
H9GEA6_MCL1-02        cttcagagatggcataataaactggggccgcattgtgactctcatctctt
H9GEA6_MCL1-01        cttcagagatggcataataaactggggccgcattgtgactctcatctctt
                      ****   ** **     * ********  * ** *** *  ** *    *

H9GPE7_BCL2-01        ttgg------tggcatgctgtgcgtggagagtgtcagccgggag-atgt-
H9GHK7_BCL2L1-01      ttgg------gggagccctgtgcgtggagagcgttgacaaagag-atgc-
H9GEA6_MCL1-02        ttggtgcctttgttgccaaacacctgaagagcataaaccaagagaatgct
H9GEA6_MCL1-01        ttggtgcctttgttgccaaacacctgaagagcataaaccaagagaatgct
                      ****       *          * ** ****  *   *   *** ***  

H9GPE7_BCL2-01        ----ccccccttgtggacaatattgctacgtggatgactgagtatctgaa
H9GHK7_BCL2L1-01      ----aagggttggtggtgaggattgccagctggatgaccacgtacctgac
H9GEA6_MCL1-02        atcaacactttaatagaaattatcactgatgtgctggtgacggacaagag
H9GEA6_MCL1-01        atcaacactttaatagaaattatcactgatgtgctggtgacggacaagag
                                *  * *  *  **  *      * **     * *   ** 

H9GPE7_BCL2-01        ccagtacctgcgcaactggatccaggagaacggaggctgg----------
H9GHK7_BCL2L1-01      tgaacacctggacccctggatccaagaaaacggtggctggaa--------
H9GEA6_MCL1-02        agaa------------tggctattgaaacataatgcctgggagggatttg
H9GEA6_MCL1-01        agaa------------tggctattgaaacataatgcctggca--------
                        *             *** *     *  *    * ****          

H9GPE7_BCL2-01        --------------------------------------------------
H9GHK7_BCL2L1-01      --------------atcaaaggggggacaaatcatttcagttatctacac
H9GEA6_MCL1-02        ttcagttcttccatgtagaggacatagaaggtggcatcaggaatgttctg
H9GEA6_MCL1-01        --------------------------------------------------

H9GPE7_BCL2-01        --------------------------------------------------
H9GHK7_BCL2L1-01      gcatcattccgaagtctgtctga---------acacttacattgattga-
H9GEA6_MCL1-02        gtggcttttgccagtgtggctggaataggggcaggcttggcctacatgat
H9GEA6_MCL1-01        ----------caactgtgtctga---------------------------

H9GPE7_BCL2-01        -------
H9GHK7_BCL2L1-01      -------
H9GEA6_MCL1-02        ccggtga
H9GEA6_MCL1-01        -------

© 1998-2020Legal notice