Dataset for CDS BCL-2-like of organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H9GPE7_BCL2-01          atggctca--------------tcctgggataagaggttacgacaa----
A0A803T0A4_MCL1-01      atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcat
A0A803T0A4_MCL1-02      atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcat
A0A803T0A4_MCL1-03      atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcat
H9GHK7_BCL2L1-01        atgtcgagcagtaa------------------------------------
                        ***                                               

H9GPE7_BCL2-01          ----cagggaaatc------------------------------------
A0A803T0A4_MCL1-01      ggccccgaacacgccggcctcacctggagccggcggaggcgtcggagaaa
A0A803T0A4_MCL1-02      ggccccgaacacgccggcctcacctggagccggcggaggcgtcggagaaa
A0A803T0A4_MCL1-03      ggccccgaacacgccggcctcacctggagccggcggaggcgtcggagaaa
H9GHK7_BCL2L1-01        ----ccgagcgctc------------------------------------
                            * *      *                                    

H9GPE7_BCL2-01          ------------------------gtgctgaggtacatccattacaagc-
A0A803T0A4_MCL1-01      gtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcc
A0A803T0A4_MCL1-02      gtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcc
A0A803T0A4_MCL1-03      gtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcc
H9GHK7_BCL2L1-01        ------------------------gtggtggacttcctttcctacaagc-
                                                * *  *   *           * ** 

H9GPE7_BCL2-01          --------tgtcgcagaaaggatatgac--tgggttgccagtgga-----
A0A803T0A4_MCL1-01      tcaggtcttttctcagagaggccgcgccctctgattggcggggggcctcg
A0A803T0A4_MCL1-02      tcaggtcttttctcagagaggccgcgccctctgattggcggggggcctcg
A0A803T0A4_MCL1-03      tcaggtcttttctcagagaggccgcgccctctgattggcggggggcctcg
H9GHK7_BCL2L1-01        --------tgtcgcagcggggccacagc-------tggcatgaga--ttg
                                * ** ***   **      *       ** *    *      

H9GPE7_BCL2-01          ------------gacag---------------aggaaaccttgctgctgc
A0A803T0A4_MCL1-01      cgccggacccctgagggcgctgattggcccctgggaggggtctcagcggg
A0A803T0A4_MCL1-02      cgccggacccctgagggcgctgattggcccctgggaggggtctcagcggg
A0A803T0A4_MCL1-03      cgccggacccctgagggcgctgattggcccctgggaggggtctcagcggg
H9GHK7_BCL2L1-01        agatg-------gagagcg-------------gggagg---------aag
                                    **  *                ***              

H9GPE7_BCL2-01          tgctgctgctgctgctgctactcctagtg-------------ctccaact
A0A803T0A4_MCL1-01      cgctgat----tggctgcgacgctgagggagaaggagagcaaccaaaatg
A0A803T0A4_MCL1-02      cgctgat----tggctgcgacgctgagggagaaggagagcaaccaaaatg
A0A803T0A4_MCL1-03      cgctgat----tggctgcgacgctgagggagaaggagagcaaccaaaatg
H9GHK7_BCL2L1-01        cgatg-----------gagccagcaaacgagacggggaacaccctcaatg
                         * **           *   *    *  *             *   **  

H9GPE7_BCL2-01          gtgtc-------agcatctctttcccca---------gagcttctcaatt
A0A803T0A4_MCL1-01      gcgccc------ggcctccctgccgctgcctgaaggggagctcgacggct
A0A803T0A4_MCL1-02      gcgccc------ggcctccctgccgctgcctgaaggggagctcgacggct
A0A803T0A4_MCL1-03      gcgccc------ggcctccctgccgctgcctgaaggggagctcgacggct
H9GHK7_BCL2L1-01        ggagcccttcttggcatcccagccccagcc--------------atgtca
                        *   *        ** ** *   * *                        

H9GPE7_BCL2-01          ctgat----cctgtgagta----------------------ccaatgccc
A0A803T0A4_MCL1-01      gcgaggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccc
A0A803T0A4_MCL1-02      gcgaggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccc
A0A803T0A4_MCL1-03      gcgaggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccc
H9GHK7_BCL2L1-01        tcaatggggcctcagaaca--------------------ccccgaactcc
                           *     **   **  *                       * *   **

H9GPE7_BCL2-01          cca----------------------gggaagaa-----------------
A0A803T0A4_MCL1-01      tcgccggacaaagagatggcggaggaggaaggagagaaagggaaaggagg
A0A803T0A4_MCL1-02      tcgccggacaaagagatggcggaggaggaaggagagaaagggaaaggagg
A0A803T0A4_MCL1-03      tcgccggacaaagagatggcggaggaggaaggagagaaagggaaaggagg
H9GHK7_BCL2L1-01        ttg-------aaga------ggaggaggaagaa-----------------
                                                  ***** *                 

H9GPE7_BCL2-01          -------------------------cctgacccggtgccacaggttgtcc
A0A803T0A4_MCL1-01      gccccctctcttcccggaccacctgcggaagacgacgctggaagtggtag
A0A803T0A4_MCL1-02      gccccctctcttcccggaccacctgcggaagacgacgctggaagtggtag
A0A803T0A4_MCL1-03      gccccctctcttcccggaccacctgcggaagacgacgctggaagtggtag
H9GHK7_BCL2L1-01        ----------------------------aacccgagggtgga--tgtcag
                                                     *  **  *    *  *     

H9GPE7_BCL2-01          atacaacattacgccaagccggagatgagttct--cccgacgctatcgg-
A0A803T0A4_MCL1-01      gccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccggg
A0A803T0A4_MCL1-02      gccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccggg
A0A803T0A4_MCL1-03      gccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccggg
H9GHK7_BCL2L1-01        ccagacactta-gggaggctggcgatgagtttgaa--ctaaggtaccgg-
                                 *  *  * ** *  ** ***        * * *  * *** 

H9GPE7_BCL2-01          --------------------------agggactttgctcaaatgtctggc
A0A803T0A4_MCL1-01      cccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaa
A0A803T0A4_MCL1-02      cccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaa
A0A803T0A4_MCL1-03      cccaagttctccttccaaggcttgctggggcgcttcgggagcagccccaa
H9GHK7_BCL2L1-01        --------------------------cgggcttttagtgacctgacctcc
                                                   ***   **    *   * *    

H9GPE7_BCL2-01          ca-----------------gctgcatttgaccc-------------ccag
A0A803T0A4_MCL1-01      cgaggcggaggtggcgcgcgcgctggag-acgctgcgccgggtgggcgag
A0A803T0A4_MCL1-02      cgaggcggaggtggcgcgcgcgctggag-acgctgcgccgggtgggcgag
A0A803T0A4_MCL1-03      cgaggcggaggtggcgcgcgcgctggag-acgctgcgccgggtgggcgag
H9GHK7_BCL2L1-01        ca-----------------gctccacatcaccttgggcacggcataccag
                        *                  **        **               * **

H9GPE7_BCL2-01          cactgccagaag--tcgttttgtggcc-----------------------
A0A803T0A4_MCL1-01      agcctccgggagaagcacctgctggccttccaaggaatgcttagaaagtt
A0A803T0A4_MCL1-02      agcctccgggagaagcacctgctggccttccaaggaatgcttagaaagtt
A0A803T0A4_MCL1-03      agcctccgggagaagcacctgctggccttccaaggaatgcttagaaagtt
H9GHK7_BCL2L1-01        agcttcgagcag--------------------------------------
                          *  *  * **                                      

H9GPE7_BCL2-01          ----------------------------------------gtggtggaag
A0A803T0A4_MCL1-01      ggaaataaagaaagaagaggacttggcgtctgtggcagaagtgacaacag
A0A803T0A4_MCL1-02      ggaaataaagaaagaagaggacttggcgtctgtggcagaagtgacaacag
A0A803T0A4_MCL1-03      ggaaataaagaaagaagaggacttggcgtctgtggcagaagtgacaacag
H9GHK7_BCL2L1-01        ----------------------------------------gtggtgaatg
                                                                ***      *

H9GPE7_BCL2-01          agctcttccaggacgg---tgtgaactgggggaggattgtggcgttcttt
A0A803T0A4_MCL1-01      aggtcttcagagatggcataataaactggggccgcattgtgactctcatc
A0A803T0A4_MCL1-02      aggtcttcagagatggcataataaactggggccgcattgtgactctcatc
A0A803T0A4_MCL1-03      aggtcttcagagatggcataataaactggggccgcattgtgactctcatc
H9GHK7_BCL2L1-01        aactcttccacgatgg---ggtaaactgggggcggatagtggcattcttc
                        *  *****   ** **     * ********  * ** *** *  ** * 

H9GPE7_BCL2-01          gaatttgg------tggcatgctgtgcgtggagagtgtcagccgggag-a
A0A803T0A4_MCL1-01      tcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaa
A0A803T0A4_MCL1-02      tcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaa
A0A803T0A4_MCL1-03      tcttttggtgcctttgttgccaaacacctgaagagcataaaccaagagaa
H9GHK7_BCL2L1-01        tcctttgg------gggagccctgtgcgtggagagcgttgacaaagag-a
                           *****       *          * ** ****  *   *   *** *

H9GPE7_BCL2-01          tgt-----ccccccttgtggacaatattgctacgtggatgactgagtatc
A0A803T0A4_MCL1-01      tgctatcaacactttaatagaaattatcactgatgtgctggtgacggaca
A0A803T0A4_MCL1-02      tgctatcaacactttaatagaaattatcactgatgtgctggtgacggaca
A0A803T0A4_MCL1-03      tgctatcaacactttaatagaaattatcactgatgtgctggtgacggaca
H9GHK7_BCL2L1-01        tgc-----aagggttggtggtgaggattgccagctggatgaccacgtacc
                        **            *  * *  *  **  *      * **     * *  

H9GPE7_BCL2-01          tgaaccagtacctgcgcaactggatccaggagaacggaggctgggtatgt
A0A803T0A4_MCL1-01      agagagaa------------tggctattgaaacataatgcctggcaacgt
A0A803T0A4_MCL1-02      agagagaa------------tggctattgaaacataatgcctggcaacgt
A0A803T0A4_MCL1-03      agagagaa------------tggctattgaaacataatgcctggga--gg
H9GHK7_BCL2L1-01        tgactgaacacctggacccctggatccaagaaaacggtggctgggagcga
                         **   *             *** *     *  *    * ****    * 

H9GPE7_BCL2-01          ggctcattgtctttgtctttttctgtttcaaggtcatacatcactgaaac
A0A803T0A4_MCL1-01      g-----ctcggctcggcagcg----ccactctgcggatccacctcgaagc
A0A803T0A4_MCL1-02      g-----ctcggctcggcagcg----ccactctgcggatccacctcgaagc
A0A803T0A4_MCL1-03      g-----atttgttcagttctt----ccatgtagagg----acatagaagg
H9GHK7_BCL2L1-01        t-----ttgtggacgtctacgggaacgatgcggccgccaaaagcaggaag
                               *                        *            * *  

H9GPE7_BCL2-01          atccattc-cggtgtcacaaatggcttgtgtgaccagtggttcccagt--
A0A803T0A4_MCL1-01      agtcactctcgttttcctcaattttca---agtccaggctgttttcgt--
A0A803T0A4_MCL1-02      agtcactctcgttttcctcaattttca---agtccaggctgttttcgt--
A0A803T0A4_MCL1-03      tggca---------tcaggaat---------gttctggtggcttttgc--
H9GHK7_BCL2L1-01        ggccaggaacgcttcaacaagtggctc---tggacagg-ggccaccgtgg
                           **              * *         *  * *         *   

H9GPE7_BCL2-01          --gcggtgtcacttgtaaagttgttccaagggcattttgcttattccgaa
A0A803T0A4_MCL1-01      ccgccatggcttccttggatctgagagaggaaagcagcagcacaactgtg
A0A803T0A4_MCL1-02      ccgccatggcttccttggatctgagagaggaaagcagcagcacacctgtc
A0A803T0A4_MCL1-03      cag-tgtggc-----tgga----ataggggcaggc-ttggcctacatgat
H9GHK7_BCL2L1-01        ccggtgtggtgctcctgggct-------------------ccctcctgag
                          *   **       *                               *  

H9GPE7_BCL2-01          caaaaggtgacaaccagttattatag
A0A803T0A4_MCL1-01      t-----ctga----------------
A0A803T0A4_MCL1-02      c-----gtga----------------
A0A803T0A4_MCL1-03      ccg---gtga----------------
H9GHK7_BCL2L1-01        ccgcaagtag----------------
                               *                  

© 1998-2022Legal notice