Dataset for CDS BOK of Organism Gopherus agassizii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A452GV90_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gopherus agassizii GN=BOK (length=570 residues).
atggaggtgctacgccgttcctcggtctttgctgcggaggtgatggaggtttttgatcggtctcccaccgacaaggagct
ggtgtcccaggctaaggtgctctgcagagactacatacattcccggctgcttcgggctggcattggctggagcaaaccag
agcacagtgcacccatgcctggcggcagactggctgaggtgtccagcgtgcttctgcgactaggggacgagctagaatac
atccgaccaaacatttaccggaatattgcccgccagctgaacatctcactgcactccgagaccgtggtgactgacgcctt
cttggcagtagcagcccagatcttcacagcaggtacagatgtctgtctgggctgtgttggaaacaaactgaaatataaac
tctgctatttagcgttcagcttattaagaaaacagtccaggtctgggactacagccctgctcaagtgcccactctctgta
ccttcctgctgggcagtttttctctccttttaccccttctcctctcttactccattcttattccttcctcgacccctagt
gcagcactga
© 1998-2023Legal notice