Dataset for CDS BCL-2 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q6R755_BCL2-01      atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacat
Q75SV7_BCL2-01      atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccac
                    ******** ** *** ********** ************** ************** ** 

Q6R755_BCL2-01      tataagctgtcacagaggggctacgagtgggatgtgggagatgtggacgccgcgcccctg
Q75SV7_BCL2-01      tacaagctgtcgcagaggggctacgagtgggacgcgggagaggcgggcgccgcgcccccg
                    ** ******** ******************** * ****** * ** *********** *

Q6R755_BCL2-01      ggcgccgcccccacccctggcatcttctccttccagcctgagagcaacccaacgcccgct
Q75SV7_BCL2-01      ggggccgcccccgcgccgggcatcttctcctcgcagcccggccgcgcccccgcgcccg--
                    ** ********* * ** *************  ***** *   **  ***  ******  

Q6R755_BCL2-01      gtgcaccgggacatggctg--------ccaggacatcgccactaaggc--------ccat
Q75SV7_BCL2-01      -----ccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgc
                         ** **** * ** *        **  * *  * ** **   **        **  

Q6R755_BCL2-01      agtcgccaccactgggcctacccttagccccgtgccacctgtggtccacctgaccctccg
Q75SV7_BCL2-01      cgccgacgccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcg
                     * ** * ** * ** **  * *  ******************************** **

Q6R755_BCL2-01      ccgggctggggatgacttctcccgtcgctaccgtcgcgacttcgcggagatgtccagtca
Q75SV7_BCL2-01      ccaggccggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagcca
                    ** *** ** ** *********** ******** *********** *********** **

Q6R755_BCL2-01      gctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctctt
Q75SV7_BCL2-01      gctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctctt
                    ************************************************************

Q6R755_BCL2-01      cagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtg
Q75SV7_BCL2-01      cagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtg
                    *************************** ********************************

Q6R755_BCL2-01      tgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgac
Q75SV7_BCL2-01      tgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgac
                    ************************************************************

Q6R755_BCL2-01      tgagtacctgaaccggcatctgcacacctggatccaggacaacggaggctgggatgcctt
Q75SV7_BCL2-01      tgagtacctgaaccggcatctgcacacctggatccaggacaacggaggctgggatgcctt
                    ************************************************************

Q6R755_BCL2-01      tgtggaactgtacggccccaccatgcagcctctgtttgatttctcctggctgtctctgaa
Q75SV7_BCL2-01      tgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggctgtctctgaa
                    *************************************** ********************

Q6R755_BCL2-01      ggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggcca
Q75SV7_BCL2-01      ggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggcca
                    ************************************************************

Q6R755_BCL2-01      taagtga
Q75SV7_BCL2-01      taagtga
                    *******

© 1998-2022Legal notice