Dataset for CDS BCL-2 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q6R755_BCL2-01      atggcgcaagccgggaga---acagggtatgataaccgggagatcgtgatgaagtacata
E2QWA1_BCL2-01      ccctttcagtttgggggatgcccagtgtcct-tttccggg-------------------c
E2QWA1_BCL2-02      atggcgcacgctgggcga---acagggtacgataaccgggagatagtgatgaagtacatc
Q75SV7_BCL2-01      atggcgcacgctgggcga---acagggtacgataaccgggagatagtgatgaagtacatc
                          **    *** **    *** **    *  *****                    

Q6R755_BCL2-01      cattataagctgtcacagaggggctacgagtgggatgtgggagatgtggacgccgcgccc
E2QWA1_BCL2-01      cagaacttgcttcccc----------------------------------cccccccccc
E2QWA1_BCL2-02      cactacaagctgtcgcagaggggctacgagtgggacgcgggagaggcgggcgccgcgccc
Q75SV7_BCL2-01      cactacaagctgtcgcagaggggctacgagtgggacgcgggagaggcgggcgccgcgccc
                    **  *   ***  * *                                  * ** * ***

Q6R755_BCL2-01      ctgggc------gccgcccccacccctg--gcatcttctccttccagcctgagagcaacc
E2QWA1_BCL2-01      ccagggccacctgccgccgccgccgccgccgcctttccccctcgt---------------
E2QWA1_BCL2-02      ccgggg------gccgcccccg-cgccg-ggcatctccgcctcgcagnnnnnnnnnnnnn
Q75SV7_BCL2-01      ccgggg------gccgcccccg-cgccg-ggcatcttctcctcgcagcccggccgcgccc
                    *  **       ****** **  * * *  ** * * * ***                  

Q6R755_BCL2-01      caacgcccg---------ctgtgcaccgggacatggctgccaggacatcgccactaaggc
E2QWA1_BCL2-01      ------------------------------------------------------------
E2QWA1_BCL2-02      ------------------nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Q75SV7_BCL2-01      ccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccg

Q6R755_BCL2-01      ccatagtcgccaccactgggcctacccttagccccgtgccacctgtggtccacctgaccc
E2QWA1_BCL2-01      -----------------gctcctnnnnncagccccgtgccacctgtggtccacctgaccc
E2QWA1_BCL2-02      nnnnnnnnnnnnnnnnnnnnnnnnnnnncagccccgtgccacctgtggtccacctgaccc
Q75SV7_BCL2-01      ccgccgccgacgccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccc

Q6R755_BCL2-01      tccgccgggctggggatgacttctcccgtcgctaccgtcgcgacttcgcggagatgtcca
E2QWA1_BCL2-01      tgcgccaggccggcgacgacttctcccgccgctaccggcg---tttcgccgagatgtcca
E2QWA1_BCL2-02      tgcgccaggccggcgacgacttctcccgccgctaccggcg---tttcgccgagatgtcca
Q75SV7_BCL2-01      tgcgccaggccggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtcca
                    * **** *** ** ** *********** ******** **    ***** **********

Q6R755_BCL2-01      gtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
E2QWA1_BCL2-01      gccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
E2QWA1_BCL2-02      gccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
Q75SV7_BCL2-01      gccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
                    * **********************************************************

Q6R755_BCL2-01      tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtca
E2QWA1_BCL2-01      tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtca
E2QWA1_BCL2-02      tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtca
Q75SV7_BCL2-01      tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtca
                    ******************************* ****************************

Q6R755_BCL2-01      tgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtgga
E2QWA1_BCL2-01      tgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtgga
E2QWA1_BCL2-02      tgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtgga
Q75SV7_BCL2-01      tgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtgga

Q6R755_BCL2-01      tgactgagtacctgaaccggcatctgcacacctggatccaggacaacggaggctgggatg
E2QWA1_BCL2-01      tgactgagtacctgaaccggcatctgcacacctggatccaggacaacggaggctgggatg
E2QWA1_BCL2-02      tgactgagtacctgaaccggcatctgcacacctggatccaggacaacggaggctgggatg
Q75SV7_BCL2-01      tgactgagtacctgaaccggcatctgcacacctggatccaggacaacggaggctgggatg

Q6R755_BCL2-01      cctttgtggaactgtacggccccaccatgcagcctctgtttgatttctcctggctgtctc
E2QWA1_BCL2-01      cctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggctgtctc
E2QWA1_BCL2-02      cctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggctgtctc
Q75SV7_BCL2-01      cctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggctgtctc
                    ******************************************* ****************

Q6R755_BCL2-01      tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgg
E2QWA1_BCL2-01      tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgg
E2QWA1_BCL2-02      tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgg
Q75SV7_BCL2-01      tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgg

Q6R755_BCL2-01      gccataagtga
E2QWA1_BCL2-01      gccataagtga
E2QWA1_BCL2-02      gccataagtga
Q75SV7_BCL2-01      gccataagtga

© 1998-2022Legal notice