Dataset for CDS BCL-2 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q6R755_BCL2-01          atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaa
A0A8C0RVL3_BCL2-01      atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaa
Q75SV7_BCL2-01          atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaa
                        ******** ** *** ********** ************** ********

Q6R755_BCL2-01          gtacatacattataagctgtcacagaggggctacgagtgggatgtgggag
A0A8C0RVL3_BCL2-01      gtacatccactacaagctgtcgcagaggggctacgagtgggacgcgggag
Q75SV7_BCL2-01          gtacatccactacaagctgtcgcagaggggctacgagtgggacgcgggag
                        ****** ** ** ******** ******************** * *****

Q6R755_BCL2-01          atgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctcc
A0A8C0RVL3_BCL2-01      aggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcc
Q75SV7_BCL2-01          aggcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcc
                        * * ** *********** *** ********* * ** ******* * **

Q6R755_BCL2-01          ttccagcctgagagcaacccaacgcccgctgtgcaccgggacatggctg-
A0A8C0RVL3_BCL2-01      tcgcagcccggccgcgcccccgcgcccg-------ccaggacctcgccgc
Q75SV7_BCL2-01          tcgcagcccggccgcgcccccgcgcccg-------ccaggacctcgccgc
                        *  ***** *   **  ***  ******       ** **** * ** * 

Q6R755_BCL2-01          -ccaggacatcgccactaaggc-----ccatagtcgc---------cacc
A0A8C0RVL3_BCL2-01      ccccgccccccgccgcccccgccgccgccgccgccgc---------cgcc
Q75SV7_BCL2-01          ccccgccccccgccgcccccgctgccgccgccgccgccgccgccgacgcc
                         ** *  *  **** *    **     **   * ***         * **

Q6R755_BCL2-01          actgggcctacccttagccccgtgccacctgtggtccacctgaccctccg
A0A8C0RVL3_BCL2-01      gcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcg
Q75SV7_BCL2-01          gcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcg
                         * ** **  * *  ******************************** **

Q6R755_BCL2-01          ccgggctggggatgacttctcccgtcgctaccgtcgcgacttcgcggaga
A0A8C0RVL3_BCL2-01      ccaggccggcgacgacttctcccgccgctaccgccgcgacttcgccgaga
Q75SV7_BCL2-01          ccaggccggcgacgacttctcccgccgctaccgccgcgacttcgccgaga
                        ** *** ** ** *********** ******** *********** ****

Q6R755_BCL2-01          tgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgcc
A0A8C0RVL3_BCL2-01      tgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgcc
Q75SV7_BCL2-01          tgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgcc
                        ******* ******************************************

Q6R755_BCL2-01          acggtggtggaggagctcttcagggatggggtgaactgggggaggatcgt
A0A8C0RVL3_BCL2-01      acggtggtggaggagctcttcagggatggggtgaactgggggaggatcgt
Q75SV7_BCL2-01          acggtggtggaggagctcttcagggatggggtgaactgggggaggattgt
                        *********************************************** **

Q6R755_BCL2-01          ggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccggg
A0A8C0RVL3_BCL2-01      ggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccggg
Q75SV7_BCL2-01          ggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccggg
                        **************************************************

Q6R755_BCL2-01          agatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctg
A0A8C0RVL3_BCL2-01      agatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctg
Q75SV7_BCL2-01          agatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctg
                        **************************************************

Q6R755_BCL2-01          aaccggcatctgcacacctggatccaggacaacggaggctgggatgcctt
A0A8C0RVL3_BCL2-01      aaccggcatctgcacacctggatccaggacaacggaggctgggatgcctt
Q75SV7_BCL2-01          aaccggcatctgcacacctggatccaggacaacggaggctgggatgcctt
                        **************************************************

Q6R755_BCL2-01          tgtggaactgtacggccccaccatgcagcctctgtttgatttctcctggc
A0A8C0RVL3_BCL2-01      tgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggc
Q75SV7_BCL2-01          tgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggc
                        *************************************** **********

Q6R755_BCL2-01          tgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcacc
A0A8C0RVL3_BCL2-01      tgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcacc
Q75SV7_BCL2-01          tgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcacc
                        **************************************************

Q6R755_BCL2-01          ctgggtgcctatctgggccataagtga
A0A8C0RVL3_BCL2-01      ctgggtgcctatctgggccataagtga
Q75SV7_BCL2-01          ctgggtgcctatctgggccataagtga
                        ***************************

© 1998-2022Legal notice